L’altération du flux de glucose dans les chondrocytes humains
arthrosiques par le 4-hydroxynonénal
Alain Baho, Centre de r...
Introduction :
L’arthrose
L’arthrose (OA) est une maladie articulaire chronique et multifactorielle, caractérisée
par les ...
l’inflammation synoviale débute (Blanco, López-Armada et al. 2004). En effet, lorsque les
cellules synoviales ingèrent les...
médiateurs de l’inflammation et des cytokines tels que le NO, les prostaglandines, l’interleukine-
1 bêta (l’IL-1β), IL-6,...
par exemple, est induit par des stimuli pro-inflammatoires et est caractérisé par la sécrétion de
protéases, par la suppre...
membrane synoviale, puisque l’échange est facilité par l’augmentation de la densité des
capillaires fenêtrés situés tout p...
articulaire même en condition aérobie (Otte 1991; Lee and Urban 1997; Blanco, López-Armada
et al. 2004). D’ailleurs, on su...
et al. 2002). Son expression apparaît augmentée par la privation du glucose et l’hypoxie-
ischémique prolongée ainsi qu’en...
2) la modification des GLUTs quant à leur affinité pour le glucose (Shikhman, Brinson et al.
2004)
La dégradation du carti...
(Dore, Pelletier et al. 1994). Un faible changement dans la concentration de glucose, dans le
micro-environnement de l’ECM...
constituants de l’articulation tels que le collagène, les protéoglycanes et les hyluronanes
(Dimock, Siciliano et al. 2000...
des patients OA (Grigolo, Roseti et al. 2003). Dans les cellules, la plupart d’HNE est généré par
des réactions non-enzyma...
additions de Michael avec les résidus nucléophiles lysyls, sulfhydriles ou histidyls, ou encore, il
peut former des comple...
rapporté que le HNE pourrait induire le catabolisme du cartilage en agissant sur le plan
transcriptionel et post-traductio...
MATÉRIELS ET MÉTHODES:
Culture cellulaire et sélection de spécimens :
Les spécimens de cartilage ont été obtenus auprès de...
chauffé à 37ºC, puis mises de nouveau en culture pendant 20 minutes dans du DMEM sans
glucose contenant 10Ci/ml de [3
H]2...
Immunobuvardage de type western :
Le niveau d’expression de GLUT-1 et -9 a pu être détecté à l’aide de la méthode
d’immuno...
Dosage de l’ARN
Afin d’évaluer le plus précisément possible la quantité d’ARN recueillie, le dosage a
été effectué à l’aid...
pendant trois minutes. Une fois l’acide désoxyribonucléique complémentaire (ADNc) synthétisé,
il est conservé à -20o
C jus...
Ratio d’efficacité d’amplification = pente des dilutions du gène étudié/ pente des dilutions du
gène de référence.
Analyse...
3. RESULTATS:
3.1 Effet de 10 M de HNE en fonction du temps d’incubation sur l’influx du [3
H] 2-
DG dans les chondrocyte...
3.2 Effet de 10µM de HNE en fonction du temps d’incubation sur l’expression de la
GLUT-1 dans les chondrocytes OA :
Afin d...
0
2
4
8
16
24
0
10
20
30
40
50
60
70
80
90
100
110
***
**
**
A GLUT 1
-Actine
0 2 4 8 16 24
Temps d'incubation (h)
GLUT1
...
3.3 Effet de 10 µM de HNE en fonction du temps d’incubation sur l’expression et la
régulation de la GLUT-9 dans les chondr...
0
2
4
8
16
24
0
10
20
30
40
50
60
70
80
90
100
110
120 *
*** **
**
A
0 2 4 8 16 24
GLUT9
-Actine
Temps d'incubation (h)
G...
Discussion :
L’OA est une maladie répandue. Pourtant, les causes de cette pathologie demeurent
peu connues. Le stress oxyd...
Les résultats de cette étude démontrent une diminution proportionnelle du flux de glucose
en fonction du temps d’incubatio...
voie de signalisation impliquée dans la régulation de GLUT-1 et GLUT-9 (Uchida 2003). Des
etudes plus poussée sont nécessa...
prochaines études doivent prendre en considération certains points : premièrement, les niveaux
d’expression des autres GLU...
Ahmed, I., A. John, et al. (2002). "Differential modulation of growth and glutathione metabolism
in cultured rat astrocyte...
Grigolo, B., L. Roseti, et al. (2003). "Enhanced lipid peroxidation in synoviocytes from patients
with osteoarthritis." J ...
Mason, R. M., J. H. Kimura, et al. (1982). "Biosynthesis of hyaluronic acid in cultures of
chondrocytes from the Swarm rat...
Rosenbloom, A. L. and J. H. Silverstein (1996). "Connective tissue and joint disease in diabetes
mellitus." Endocrinol Met...
Prochain SlideShare
Chargement dans…5
×

Rapport-projet Final- Les Chondrocytes sous l'Effet de 4-HNE

17 vues

Publié le

0 commentaire
0 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Vues
Nombre de vues
17
Sur SlideShare
0
Issues des intégrations
0
Intégrations
1
Actions
Partages
0
Téléchargements
1
Commentaires
0
J’aime
0
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

Rapport-projet Final- Les Chondrocytes sous l'Effet de 4-HNE

  1. 1. L’altération du flux de glucose dans les chondrocytes humains arthrosiques par le 4-hydroxynonénal Alain Baho, Centre de recherches de l’hôpital du Sacré-Coeur de Montréal (Université de Montréal). Résumé L’arthrose (OA) est une maladie multifactorielle dans laquelle chacun des différents tissus de l’articulation joue un rôle. Le 4-hydroxynonénal (HNE), un produit final de la peroxydation lipidique, contribue à la pathogénèse de l’OA par sa capacité de stimuler les réponses cataboliques et inflammatoires dans des tissus articulaires arthrosiques. le glucose est la principale source d'énergie pour les chondrocytes articulaires, et est le précurseur de la glycosaminoglycanes de matrice extracellulaire du cartilage. Ce qui rendre l’altération de flux de glucose critique au maintiens l’homéostasie de chondrocytes. Les chondrocytes expriment plusieurs transporteurs de glucose (GLUTs) y compris les isoformes GLUT-1 et -9. L’objectif de cette étude est d’étudier l’effet de HNE sur le flux de glucose dans les chondrocytes OA, en étudiant parallèlement son effet sur l’expression protéique et d’ARNm de GLUT-1 et -9, puisque les GLUTs forment l’étape limitant de métabolisme de glucose. Les chondrocytes OA ont été incubés en présence de 10 µM HNE pendant 2, 4, 8, 16 h et 24h. Le flux de glucose étais mésuré par le [3H] 2-déoxyglucose, puis l’expression au niveau protéique et ARNm des différentes enzymes ont été évaluées par spectrophotométries, immunobuvardages de type Western et RT- PCR en temps réel. Le traitement des chondrocytes OA avec le HNE réduit, l’activité et l’expression d’ARNm des GLUTs en fonction du temps d’incubation avec une expression protéique faiblement réduit. Donc, le HNE est capable d’altérer le flux de glucose, soit par la formation des complexes HNE/GLUTs, ou bien au niveau d’ARNm, en affectant la stabilité des ARNm des GLUTs ou par l’inactivation de certaine voie de signalisation impliquée dans la régulation de GLUT-1 et GLUT-9. Ces données ainsi que l’augmentation de la production du HNE dans les tissus articulaires OA telle que rapportée dans la littérature suggèrent l’implication du HNE dans la physiopathologie de cette maladie via l’altération du métabolisme des chondrocytes OA.
