Contenu connexe
Similaire à GENE MAPPING 3 (20)
GENE MAPPING 3
- 1. GENE MAPPING - 3
By A.Arputha Selvaraj
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
- 2. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contents
Genetic mapping: Virtual or relational
mapping
Physical mapping: systematic analysis
Chromosome walking: find a gene on
chromosome
Determining DNA sequences: quick revision
New techniques for mapping and sequencing
- 3. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Why map before sequencing?
Major problem in large-scale sequencing:
Current technologies can only sequence 600–800 bases
at a time. We need to sequence 30 billion bp in order to
perfectly sequence human genome
One solution: make a physical map of overlapping
DNA fragments: Top-Down approach
Chromosomal libraries: 46 chromosomes/23 pairs
Genomic library for many fragments from each
chromosome
Determine sequence of each fragment
Then assemble to form contiguous sequence
- 4. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Map-less sequencing: Bottoms up
Celera approach
Alternative solution: fragment entire genome
Sequence each fragment
Assemble overlapping sequences to form
contiguous sequence
Focus here on principles and techniques of
mapping and sequencing of the genomes
- 5. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Figure 3.15 Genomes 3 (© Garland Science 2007)
Mitosis
Chromatids
- 6. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Figure 3.16 Genomes 3 (© Garland Science 2007)
Meiosis
- 7. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
From:
- 8. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
From:
- 9. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Figure 3.17 Genomes 3 (© Garland Science 2007)
- 10. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Mapping I
Mapping is identifying
relationships between
genes on chromosomes
Just as a road map
shows relationships
between towns on
highway: fine maps
Two types of mapping:
genetic and physical
- 11. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Mapping II
Genetic mapping
Based on differences in recombination
frequency between genetic loci: meiosis
Physical mapping
Based on actual distances in base pairs between
specific sequences found on the chromosome
Most powerful when genetic and physical
mapping are combined
- 12. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping I
Based on recombination frequencies
The further away two points are on a
chromosome, the more recombination there is
between them
Because recombination frequencies vary along
a chromosome, we can obtain a relative
position for the loci
Distance between the markers
- 13. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping II
Genetic mapping requires that a cross be
performed between two related organisms
The organism should have phenotypic
differences (contrasting characters like red and
white or tall and short etc) resulting from allele
differences at two or more loci
The frequency of recombination is determined
by counting the F2 progeny with each
phenotype
- 14. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping example I
Genes on two different
chromosomes
Independent
assortment during
meiosis (Mendel)
No linkage
Dihybrid ratio
F1
9 : 3 : 3 : 1
F2
P
- 15. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping example II
Genes very close
together on same
chromosome
Will usually end up
together after meiosis
Tightly linked
F1
1 : 2 : 1
F2
P
- 16. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping example III
Genes on same
chromosome, but not
very close together
Recombination will
occur
Frequency of
recombination
proportional to
distance between genes
Measured in
centiMorgans =cM
Recombinants
Non-parental features
One map unit = one centimorgan (cM) = 1% recombination between loci
- 17. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Figure 3.18 Genomes 3 (© Garland Science 2007)
cM or centimorgan
1% Recombination = 1 cM
- 18. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic markers
Genetic mapping between positions on
chromosomes
Positions can be genes
Responsible for phenotype
Examples: eye color or disease trait: limited
Positions can be physical markers
DNA sequence variation
- 19. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Physical markers
Physical markers are DNA sequences that vary
between two related genomes
Referred to as a DNA polymorphism
Usually not in a gene
Examples
RFLP
SSLP
SNP
- 20. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
RFLP
Restriction-fragment length polymorphism
Cut genomic DNA from two individuals with
restriction enzyme
Run Southern blot
Probe with different pieces of DNA
Sequence difference creates different band pattern
GGATCC
CCTAGG
GTATCC
GATAGG
GGATCC
CCTAGG
200 400
GGATCC
CCTAGG
GCATCC
GGTAGG
GGATCC
CCTAGG
200 400*
*
200
400
600
1 2
**
2
1
- 21. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
SSLP/Microsatellites
• Simple-sequence length polymorphism