  2. 2. Introduction : L’arthrose L’arthrose (OA) est une maladie articulaire chronique et multifactorielle, caractérisée par les changements dégénératifs progressifs de la composition, des structures et des fonctions du cartilage articulaire et des autres tissus articulaires (l’os sous-chondral et la membrane synoviale). L’OA, qui est la pathologie d’arthrite la plus courante, touche 10% de la population canadienne, est l’une des causes principales de limitations fonctionnelles chez les personnes âgées. Sa prévalence est plus élevée avant 45 ans chez les hommes et après 55 ans chez les femmes, cependant, à l’âge de 70 ans, la plupart de gens souffrent d’OA. Avec le vieillissement et l’augmentation du taux de l’obésité de la population, la maladie va toucher une tranche plus grande de la population canadienne et mondiale dans un futur proche. Le traitement actuel ne vise que les symptômes, se qui demande une meilleure compréhension de la maladie pour arrêter sa progression.!!!! Par définition, l’OA est décrite comme un trouble non inflammatoire progressif et chronique de l’articulation menant à la détérioration du cartilage articulaire et elle est associé à la détérioration de l’os à la surface et aux bords de l’articulation(Buckwalter and Martin 2006). La progression de la maladie se divise en trois étapes : La première, implique la destruction protéolytique de la matrice cartilagineuse. Suite par l’étape de fibrillation et de l’érosion de la surface du cartilage. Par ailleurs, les fissures et l’apparition de graves ulcérations peuvent mener à l’entière disparition du cartilage à la surface de l’articulation et elles sont accompagnées par le relâchement de produits de la destruction dans le liquide synovial. L’étape finale est celle où
  3. 3. l’inflammation synoviale débute (Blanco, López-Armada et al. 2004). En effet, lorsque les cellules synoviales ingèrent les produits de la dégradation par phagocytose, elles produisent de nombreux médiateurs inflammatoires et cataboliques tels que les protéases et les cytokines proinflammatoires(Blanco, López-Armada et al. 2004). L’étiologie exacte d’OA demeure inconnue, il semble que certains facteurs de risques systémiques sont susceptibles d’augmenter le risque de cette maladie, ce qui suggère que ce soit une maladie multifactorielle. On retrouve entre autres les changements sur le plan structurel, moléculaire et mécanique liés au vieillissement, aux hormones sexuelles, en particulier à l’œstrogène, à la densité osseuse, à la génétique et à la nutrition. La pression exercée par le poids du corps joue aussi un rôle important, puisque l’obésité accroît le risque d’arthrose, parce qu’elle impose un stress aux articulations portantes, comme les hanches et les genoux. D’autres facteurs de risques tels que les facteurs biomécaniques locaux semblent, quant à eux, jouer un rôle décisif dans la détérioration du cartilage suite à l’exposition de l’articulation aux microtraumatismes répétés et aux charges excessives appliquées à l’articulation(Brandt, Dieppe et al. 2008). La production excessive des médiateurs inflammatoires et cataboliques par la membrane synoviale enflammée et les chondrocytes activés soit impliquée dans la pathophysiologie de l’OA (Fernandes, Martel-Pelletier et al. 2002). Ces médiateurs sont associés à des altérations fonctionnelles, non seulement au niveau synovial, mais aussi au niveau du cartilage et de l’os sous-chondral. Ils seraient d’abord produits par la membrane synoviale et ils diffuseraient dans le cartilage en passant d’abord par le liquide synovial. Une fois activés, les chondrocytes peuvent aussi produire des protéases ainsi que d’autres facteurs cataboliques. En effet, il semblerait que les chondrocytes OA soient une source importante de métalloprotéinases (MMP). En plus des MMP, il est de plus en plus reconnu que les chondrocytes ont la capacité de sécréter des
  4. 4. médiateurs de l’inflammation et des cytokines tels que le NO, les prostaglandines, l’interleukine- 1 bêta (l’IL-1β), IL-6, IL-8 et le facteur de nécrose de tumeur alpha (TNF-α)(Caron, Fernandes et al. 1996 ). De plus, cette cascade serait responsable du catabolisme, de l’apoptose des chondrocytes et d’autres changements structurels associés à la progression de la maladie. Le cartilage Le cartilage articulaire est de type hyalin. C’est un tissu conjonctif composé par un seul type cellulaire appelé : les chondrocytes, entourés complètement par la matrice extracellulaire (MEC), secrétée, synthétisée et dégradée par les chondrocytes eux-mêmes(Buckwalter, Mankin et al. 2005). Ces cellules, ne forment que 2% du volume total de ce tissu, possèdent une morphologie et probablement des activités métaboliques différentes selon leurs localisations dans les différentes zones du cartilage (la zone superficielle - la zone mitoyenne- les zones profondes et calcifiées) (Poole, Kojima et al. 2001). Toutefois, elles ne se divisent pas après le passage à l’adolescence et possèdent tous un réticulum endoplasmique et un appareil de Golgi bien développés permettant la synthèse de la MEC(Aydelotte and Kuettner 1988). Cette dernière est constituée par 2 composants majeurs : un réseau de fibre de collagène de type 2 (CII), qui donne au cartilage sa résistance à la pression (Gelse, Pöschl et al. 2003), et un gel de protéoglycanes hydrophiles, qui fournit au cartilage une certaine rigidité face à la compression (Knudson and Knudson 2001 ). Le rôle fonctionnel du cartilage est de répartir la pression mécanique partout et fournit une surface lisse et dynamique pour passer le mouvement sans douleur. Les chondrocytes sont très actifs métaboliquement et expriment différents programmes fonctionnels pour maintenir l’homéostasie lors du remodelage du cartilage suite à un traumatisme ou à une inflammation (Pelletier, DiBattista et al. 1993). Le programme catabolique,
  5. 5. par exemple, est induit par des stimuli pro-inflammatoires et est caractérisé par la sécrétion de protéases, par la suppression de la synthèse de la matrice et par l’inhibition de la prolifération des chondrocytes. La phase anabolique, au contraire, est associée à la sécrétion d’antagonistes des cytokines, à la synthèse d’inhibiteurs de protéases, à la production de la MEC et à la réplication cellulaire. Tous ces processus mentionnés précédemment nécessitent un apport nutritionnel et énergétique important et sont donc modulés par la balance entre la génération et la consommation d’adénosine triphosphates (ATP) (Otte 1991). En conditions normales, le cartilage n’est pas lié aux vaisseaux sanguins ou lymphatiques ni aux fibres nerveuses (Blanco, López-Armada et al. 2004), ce qui demande un système complexe pour la diffusion de tous les nutriments et les autres éléments essentiels aux activités métaboliques. En fait, les chondrocytes et la MEC dépendent l’une de l’autre, puisqu’en plus de protéger ces cellules des dommages mécaniques, la MEC assure aussi le passage des molécules (nutriments, substances nécessaires à la synthèse de la MEC, déchets métaboliques, facteurs de croissance, hormones et cytokines) autour des chondrocytes, et aussi, les mettre en réserve à l’intérieur même de la matrice (Buckwalter and Mankin 1998b). De plus, les chondrocytes possèdent une position clé dans le maintien et la réparation de la MEC durant la physiologie ou la pathophysiologie du cartilage, en utilisant les supports nutritionnels de la part des tissus adjacents. Les principales molécules requises pour synthétiser et maintenir la MEC sont : l’O2, le glucose, les aminoacides, les vitamines et les oligo-éléments. C’est pour cela, qu’une altération de la concentration de ces éléments peut conduire à la détérioration du fonctionnement normal des chondrocytes(Mobasheri, Vannucci et al. 2002). La majeure partie des nutriments et de l’oxygène (O2) du cartilage provient de deux origines distinctes. Premièrement et essentiellement à partir de la microcirculation de la
  6. 6. membrane synoviale, puisque l’échange est facilité par l’augmentation de la densité des capillaires fenêtrés situés tout près de la surface synoviale avec des fenestrations préférentiellement orientées vers la cavité synoviale, et pour s’assurer de la diffusion nécessaire de glucose aux chondrocytes, une microcirculation intra-articulaire de liquide synovial est générée, ce qui facilite le transport du glucose durant l’exercice physique et du chargement de poids (Levick 1995 ). L’autre source de nutriment est les capillaires sanguins de l’os sous- chondral, la plupart des canaux vasculaires sont séparés du cartilage par une couche d'os bien défini, ce qui réduit le passage des nutriments vers le cartilage (Clark 1990). Le glucose, est un métabolite essentiel à toutes les cellules vivantes, puisqu’il fournit une source d'énergie facile aux cellules. Il participe également dans la formation des squelettes de carbone pour la biosynthèse de macromolécules telles que les protéines, les lipides, les acides nucléiques et de complexe de polysaccharides (glycogène) et des proteoglycanes. Le Glucose joue un rôle métabolique et structurel important pour les chondrocytes, puisque c’est le précurseur de la synthèse des glycosaminoglycanes. Sa régulation et son flux dans la cellule ont donc des conséquences cruciales sur le développement et l’intégrité de ce tissu (Wang, Zhou et al. 1999). La diffusion du glucose et de l’O2 impliquant un long trajet, les concentrations de ces nutriments se voient diminuées dans la MEC des zones les plus profondes du cartilage. Plus précisément, les chondrocytes situés en surface, près du liquide synovial, sont probablement exposés à une tension normale en O2 qui se situerait entre 20 et 80 mm Hg , tandis que ceux, dans les régions profondes, la tension de l’O2 est beaucoup plus faible ou nulle (condition hypoxique) (Lee and Urban 1997). Chez les chondrocytes localisés dans les zone profonde et superficiel du cartilage, la glycolyse anaérobique et la production de lactate (un produit final et majeur dans la respiration anaerobique) impliquées dans le métabolisme respiratoire du cartilage
  7. 7. articulaire même en condition aérobie (Otte 1991; Lee and Urban 1997; Blanco, López-Armada et al. 2004). D’ailleurs, on suggère que la faible respiration aérobie des cellules du cartilage doit être une réponse d’adaptation à la faible tension en O2 (Marcus 1973). Pour cette raison, les chondrocytes sont des cellules hautement glycolytiques, ce qui requise un besoin régulière de glucose pour produire l’ATP et garder l’homéostasie de cellule (Otte 1991; Lee and Urban 1997). En l’absence de phosphorylation oxydative, les chondrocytes supportent leur condition hypoxique en générant principalement l’ATP par la voie glycolytique. Ainsi, le maintien de l’apport et du transport du glucose au niveau physiologique se retrouve modifié, ce qui occasionne alors des conséquences significatives sur le maintien du fonctionnement et de la viabilité des chondrocytes (Otte 1991; Lee and Urban 1997). Le transport transmembranaire du glucose est l’étape limitante du métabolisme du glucose. Il est facilité par une famille de transporteurs d’hexose (GLUT/SLC2A). Celle-ci est constituée par 13 transporteurs protéiques très homologues, caractérisés par leurs 12 passages transmembranaires et leurs séquences motifs conservées. Ils catalysent l’entrée du glucose dans toutes les cellules des mammifères et sont exprimés différemment selon les types de tissus et de cellules(Joost and Thorens 2001). Les chondrocytes expriment dans les conditions normales au moins trois isoformes de GLUT, soit la GLUT-1, –3, -6 (aussi appelé GLUT9) (Mobasheri, Neama et al. 2002). D’autres études ajoutent d’autres isoformes sur la liste comme la GLUT8 (Shikhman, Kuhn et al. 2001b)et les GLUT-5, - 10, -11 et -12 sont présentes dans les chondrocytes matures (Richardson, Neama et al. 2003). Le GLUT-1 est exprimé de façon ubiquitaire dans toutes les cellules adultes et fœtales (Zhao and Keating 2007). Dans les chondrocytes, sa présence est liée au besoin élevé de produire de l’énergie par la voie glycolytique en condition de faible tension en O2 (Mobasheri, Vannucci
  8. 8. et al. 2002). Son expression apparaît augmentée par la privation du glucose et l’hypoxie- ischémique prolongée ainsi qu’en présence de facteurs cataboliques et de cytokines proinflammatoires (Shikhman, Brinson et al. 2001; Richardson, Neama et al. 2003; Shikhman, Brinson et al. 2004; Phillips, Ferraz et al. 2005). Le GLUT-3 est le transporteur rapide du glucose. Au niveau basal, il transporte le glucose dans plusieurs types de cellules humaines. Ce transporteur possède une haute affinité pour son substrat et est spécialisé dans sa capture lorsque la concentration de glucose est basse(Zhao and Keating 2007). Il est susceptible d’être plus influent que les autres GLUTs en raison de son efficacité dans le transport du glucose. De plus, sa présence pourrait refléter une adaptation spécifique du cartilage à un environnement physiologique très pauvre en glucose (Mobasheri, Neama et al. 2002). Le GLUT-9 reste peu connu (Phay, Hussain et al. 2000). Ce transporteur a été détecté abondamment dans le foie et les reins, deux tissus ayant une forte capacité métabolique et capable de produire la gluconéogenèse (Phay, Hussain et al. 2000; Richardson, Neama et al. 2003). Toutefois, il se retrouve aussi dans d’autres tissus tels le placenta, les poumons, le cœur, le cartilage, etc.(Phay, Hussain et al. 2000; Richardson, Neama et al. 2003). D’autres études sont nécessaires pour déterminer avec exactitude le rôle physiologique du GLUT-9, entre autres dans le cartilage. Il a été suggéré que ce transporteur pourrait être impliqué dans la capture et le transport intracellulaire du glucose, dans la glycosylation de la matrice extracellulaire et la glycogénèse (Richardson, Neama et al. 2003; Mobasheri, Dobson et al. 2005). La régulation du transport du glucose peut être effectuée selon deux mécanismes principaux : 1) la modulation de la synthèse et de l’incorporation à la membrane des GLUTs; et
  9. 9. 2) la modification des GLUTs quant à leur affinité pour le glucose (Shikhman, Brinson et al. 2004) La dégradation du cartilage articulaire est un phénomène inhérent à l’OA qui est associé à l’altération du métabolisme du glucose (Sandell and Aigner 2001). De plus, de récentes études suggèrent que la dégénération du cartilage survient de manière concomitante avec des dysfonctions endocriniennes ou encore avec un déséquilibre au niveau du glucose (Arlan and Janet 1996). Les mécanismes moléculaires régulant l’apport en glucose et son métabolisme sont donc importants dans la physiologie du cartilage et dans la pathogénèse de l’OA (Shikhman, Brinson et al. 2004) Les GLUTs donnent le moyen d’accélérer le transport du glucose et d’augmenter l’utilisation de substrats en réponse à une stimulation proinflammatoire (Shikhman, Brinson et al. 2001; Shikhman, Kuhn et al. 2001b; Richardson, Neama et al. 2003). Les cytokines proinflammatoires telles que l’IL-1β et TNF-α stimulent l’expression et l’incorporation membranaire des GLUT-1 et -9 dans les chondrocytes articulaires humains normaux(Shikhman, Brinson et al. 2001). Les effets de l’IL-1β sur le transport du glucose, dans les chondrocytes, requièrent l’activation des protéines kinases C (PKC) et de la p38 MAP kinase (p38 MAPK) (Shikhman, Brinson et al. 2001). Contrairement à l’IL-1β, le facteur de croissance transformant bêta-1 (TGF  accélère le transport du glucose, en modifiant l’affinité des GLUT envers le glucose, sans affecter l’expression et l’incorporation des GLUTs (Shikhman, Brinson et al. 2004). L’effet du TGF  serait régulé, quant à lui, par les PKC et les ERK (Shikhman, Brinson et al. 2004). Un autre facteur, l’IGF-1, semble être impliqué dans la diminution observée dans l’OA de la croissance et de la réparation du cartilage en raison de l’incapacité des chondrocytes provenant des articulations humaines OA à répondre efficacement aux stimulations de ce facteur