• Most genomes contain repeats of three or four
nucleotides
• Length of repeat varies due to slippage in replication
• Use PCR with primers external to the repeat region
• On gel, see difference in length of amplified fragment
ATCCTACGACGACGACGATTGATGCT
12
18
1 2
2
1
ATCCTACGACGACGACGACGACGATTGATGCT
- 22. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
SNP
Single-nucleotide polymorphism
One-nucleotide difference in sequence of two
organisms
Found by sequencing
Example: Between any two humans, on average one
SNP every 1,000 base pairs
ATCGATTGCCATGAC
ATCGATGGCCATGAC2
1
SNP
- 23. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic map of Medicago truncatula BMC Plant Biology 2002, 2:1doi:10.1186/1471-2229-2-1
- 24. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Physical mapping
Determination of physical distance between
two points on chromosome
Distance in base pairs
Example: between physical marker and a gene
Need overlapping fragments of DNA
Requires vectors that accommodate large
inserts
Examples: cosmids, YACs, and BACs
- 25. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Physical Mapping Systems
(like a Filing system of clones)
Yeast Artificial Chromosomes (YACs) 200-1000 kb
Bacteriophage P1 90 kb
Cosmids 40 kb
Bacteriophage 9-23 kb
Plasmids (2-6 kb)
- 26. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Large insert vectors
Lambda phage
Insert size: 20–30 kb
Cosmids
Insert size: 35–45 kb
BACs and PACs (bacterial and P1 artificial
chromosomes (Viral) respectively)
Insert size: 100–300 kb
YACs (yeast artificial chromosomes)
Insert size: 200–1,000 kb
- 27. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pros and cons of large-insert vectors
Lambda phage and
cosmids
Inserts stable
But insert size too
small for large-scale
sequencing projects
YACs
Largest insert size
But difficult to work
with due to instability
- 28. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
BACs and PACs
BACs and PACs
Most commonly used
vectors for large-scale
sequencing
Good compromise
between insert size and
ease of use
Growth and isolation
similar to that for
plasmids
- 29. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contigs
Contigs are groups of overlapping pieces of chromosomal
DNA
Make contiguous clones
For sequencing one wants to create “minimum tiling path”
Contig of smallest number of inserts that covers a region of
the chromosome
genomic DNA
contig
minimum
tiling path
- 30. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contigs from overlapping
restriction fragments
Cut inserts with
restriction enzyme
Look for similar pattern
of restriction fragments
Known as
“fingerprinting”
Line up overlapping
fragments
Continue until a contig
is built
- 31. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Restriction mapping applied to
large-insert clones
Generates a large number of fragments
Requires high-resolution separation of
fragments
Can be done with gel electrophoresis
- 32. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Analysis of restriction fragments
Computer programs perform automatic
fragment-size matching
Possibilities for errors
Fragments of similar size may in fact be
different sequences
Repetitive elements give same sizes, but from
different chromosomal locations
- 33. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Gel image processing
- 34. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
FPC: fingerprint analysis window
- 35. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Building contigs by probing with
end fragments
Isolate DNA from both
ends of insert and mix
Label and probe
genomic library
Identify hybridizing
clones
Repeat with ends of
overlapping clones
- 36. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Chromosome walking
Combines probing with
insert ends and
restriction mapping
First find hybridizing
clones
Then create a
restriction map
Identify the clone with
the shortest overlap
Make probe from its end
Repeat process
probe
library
probe library
- 37. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequencing
All large-scale sequencing projects use the
Sanger method
Based on action of DNA polymerase
Requires template DNA and primer
Polymerase and nucleotides
Polymerase adds nucleotides according to
template
Small amount of nucleotide analog included
Stops synthesis
- 38. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequencing reaction
Chain-termination
method
Uses dideoxy
nucleotides
When added in right
amount, the chain is
terminated
Every time that base
appears in template
Need a reaction for each
base: A, T, C, and G
3’ ATCGGTGCATAGCTTGT 5’
5’ TAGCCACGTATCGAACA* 3’
5’ TAGCCACGTATCGAA* 3’
5’ TAGCCACGTATCGA* 3’
5’ TAGCCACGTA* 3’
5’ TAGCCA* 3’
5’ TA* 3’
Sequence reaction products
Template
- 39. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence detection
To detect products of
sequencing reaction
Include labeled
nucleotides
Formerly, radioactive
labels used
Now, fluorescent labels
used
Use different fluorescent
tag for each nucleotide