  10. 10. (Dore, Pelletier et al. 1994). Un faible changement dans la concentration de glucose, dans le micro-environnement de l’ECM, peut déséquilibrer les activités anaboliques de l’IGF-1 et promouvoir une variété de pathologies dans l’articulation (Rosenbloom and Silverstein 1996; Liote and Orcel 2000) Le stress oxydative : Les espèces réactives de l’oxygène (ROS) sont normalement produites dans les cellules aérobies. Une concentration excessive de ROS est détectée dans plusieurs pathologies (Knight 1995). La chaîne de transport d’électrons mitochondriale correspond à la principale source de ROS. Puisque, Environ 1 à 2 % de l’oxygène utilisé par la mitochondrie sont transformés en ROS à l’étape intermédiaire de la chaîne respiratoire (Giulivi, Boveris et al. 1995). En effet, il en résulte, lors du couplage du transfert d’électrons et de la phosphorylation oxydative, deux phénomènes se produisant à l’intérieur de la membrane interne mitochondriale, une « fuite » d’électrons (Musatov, Carroll et al., 2002). Cette fuite d’électrons est responsable de la génération de l’anion superoxyde (O2-.) Toutefois, par des interactions intracellulaires avec des métaux libres, cet anion peut être converti en espèces encore plus toxiques, c’est-à-dire le radical hydroxyle (. OH) et le peroxyde d’hydrogène (H2O2). Ces molécules sont très réactives et causent des dommages aux macromolécules biologiques menant à la peroxydation lipidique, à l’oxydation des protéines et à la modification de l’ADN (Marnett 2002; Niki, Yoshida et al. 2005). Par ailleurs, les patients OA démontrent un niveau de ROS élevé dans le liquide synovial (Gutteridge 1993; Kehrer 1993). Celles-ci peuvent oxyder et endommager différents
  11. 11. constituants de l’articulation tels que le collagène, les protéoglycanes et les hyluronanes (Dimock, Siciliano et al. 2000; Kawai, Kubota et al. 2000; Haklar, Yuksel et al. 2002). Bien que les mécanismes entraînant la dégradation de la matrice du cartilage ne soient pas totalement élucidés, il semble que les ROS soient des facteurs de premier ordre dans ce processus (Greenwald 1991; Henrotin, Bruckner et al. 2003; Martin, Brown et al. 2004; Martin, Brown et al. 2004). Les cellules sont adaptées à l’élimination continuelle de ROS par deux systèmes antioxydants, l’une est enzymatique et constitue par plusieurs enzymes (superoxyde dismutase, catalase, glutathion peroxydase) et l’autre system non enzymatique constitue par d’autres agents réducteurs et fixateurs de radicaux libres comme l’urate, le 2-oxoglutarate et les tocophérols fournissent à la cellule une protection non enzymatique contre les ROS (Marnett 2002). Les ROS induit la peroxydation lipidique des acides gras non saturés de la membrane, ce qui induit l’augmentation de la production des aldéhydes. Comme les ROS, les aldéhydes sont électrophiles, elles se lient aux groupements nucléophiles de protéines. Ils possèdent une demi- vie plus longues que les ROS, ce qui les rendre un bon candidat à la propagation de dommages entre les cellules voisines(Niki, Yoshida et al. 2005). En vertu de stress oxydatif intense, le niveau d'aldéhydes devient très signifiante, et cette augmentation est estimé à contribuer au développement de nombreuses conditions pathologiques (Uchida 2003). Pour cette étude, un intérêt particulier est donné au HNE, il est le principal aldéhyde α,β-insaturé produit lors de la peroxydation non enzymatique des acides gras ω-3 et ω-6- polyinsaturés tels l’acide linoléique (18 :2) et l’acide arachidonique (20 :4) (Esterbauer, Schaur et al. 1991). Grigolo et al. ont démontré que sa présence était augmentée dans les synoviocytes
  12. 12. des patients OA (Grigolo, Roseti et al. 2003). Dans les cellules, la plupart d’HNE est généré par des réactions non-enzymatiques au cours de la peroxydation des lipides, et son homéostasie semble être régulée principalement par son métabolisme. Le HNE est aujourd’hui considéré comme un important médiateur des dommages cellulaires liés au stress oxydatif (Esterbauer, 1993). Malgré que le HNE ait longtemps été considéré comme un simple marqueur des dommages tissulaires, son rôle en tant que «second messager toxique», selon l’hypothèse d’Esterbauer, devient de plus en plus accepté (Benderdour, Charron et al. 2004). Le HNE est généralement considéré comme le plus toxique des aldéhydes (Esterbauer, Schaur et al. 1991). Tel que présenté à la figure 1-1, il est possible de constater que c’est un aldéhyde hautement réactif qui est constitué de neuf carbones et qui possède trois groupes fonctionnels, le double lien C=C, le groupe –OH et le groupe -CHO (aldéhyde) (Esterbauer, Schaur et al. 1991). Il possède une grande stabilité et il peut facilement diffuser à travers les membranes pour attaquer d’autres compartiments cellulaires ou extracellulaires(Uchida 2003). Figure 1-1 : Structure chimique du HNE. Ce sont ses caractéristiques chimiques qui déterminent la réactivité du HNE avec différentes espèces moléculaires, particulièrement avec les protéines, mais aussi avec les acides nucléiques. En outre, il affecte les lipides en favorisant la peroxydation lipidique (Uchida, Szweda et al., 1993). Le HNE peut former des complexes stables avec les protéines par des
  13. 13. additions de Michael avec les résidus nucléophiles lysyls, sulfhydriles ou histidyls, ou encore, il peut former des complexes par les bases de Schiff avec les acides aminés primaires (Uchida, 2003; Benderdour, Charron et al., 2004). Son atome C3 oléfinique peut aussi agir comme un centre électrophile avec les résidus guanines de l’ADN (Esterbauer, Schaur et al., 1991). Les effets cytopathologiques du HNE sont nombreux et très diversifiés. Ils incluent l’inactivation par des modifications irréversibles de la glycéraldéhyde-3-phosphate déshydrogénase, de la glucose-6-phosphate déhydrogénase, de la cytochrome c oxydase et de la glutathion réductase (Poli, Schaur et al. 2008). Il peut aussi induire la lyse des érythrocytes, l’activité chimiotactique des neutrophiles et l’inhibition de protéines et de la synthèse de l’ADN, de l’ARN et des protéines (Poli, Schaur et al. 2008).Ces effets cytotoxiques sont induits par différents mécanismes incluant l’interaction directe avec des récepteurs, des facteurs de transcription et d’importantes protéines catalytiques, l’altération des mécanismes de transduction des signaux et l’atténuation du niveau de glutathion réduit (Uchida, 2003). En outre, le HNE est aussi un agent mutagène, un agent carcinogène et un agent apoptotique dans plusieurs cultures cellulaires (Poli, Schaur et al. 2008)). Ces effets génotoxiques attribués au HNE mènent à l’échange de chromatides sœurs, à la formation de micronoyaux et à la fragmentation de l’ADN (Esterbauer, Schaur et al. 1991; Kruman, Bruce- Keller et al. 1997; Ahmed, John et al. 2002; Laurora, Tamagno et al. 2005; Patrick, Li et al. 2005). Notre groupe de recherche s’intéresse aux effets du HNE dans l’OA. Nous avons démontré que le niveau du HNE est élevé dans le liquide synovial des patients OA comparativement aux sujets normaux (Morquette, Shi et al. 2006). Dans cette étude, il a été
  14. 14. rapporté que le HNE pourrait induire le catabolisme du cartilage en agissant sur le plan transcriptionel et post-traductionel en modulant l’expression du collagène type II et de la MMP- 13 (Morquette, Shi et al., 2006). De plus, cet aldéhyde a la capacité de réguler la COX-2 et l’iNOS en modulant deux voies de signalisation distinctes (Vaillancourt, Morquette et al. 2006) Dans une étude plus récente encore, Shi et al. ont démontré que le HNE pourrait être impliqué dans l’altération du métabolisme cellulaire des ostéoblastes OA (Shi, Vaillancourt et al. 2006). L’objectif de cette étude est de démontrer que l’augmentation de la concentration du HNE observé dans les tissus articulaires pourrait altérer le métabolisme cellulaire des chondrocytes durant le développement de l’OA. Cette altération serait due à la perturbation du flux du glucose à travers de la membrane plasmique en raison d’un défaut dans la régulation des GLUT. On propose avoir: une diminution de flux de glucose dans les chondrocytes OA à la suite de l’incubation de ces cellules dans 10µM de HNE. Le flux du glucose est mesuré par le comptage du taux de [3 H] 2-deoxyglucose pénétrer dans les cellules. A la suite d’une régulation négative de transporteur du glucose, les GLUT-1 et -9 aux niveaux d’expression d’ARNm qui va influencer son expression protéique. Le taux protéique est mesuré par l’immunobuvardage avec les anticorps appropriés de GLUT-1 et -9. Tandis que le taux d’ARNm est mesuré par la technique de RT-PCR quantitatif avec les amorces de GLUT-1 et -9.
  15. 15. MATÉRIELS ET MÉTHODES: Culture cellulaire et sélection de spécimens : Les spécimens de cartilage ont été obtenus auprès de patients atteints d'arthrose (64 ± 8 ans, moyenne ± SEM), qui ont subi l'arthroplastie totale du genou (n = 8). Le diagnostique des patients a été établi en accord avec les critères de l'«American College of Rheumatology» (Altman, Asch et al. 1986). Les cartilages OA sont disséqués dans des conditions stériles de l'os sous-jacents de chaque spécimen. Le protocole expérimental a été approuvé par le conseil d'éthique du centre de recherche de l’hôpital du Sacré-Cœur de Montréal. Les chondrocytes OA ont été isolé par une la digestion enzymatique séquentielle de 1 mg / ml de pronase (Sigma, Oakville, ON, Canada) pour 1 h, suivie de 16 h à 2 mg / ml de collagénase de type IV (Sigma) à 37 ° C en Dulbecco’s Modified Eagle Medium (DMEM), acheté chez GIBCO, complété avec 10% de sérum bovin fœtal (FBS), acheté chez Hyclone, désactivé par la chaleur et 100 U / ml penicillin/100 μ g / ml de streptomycine (Invitrogen life technology, Inc.) Les cellules isolées sont cultivées, dans des flacons, à haute confluence dans un milieu de culture DMEM avec 10% de FBS dans un incubateur humide à 370 , contenants 5% de CO2 et 95% d’air. À l’aide d’un traitement avec 0.05% trypsine-EDTA (GIBCO Invitrogen™ ), les Chondrocytes OA ont été mises dans des plaques de culture de 6 ou 24 puits à raison de 2 x 105 cellules/puits pour, ensuite, stimulés à 10 μM de HNE pour différents périodes de temps différents. Dans les vingt- quatre heures précédent l’expérience, le milieu de culture a été remplacé par un nouveau qui diffère de l’autre par un 1% de FBS. L’incorporation du glucose Les chondrocytes OA ont été traitées en présence de 10 µM HNE à différents temps d’incubation (0-16h). À la fin de l’incubation, les cellules ont été lavées trois fois avec du PBS
  16. 16. chauffé à 37ºC, puis mises de nouveau en culture pendant 20 minutes dans du DMEM sans glucose contenant 10Ci/ml de [3 H]2-déoxyglucose (2DG). Par la suite, le tapis cellulaire est lavé cinq fois avec du PBS froid afin d’éliminer la radioactivité non incorporée, puis lysé avec 200 µL du tampon de lyse (Mannitol, 220 mM; sucrose, 70 mM; HEPES-KOH, 10 mM, pH 7.4; EDTA, 10 mM; glycérol, 10%) en utilisant le processus de congélation/décongélation. Après une centrifugation de 10 minutes à 1000 x g, un volume de 100 µL de l’extrait cellulaire est déposé dans des fioles contenant 3 mL de liquide de scintillation (Amersham). Après 1 h de repos à l’abri de la lumière, le comptage de la radioactivité est effectué dans un compteur PerkinElmer. Les résultats sont exprimés en cpm/mg protéines. Dosage de protéines totales La normalisation des résultats obtenus de l’incubation du glucose est faite par le dosage de protéines total. Pour ce fait, une courbe standard a été réalisée en déposant 0,1, 2, 5, 10 et 20 L d’albumine sérique bovine (BSA) dont la concentration est de 1 mg/ml. Dix microlitres de chaque échantillon sont déposés dans chaque puits. Ensuite le volume est complété à 40 L finaux avec de l’eau. Chaque puits de standard contient 10 L du tampon de lyse. La réaction est initiée par l’addition de 160 L du réactif préalablement préparé en mélangeant 10 mL d’acide bicinchoninique (BCA) avec 0.2 mL de sulfate de cuivre. La réaction se développe sur une période allant de 15 à 30 minutes. Une fois la réaction développée, la plaque est lue à 562 nm à l’aide d’un lecteur de plaques (EL800 Universal Microplate Reader BIO-TEK INSTRUMENTS. INC.).
  17. 17. Immunobuvardage de type western : Le niveau d’expression de GLUT-1 et -9 a pu être détecté à l’aide de la méthode d’immunobuvardage de type Western. Huit µg de protéines totales de lysâtes de chondrocytes traités par 10 µM HNE à différents temps d’incubation ont été migré dans un gel discontinu de polyacrylamide (4-12%) en présence de 0.1% de SDS et transférées sur une membrane de nitrocellulose (Bio-Rad) par électrophorèse sur les membranes de nitrocellulose (Bio-Rad). Les membranes sont saturées sous agitation pendant quatre heurs à 370 C dans du TTBS contenant 5% (p/v) de lait écrémé. Les membranes sont ensuite incubées sous agitation pendant la nuit à 4o C en présence de l’anticorps d’intérêt, dilué dans du TTBS + 10% de solution de blocage SuperBloc™ (PIERCE). Par la suite, les membranes sont lavées dans le TTBS trois fois 10 minutes, puis incubées pendant une heure à température de la pièce avec l’anticorps secondaire approprié : Anticorps IgG secondaire anti-lapin (1:20 000 Jackson ImmunoResearch). Après une série de lavages (tels que décrits précédemment), les membranes sont incubées à nouveau avec un réactif luminescent pour environ 15 secondes. Les membranes sont enfin exposées à des films Bioflex® EconoFilm (Clonex corporation). Isolation de l’ARN total L’ARN total a été extrait à partir des chondrocytes traités dans différentes conditions en utilisant le réactif TRIzol® (Invitrogen™) et en suivant les instructions du fabricant. Une fois isolé, l’ARN total a été mis en suspension dans l’eau stérile sans RNAse , puis dosé comme décrit ci-dessous.
  18. 18. Dosage de l’ARN Afin d’évaluer le plus précisément possible la quantité d’ARN recueillie, le dosage a été effectué à l’aide du Quant-iT™ RiboGreen® RNA reagent (Invitrogen™). Deux gammes étalons d’ARN standard ribosomale (ribosomal RNA standard) (Invitrogen™) sont réalisées, la première entre 0 et 50 ng et l’autre entre 0 et 6,25 ng d’ARN. Vingt-cinq microlitres d’échantillon ou de standard sont déposés dans les puits d’une plaque de 96 puits, ainsi que 25 L de RiboGreen™ (Invitrogen™) (1:4000 ou 1:400). La plaque est lue à l’aide du MX3005P™ avec le filtre FAM (exitation 492; émisson 516). La concentration initiale est évaluée par la formule suivante: ng/L x facteur de dilution = concentration initiale Transcription inverse et réaction en chaîne de la polymérase en temps réel : La transcription inverse-réaction en chaîne de la polymérase (RT-PCR) en temps réel a été réalisée en deux étapes : (i) Transcription inverse La transcription inverse (RT) a été effectuée à l’aide d’un kit acheté chez QIAGEN. Pour ce faire, 100 ng d’ARNm ont d’abord été incubés pendant deux minutes à 42o C en présence de 2 mL de tampon d’élimination d’ADN génomiques contaminants (7X) et d’eau ultra pure pour un total de 14 mL. Par la suite, une solution contenant les réactifs de la RT est préparée selon une proportion de 1:4:1 de RT Quantiscript (incluant des inhibiteurs de RNase) : de tampon RT Quantiscript (5X) : de mélange d’amorces de RT (incluant du Mg2+ et des dNTP), respectivement. Six microlitres de ce mélange sont ensuite additionnés aux 14 mL de la solution précédente avant d’être incubés pendant 20 minutes à 42o C. Par la suite, ils sont incubés à 95 o C
  19. 19. pendant trois minutes. Une fois l’acide désoxyribonucléique complémentaire (ADNc) synthétisé, il est conservé à -20o C jusqu’au moment de la PCR. (b) PCR en temps réel Une fois l’ADNc synthétisé, la quantification relative de différents gènes a pu être réalisée par PCR en temps réel. Les amorces ont été commandées chez Montréal Biotech (Roxboro) Québec. Ces amorces ont été choisies pour leurs spécificités avec les gènes étudiés, la longueur des produits de PCR (81-131pb) et leur température d’hybridation (57-59o C). Les amorces sont décrites dans le tableau 1. La réaction de PCR est réalisée dans une plaque de 96 puits par l’ajout dans chaque puits du «Master Mix» (QIAGEN) contenant 30 mM de chaque amorce, sens et anti-sens, 1x de SYBRGreen, 0,25 unité d’uracil ADN glycosylase (UNG) et 25 mL d’ADNc. La plaque est ensuite placée dans le thermocycleur MX3005P™ (Invitrogen®). L’amplification de l’ADNc se fait pendant 40 cycles composés de 15 secondes à 94o C, 30 secondes à 58o C et 15 secondes à 72o C. Les lectures sont prises à chaque cycle pendant la période d’hybridation avec le filtre FAM (excitation 492; émission 516). La quantité relative d’ARNm initiale a été évaluée par la formule 2-∆∆Ct. Efficacité d’amplification : Par la suite, l’efficacité d’amplification dans les conditions choisies a été comparée entre les gènes étudiés et le gène de référence GAPDH. Pour étudier les efficacités d’amplification, des dilutions (1 à 1/100 000) d’ADNc ont été amplifiées, puis comparées avec celles du gène de référence. Le ratio des efficacités d’amplification linéaire était accepté lorsqu’il ne dépassait pas 0,14.
  20. 20. Ratio d’efficacité d’amplification = pente des dilutions du gène étudié/ pente des dilutions du gène de référence. Analyses statistiques Les résultats sont exprimés en moyenne ± écart-type. La valeur statistique des résultats est évaluée par le test t de student non apparié à l’aide du programme Prism. Les résultats sont statistiquement significatifs lorsque la valeur de p ≤ 0.05. Amorce Longueur de la séquence Sens 5’-3’ Anti-Sens 5’-3’ GAPDH 104 GCCTCAAGATCATCAGCAATGCCT TGTGGTCATGAGTCCTTCCACGAT GLUT-1 134 ATCCTCATTG CCGTGGTGCT ACGATGCCAGAGCCGATGGT GLUT-9 229 ACTGAGACCCATGGCAAGGAA GAGTGTCTGGGTCTATTGGA Tableau I : Description des amorces utilisées.
  21. 21. 3. RESULTATS: 3.1 Effet de 10 M de HNE en fonction du temps d’incubation sur l’influx du [3 H] 2- DG dans les chondrocytes OA : Afin de déterminer l’effet du HNE sur l’influx du glucose en fonction du temps, les chondrocytes OA (n=3) ont été traités en présence de 10 µM de HNE pour différentes périodes d’incubation (0-16h), suivie par une période d’incubation de 20 minutes avec le [3 H] 2-DG En présence de 10 µM de HNE, l’influx du glucose, après 2 h d’incubation, diminue non significativement et légèrement à 93.31% par rapport au contrôle, par la suite, elle diminue progressivement et significativement pour atteindre une concentration de 34,16,et 7% de l’influx de glucose basale, après respectivement 4, 8 et 16h d’incubation (figure 3-1). C 2h 4h 8h 16h 0 10 20 30 40 50 60 70 80 90 100 110 *** *** *** Temps d'incubation (h) %del'influxde[3 H]2-DG Figure 3-1 : Effet du HNE en fonction du temps d’incubation sur l’influx de [3H] 2-DG dans les chondrocytes OA. Les cellules ont été incubées avec 10 M HNE pendant différents temps d’incubation (0-16 h). Le contrôle est considéré comme 100%. La quantité de la [3 H] 2-DG incorporé (en cpm) est ajustée avec la concentration de protéines totales. Les résultats sont exprimés en moyenne ± SEM, n=3. *** P≤ 0.001.
  22. 22. 3.2 Effet de 10µM de HNE en fonction du temps d’incubation sur l’expression de la GLUT-1 dans les chondrocytes OA : Afin de mieux comprendre l’effet du HNE en fonction du temps sur l’expression de GLUT1, les chondrocytes OA ont été traités en présence de 10 µM de HNE pendant différents temps d’incubation (0-24 h). Pour ce qui est de l’expression protéique de la GLUT-1 en fonction du temps en présence de 10 µM de HNE, elle tend à diminuer après 2 et 4 h sans pour autant que ces valeurs ne soient significatives, mais à partir le 8 h, elle diminue significativement de 74,6% du contrôle, en suite elle raugmente à 16h et redescendre à 24 h (figure 3-2A). Par ailleurs, l’expression de l’ARNm de la GLUT-1 tend à diminuer légèrement et significativement après 2 et 4h d’incubation. Toutefois, l’expression diminue de façon important et significativement de 68.3, 50.8 et 49.6% après respectivement 4, 8, 16, et 24 h d’incubation comparativement à la valeur basale (p ≤ 0,001 (figure 3-2B).
  23. 23. 0 2 4 8 16 24 0 10 20 30 40 50 60 70 80 90 100 110 *** ** ** A GLUT 1 -Actine 0 2 4 8 16 24 Temps d'incubation (h) GLUT1 (%ducontrôle) 0 2 4 8 16 24h 0 10 20 30 40 50 60 70 80 90 100 110 *** *** *** *** *** B Temps d'incubation (h) GLUT1 (%ducontrôle) Figure 3-2 : Effet du HNE en fonction du temps sur l’expression et la régulation de la GLUT-1 dans les chondrocytes OA. Les cellules ont été traitées avec 10 M de HNE durant différents temps d’incubation (0-24 heures). Par la suite, l’expression de GLUT-1 par (A), le niveau protéique n=5 (B) et ARNm n=2 ont respectivement été mesurées par l’immunobuvardage et de la RT-PCR en temps réel. L’ARNm est normalisé par le taux d’expression d’ARNm de la GAPDH. Les résultats sont exprimés en moyenne ± S.E.M, n=5. ** P≤ 0.01 *** P≤ 0.001.
  24. 24. 3.3 Effet de 10 µM de HNE en fonction du temps d’incubation sur l’expression et la régulation de la GLUT-9 dans les chondrocytes OA : Les chondrocytes OA ont d’abord été traités avec 10 µM de HNE pendant différents périodes de temps (0-24h), afin d’étudier l’effet de ce dernier sur l’expression et la régulation de la GLUT-9. Pour ce qui est de l’expression protéique de la GLUT-9, elle tend à augmenter après 2h significativement pour ce rendre à 112,5% de l’état basale. En suite, elle tend à diminuer significativement après 4, 8, 16, et 24h d’incubation pour ce rendre respectivement à 83.7, 85.1, 75.2%, et 89.6% de l’état basale (figure 3-3A). Par ailleurs, l’expression de l’ARNm de la GLUT-9 tend à diminuer progressivement en fonction de temps. Puisque l’expression d’ARNm diminue significativement pour atteindre 91.7, 79.1, 58.3, et 36.4% après respectivement 4, 8, 16, et 24 h d’incubation comparativement à la valeur basale (figure 3-3B).
  25. 25. 0 2 4 8 16 24 0 10 20 30 40 50 60 70 80 90 100 110 120 * *** ** ** A 0 2 4 8 16 24 GLUT9 -Actine Temps d'incubation (h) GLUT9 (%ducontrôle) 0 2 4 8 16 24 0 50 100 150 ** ***** *** *** B Temps d'incubation (h) GLUT9 (%ducontrôle) Figure 3-3: Effet du HNE en fonction du temps sur l’expression et la régulation de la GLUT-9 dans les chondrocytes OA. Les cellules ont été traitées avec 10 M de HNE durant différents temps d’incubation (0-24 heures). Par la suite, l’expression de GLUT-9 par (A), le niveau protéique (n=5) (B) et ARNm (n=2) ont respectivement été mesurées par l’immunobuvardage et de la RT-PCR en temps réel. L’ARNm est normalisé par le taux d’expression d’ARNm de la GAPDH et le GLUT-9 est normalisé par le taux d’expression de β-Actine. Les résultats sont exprimés en moyenne ± S.E.M. *P≤ 0.05, ** P≤ 0.01 *** P≤ 0.001.
  26. 26. Discussion : L’OA est une maladie répandue. Pourtant, les causes de cette pathologie demeurent peu connues. Le stress oxydatif est un processus normal du métabolisme qui peut être augmenté lors de différentes pathologies(Knight 1995). Initialement considéré uniquement comme un marqueur du stress oxydatif, le HNE est probablement l’un des aldéhydes de la peroxydation lipidique les plus toxiques et les plus réactifs (Esterbauer, Schaur et al. 1991). Grigolo et al. ont démontré que sa présence était augmentée dans les synoviocytes des patients atteints d’OA(Grigolo, Roseti et al. 2003). C’est pour cette raison notre équipe s’intéresse aux rôles de cet aldéhyde dans la pathophysiologie de l’OA. Nous avons déjà démontré son implication dans la dégradation du cartilage(Morquette, Shi et al. 2006), le processus de mort cellulaire des chondrocytes et ainsi dans l’altération de métabolismes des ostéoblastes(Shi, Vaillancourt et al. 2006). Dans ce travail, nous avons tenté de démontrer son effet sur le flux de glucose dans les chondrocytes OA en étudiant l’expression d’ARNm et protéiques de GLUT-1 et -9. L'importance de glucose dans les chondrocytes est basée sur plusieurs observations. Le glucose est la source essentielle pour le métabolisme énergétique des chondrocytes (Otte 1991; Lee and Urban 1997). Il est l'un des principaux précurseurs pour la synthèse glycosaminoglycane et réagit comme un régulateur pour certains facteurs de croissance (Kelley, Johnson et al. 1999). L’étape limitant le métabolisme du glucose est régulée par le transport transmembranaire de celui-ci. Les GLUTs participent également à faciliter le transport de la glucosamine et N- acetylglucosamine (Zhao and Keating 2007), qui peut modifier les réponses inflammatoires de chondrocytes (Shikhman, Kuhn et al. 2001b) et sert le précurseurs efficace pour la synthèse de glycosaminoglycane (Mason, Kimura et al. 1982).
  27. 27. Les résultats de cette étude démontrent une diminution proportionnelle du flux de glucose en fonction du temps d’incubation de chondrocytes OA avec 10 µM HNE, suivie par une diminution important et proportionnelle en fonction du temps au niveau de l’expression d’ARNm de GLUT-1 et -9. Par contre, le niveau d’expression protéique de GLUT-1 et -9 ne démontre qu’une faible diminution non proportionnelle à la diminution du niveau d’ARNm. Cette forte diminution de flux de glucose observé en présence du HNE peut être expliqué par deux hypothèses distinctes, premièrement une forte diminution de l’affinité des GLUTs vers leur substrat, soit le glucose, suite d’une modification post-traductionnelle de celles- ci par le HNE pour former des complexes HNE-GLUTs. Puisque les GLUTs sont des récepteurs transmembranaires riches en cystéine (Zhao and Keating 2007) et que la membrane phospholipidique fait sorte d’une source principale de la production de HNE(Uchida 2003), ce qui suggère une formation des complexes stables par l’addition de Michael avec les résidus nucléophiles sulfhydriles des GLUTs (Uchida 2003). Pour confirmer cette idée, il faut vérifier la formation de ces complexes par la méthode d’immunoprécipitation en l’utilisation un anticorps poly-clonal anti-GLUTs par suivie par un immunobuvardage de type western en utilisant un anticorps anti-HNE. Robert.,J et al, ont montré l’effet négative de la formation du complexe HNE/GLUT-3 sur le flux de glucose dans l’hippocampal chez les rats(Reagan, Magariños et al. 2000). Le deuxième mode de régulation de GLUTs par le HNE pourrait être attribué à son effet sur l’expression des GLUTs au niveau protéique et ARNm. Dans cette étude, on s’est intéressé sur deux enzymes, la GLUT-1 et -9. Le HNE à 10µM montre un effet négatif en fonction de temps d’incubation sur la régulation d’ARNm de GLUT-1 et -9. Cette diminution est expliquée soit par la diminution de la stabilité des ARNm des GLUTs ou soit par l’inactivation de certaine
  28. 28. voie de signalisation impliquée dans la régulation de GLUT-1 et GLUT-9 (Uchida 2003). Des etudes plus poussée sont nécessaire pour répondre à ces questions. Au niveau d’expression protéique de GLUT-1, on observe une faible diminution proportionnelle au niveau d’ARNm après 4h d’incubation en présence de 10 µM HNE, ensuite, on remarque une diminution non proportionnelle en fonction du temps mais significative dans les heurs suivantes. La faible augmentation après 16h par rapport reste à confirmer par l’augmentation de nombres de spécimens. La modification post-traductionnelle de protéines par le HNE tend à rendre cela plus susceptible à la dégradation par le protéasome, la micro-organelle responsable en grande partie de la protéolyse intracellulaire. Plusieurs études ont démontré que la modification des protéines par le HNE est plus susceptible à la dégradation par le protéasome. Marques et al. ont démontré que la B-crystallin modifié par le HNE a été dégradé plus rapidement que le B-crystallin non modifié (Marques, Pereira et al. 2004). Cependant, le protéasome peut être une cible du HNE, ce qui produit une inhibition de la protéolyse.(Okada, Wangpoengtrakul et al. 1999; Hyun, Lee et al. 2002). Cette inhibition peut expliquer la faible augmentation d’expression protéique à 2h d’incubation en présence du HNE. Pourtant, le niveau d’expression protéique diminue significativement après 16 h d’incubation probablement dû à la diminution de son expression au niveau ARNm. Cependant, la faible augmentation après 24 h par rapport au 16 h, reste à confirmer par l’augmentation de nombres de spécimens. Enfin, on conclut que pour l’ensemble des résultats préliminaires présentés dans cette étude démontre que le HNE possède la capacité d’altérer forcement le flux de glucose dans les chondrocytes OA. Cependant, puisque les GLUTs est l’étape limitant du métabolisme du glucose, le niveau d’expression d’ARNm de GLUT-1 et -9 diminue en fonction de temps. Les
  29. 29. prochaines études doivent prendre en considération certains points : premièrement, les niveaux d’expression des autres GLUTs exprimés chez chondrocytes. Deuxièmement l’augmentation de nombre de spécimens pour confirmer avec l’exactitude le niveau d’expression protéique et d’ARNm de GLUT-1 et -9. Troisièmement, confirmer si le HNE fait des complexes avec les GLUTs, ce qui cause le blocage du flux du glucose via ces récepteurs, par les méthodes d’immunoprécipitation et l’immunobuvardage de type Western en utilisant les anticorps anti- GLUTs et anti-HNE respectivement. Remerciement : Ce projet est financé par la Société d’Arthrite Références :
  30. 30. Ahmed, I., A. John, et al. (2002). "Differential modulation of growth and glutathione metabolism in cultured rat astrocytes by 4-hydroxynonenal and green tea polyphenol, epigallocatechin-3-gallate." Neurotoxicology 23(3): 289-300. Altman, R., E. Asch, et al. (1986). "Development of criteria for the classification and reporting of osteoarthritis: Classification of osteoarthritis of the knee." Arthritis & Rheumatism 29(8): 1039-1049. Arlan, L. R. and H. S. Janet (1996). "CONNECTIVE TISSUE AND JOINT DISEASE IN DIABETES MELLITUS." Endocrinology and metabolism clinics of North America 25(2): 473-483. Aydelotte, M. B. and K. E. Kuettner (1988). "Differences between sub-populations of cultured bovine articular chondrocytes." Connective tissue research 18(3): 223-34. Benderdour, M., G. Charron, et al. (2004). "Decreased cardiac mitochondrial NADP+-isocitrate dehydrogenase activity and expression: a marker of oxidative stress in hypertrophy development." Am J Physiol Heart Circ Physiol 287(5): H2122-31. Blanco, F. J., M. J. López-Armada, et al. (2004). "Mitochondrial dysfunction in osteoarthritis." Mitochondrion 4(5-6): 715-728. Brandt, K. D., P. Dieppe, et al. (2008). "Etiopathogenesis of Osteoarthritis." Rheumatic Disease Clinics of North America 34(3): 531-559. Buckwalter, J. A. and H. J. Mankin (1998b). "Articular cartilage: tissue design and chondrocyte- matrix interactions." Instr Course Lect 47: 477-86. Buckwalter, J. A., H. J. Mankin, et al. (2005). "Articular cartilage and osteoarthritis." Instructional course lectures 54: 465-80. Buckwalter, J. A. and J. A. Martin (2006). "Osteoarthritis." Advanced Drug Delivery Reviews 58(2): 150-167. Caron, J. P., J. C. Fernandes, et al. (1996 ). "Chondroprotective effect of intraarticular injections of interleukin-1 receptor antagonist in experimental osteoarthritis. Suppression of collagenase-1 expression." Arthritis and rheumatism 39(9): 1535-44. Clark, J. M. (1990). "The structure of vascular channels in the subchondral plate." J Anat 171: 105-15. Dimock, A. N., P. D. Siciliano, et al. (2000). "Evidence supporting an increased presence of reactive oxygen species in the diseased equine joint." Equine Vet J 32(5): 439-43. Dore, S., J. P. Pelletier, et al. (1994). "Human osteoarthritic chondrocytes possess an increased number of insulin-like growth factor 1 binding sites but are unresponsive to its stimulation. Possible role of IGF-1-binding proteins." Arthritis Rheum 37(2): 253-63. Esterbauer, H., R. J. Schaur, et al. (1991). "Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes." Free Radic Biol Med 11(1): 81-128. Fernandes, J. C., J. Martel-Pelletier, et al. (2002). " The role of cytokines in osteoarthritis pathophysiology " Biorheology 39(2): 237-246. Gelse, K., E. Pöschl, et al. (2003). "Collagens—structure, function, and biosynthesis " Advanced Drug Delivery Reviews 55(12): 1531-46. Giulivi, C., A. Boveris, et al. (1995). "Hydroxyl Radical Generation During Mitochondrial Electron-Transfer and the Formation of 8-Hydroxydesoxyguanosine in Mitochondrial- DNA." Archives of Biochemistry and Biophysics 316(2): 909-916. Greenwald, R. A. (1991). "Oxygen radicals, inflammation, and arthritis: pathophysiological considerations and implications for treatment." Semin Arthritis Rheum 20(4): 219-40.
  31. 31. Grigolo, B., L. Roseti, et al. (2003). "Enhanced lipid peroxidation in synoviocytes from patients with osteoarthritis." J Rheumatol 30(2): 345-7. Gutteridge, J. M. (1993). "Free radicals in disease processes: a compilation of cause and consequence." Free Radic Res Commun 19(3): 141-58. Haklar, U., M. Yuksel, et al. (2002). "Oxygen radicals and nitric oxide levels in chondral or meniscal lesions or both." Clin Orthop Relat Res(403): 135-42. Henrotin, Y. E., P. Bruckner, et al. (2003). "The role of reactive oxygen species in homeostasis and degradation of cartilage." Osteoarthritis Cartilage 11(10): 747-55. Hyun, D., H, , M. H. Lee, et al. (2002). "Proteasomal dysfunction induced by 4-hydroxy-2,3- <i>trans</i>-nonenal, an end-product of lipid peroxidation: a mechanism contributing to neurodegeneration?" Journal of Neurochemistry 83(2): 360-370. Joost, H. G. and B. Thorens (2001). "The extended GLUT-family of sugar/polyol transport facilitators: nomenclature, sequence characteristics, and potential function of its novel members." Molecular Membrane Biology 18: 247-256. Kawai, Y., E. Kubota, et al. (2000). "Reactive oxygen species participation in experimentally induced arthritis of the temporomandibular joint in rats." J Dent Res 79(7): 1489-95. Kehrer, J. P. (1993). "Free radicals as mediators of tissue injury and disease." Crit Rev Toxicol 23(1): 21-48. Kelley, K. M., T. R. Johnson, et al. (1999). "Glucose regulation of the IGF response system in chondrocytes: induction of an IGF-I-resistant state." Am J Physiol Regul Integr Comp Physiol 276(4): R1164-1171. Knight, J. A. (1995). "Diseases related to oxygen-derived free radicals." Ann Clin Lab Sci 25(2): 111-121. Knudson, C. B. and W. Knudson (2001 ). "Cartilage proteoglycans." Semin Cell Dev Biol 12(2): 69-78. Kruman, I., A. J. Bruce-Keller, et al. (1997). "Evidence that 4-hydroxynonenal mediates oxidative stress-induced neuronal apoptosis." J Neurosci 17(13): 5089-100. Laurora, S., E. Tamagno, et al. (2005). "4-Hydroxynonenal modulation of p53 family gene expression in the SK-N-BE neuroblastoma cell line." Free Radic Biol Med 38(2): 215-25. Lee, R. B. and J. P. Urban (1997). "Evidence for a negative Pasteur effect in articular cartilage." Biochem. J. 321(1): 95-102. Levick, J. R. (1995 ). "Microvascular architecture and exchange in synovial joints." Microcirculation 2(3): 217-33. Liote, F. and P. Orcel (2000). "Osteoarticular disorders of endocrine origin." Baillieres Best Pract Res Clin Rheumatol 14(2): 251-76. Marcus, R. E. (1973). "The effect of low oxygen concentration on growth, glycolysis, and sulfate incorporation by articular chondrocytes in monolayer culture." Arthritis Rheum 16(5): 646-56. Marnett, L. J. (2002). "Oxy radicals, lipid peroxidation and DNA damage." Toxicology 181-182: 219-222. Marques, C., P. Pereira, et al. (2004). "Ubiquitin-dependent lysosomal degradation of the HNE- modified proteins in lens epithelial cells." FASEB J.: 04-1743fje. Martin, J. A., T. Brown, et al. (2004). "Post-traumatic osteoarthritis: the role of accelerated chondrocyte senescence." Biorheology 41(3-4): 479-91. Martin, J. A., T. D. Brown, et al. (2004). "Chondrocyte senescence, joint loading and osteoarthritis." Clin Orthop Relat Res(427 Suppl): S96-103.
  32. 32. Mason, R. M., J. H. Kimura, et al. (1982). "Biosynthesis of hyaluronic acid in cultures of chondrocytes from the Swarm rat chondrosarcoma." J. Biol. Chem. 257(5): 2236-2245. Mobasheri, A., H. Dobson, et al. (2005). "Expression of the GLUT1 and GLUT9 facilitative glucose transporters in embryonic chondroblasts and mature chondrocytes in ovine articular cartilage." Cell Biology International 29(4): 249-260. Mobasheri, A., G. Neama, et al. (2002). "HUMAN ARTICULAR CHONDROCYTES EXPRESS THREE FACILITATIVE GLUCOSE TRANSPORTER ISOFORMS: GLUT1, GLUT3 AND GLUT9." Cell Biology International 26(3): 297-300. Mobasheri, A., S. J. Vannucci, et al. (2002). "Glucose transport and metabolism in chondrocytes: a key to understanding chondrogenesis, skeletal development and cartilage degradation in osteoarthritis." Histology and histopathology 17(4): 1239-67. Morquette, B., Q. Shi, et al. (2006). "Production of lipid peroxidation products in osteoarthritic tissues: New evidence linking 4-hydroxynonenal to cartilage degradation." Arthritis & Rheumatism 54(1): 271-281. Morquette, B., Q. Shi, et al. (2006). "Production of lipid peroxidation products in osteoarthritic tissues: new evidence linking 4-hydroxynonenal to cartilage degradation." Arthritis Rheum 54(1): 271-81. Niki, E., Y. Yoshida, et al. (2005). "Lipid peroxidation: Mechanisms, inhibition, and biological effects." Biochemical and Biophysical Research Communications 338(1): 668-676. Okada, K., C. Wangpoengtrakul, et al. (1999). "4-Hydroxy-2-nonenal-mediated Impairment of Intracellular Proteolysis during Oxidative Stress. IDENTIFICATION OF PROTEASOMES AS TARGET MOLECULES." J. Biol. Chem. 274(34): 23787-23793. Otte, P. (1991). "Basic cell metabolism of articular cartilage. Manometric studies." Zeitschrift für Rheumatologie 50(5): 304-12. Patrick, B., J. Li, et al. (2005). "Depletion of 4-hydroxynonenal in hGSTA4-transfected HLE B-3 cells results in profound changes in gene expression." Biochem Biophys Res Commun 334(2): 425-32. Pelletier, J. P., J. A. DiBattista, et al. (1993). "Cytokines and inflammation in cartilage degradation." Rheum Dis Clin North Am. 19(3): 545-68. Phay, J. E., H. B. Hussain, et al. (2000). "Cloning and Expression Analysis of a Novel Member of the Facilitative Glucose Transporter Family, SLC2A9 (GLUT9)." Genomics 66(2): 217-220. Phillips, T., I. Ferraz, et al. (2005). "Differential regulation of the GLUT1 and GLUT3 glucose transporters by growth factors and pro-inflammatory cytokines in equine articular chondrocytes." The Veterinary Journal 169(2): 216-222. Poli, G., R. J. Schaur, et al. (2008). "4-Hydroxynonenal: A membrane lipid oxidation product of medicinal interest." Medicinal Research Reviews 28(4): 569-631. Poole, A. R., T. Kojima, et al. (2001). "Composition and structure of articular cartilage: A template for tissue repair." Clinical orthopaedics and related research 391 Suppl: S26-33. Reagan, L. P., A. M. Magariños, et al. (2000). "Oxidative stress and HNE conjugation of GLUT3 are increased in the hippocampus of diabetic rats subjected to stress." Brain Research 862(1-2): 292-300. Richardson, S., G. Neama, et al. (2003). "Molecular characterization and partial cDNA cloning of facilitative glucose transporters expressed in human articular chondrocytes; stimulation of 2-deoxyglucose uptake by IGF-I and elevated MMP-2 secretion by glucose deprivation." Osteoarthritis and Cartilage 11(2): 92-101.
  33. 33. Rosenbloom, A. L. and J. H. Silverstein (1996). "Connective tissue and joint disease in diabetes mellitus." Endocrinol Metab Clin North Am 25(2): 473-83. Sandell, L. and T. Aigner (2001). "Articular cartilage and changes in Arthritis: Cell biology of osteoarthritis." Arthritis Res 3(2): 107 - 113. Shi, Q., F. Vaillancourt, et al. (2006). "Alterations of metabolic activity in human osteoarthritic osteoblasts by lipid peroxidation end product 4-hydroxynonenal." Arthritis Res Ther 8(6): R159. Shikhman, A. R., D. C. Brinson, et al. (2004). "Distinct pathways regulate facilitated glucose transport in human articular chondrocytes during anabolic and catabolic responses." Am J Physiol Endocrinol Metab 286(6): E980-985. Shikhman, A. R., D. C. Brinson, et al. (2001). "Cytokine Regulation of Facilitated Glucose Transport in Human Articular Chondrocytes." J Immunol 167(12): 7001-7008. Shikhman, A. R., K. Kuhn, et al. (2001b). "N-Acetylglucosamine Prevents IL-1{{beta}}- Mediated Activation of Human Chondrocytes." J Immunol 166(8): 5155-5160. Uchida, K. (2003). "4-Hydroxy-2-nonenal: a product and mediator of oxidative stress." Progress in Lipid Research 42(4): 318-343. Vaillancourt, F., B. Morquette, et al. (2006). "Differential regulation of cyclooxygenase-2 and inducible nitric oxide synthase by 4-hydroxynonenal in human osteoarthritic chondrocytes through ATF-2/CREB-1 transactivation and concomitant inhibition of NF- kappaB signaling cascade." J Cell Biochem. Wang, J. I. E., J. Zhou, et al. (1999). "Igf1 promotes longitudinal bone growth by insulin-like actions augmenting chondrocyte hypertrophy." FASEB J. 13(14): 1985-1990. Zhao, F. Q. and A. F. Keating (2007). "Functional properties and genomics of glucose transporters." Current genomics 8(2): 113-28.

×