Can run all four bases in
same lane
TAGCCACGTATCGAA*
TAGCCACGTATC*
TAGCCACG*
TAGCCACGT*
- 40. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence separation
Terminated chains need
to be separated
Requires one-base-pair
resolution
See difference between
chain of X and X+1
base pairs
Gel electrophoresis
Very thin gel
High voltage
Works with radioactive
or fluorescent labels
A T C G
–
+
- 41. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Capillary electrophoresis
Newer automated
sequencers use very thin
capillary tubes
Run all four
fluorescently tagged
reactions in same
capillary
Can have 96 capillaries
running at the same time
96–well plate
robotic arm and syringe
96 glass capillaries
load bar
- 42. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence reading of radioactively
labeled reactions
Radioactively labeled
reactions
Gel dried
Placed on X-ray film
Sequence read from
bottom up
Each lane is a different
base
–
+
C A G T C A G T
- 43. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence reading of fluorescently
labeled reactions
Fluorescently labeled
reactions scanned by
laser as a particular
point is passed
Color picked up by
detector
Output sent directly to
computer
- 44. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Optical Mapping
• Single-molecule technique
Individual DNA molecules attached to glass
support
Restriction enzymes on glass are activated
When DNA is cut, microscope records length
of resulting fragments
Has potential to rapidly generate restriction
maps
Optical mapping was developed at New York University in the late 1990s by David Schwartz, now a professor of chemistry and genetics at the University of Wisconsin-Madison.
The method uses fluorescence microscopy to image individual DNA molecules that have been divided into orderly fragments by restriction enzymes.
- 45. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing I
Based on production of
pyrophosphate during
sequencing reaction
Each time polymerase
adds nucleotide (dNTP)
to the growing strand,
pyrophosphate (PPi) is
released
Amount released equal
to number of
nucleotides added
QuickTime™ anda
TIFF (Uncompressed) decompressor
are needed to seethis picture.
Ronaghi et al. (1998-07-17). "A sequencing method based on real-time pyrophosphate". Science 281: 363.
- 46. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing II
To quantitate amount of PPi released:
ATP sulfurylase converts PPi to ATP
ATP used by enzyme luciferase (firefly) to
produce light from the substrate luciferin
The amount of light produced is directly
proportional to the amount of ATP, which is
proportional to the amount of PPi released
- 47. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing III
Sequential addition of
each dNTP gives
sequence
Apyrase enzyme used to
degrade dNTPs after
reaction completed
Sequence read from
amount of light emitted
as each dNTP is added
Nucleotide sequence
Nucleotide added
“pyrogram,”
- 48. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing is a method of DNA sequencing based on the "sequencing by synthesis" principle.
The technique was developed by Mostafa Ronaghi and Pål Nyrén at the Royal Institute of
Technology in Stockholm in the 1990s.
"Sequencing by synthesis" involves taking a single strand of the DNA to be sequenced and
then synthesizing its complementary strand enzymatically. The Pyrosequencing method is
based on detecting the activity of DNA polymerase (a DNA synthesizing enzyme) with
another chemiluminescent enzyme. Essentially, the method allows sequencing of a single
strand of DNA by synthesizing the complementary strand along it, one base pair at a time, and
detecting which base was actually added at each step. The template DNA is immobilized, and
solutions of A, C, G, and T nucleotides are added and removed after the reaction, sequentially.
Light is produced only when the nucleotide solution complements the first unpaired base of the
template. The sequence of solutions which produce chemiluminescent signals allows the
determination of the sequence of the template.
ssDNA template is hybridized to a sequencing primer and incubated with the enzymes DNA
polymerase, , luciferase and apyrase, and with the substrates (APS) and luciferin.
The addition of one of the four deoxynucleotide triphosphates (dNTPs)(in the case of dATP
we add dATPαS which is not a substrate for a luciferase) initiates the second step. DNA
polymerase incorporates the correct, complementary dNTPs onto the template. This
incorporation releases pyrophosphate (PPi) stoichiometrically.
ATP sulfurylase quantitatively converts PPi to ATP in the presence of adenosine 5´
phosphosulfate. This ATP acts as fuel to the luciferase-mediated conversion of luciferin to
oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP.
The light produced in the luciferase-catalyzed reaction is detected by a camera and analyzed in
a program.
Unincorporated nucleotides and ATP are degraded by the apyrase, and the reaction can restart
with another nucleotide.
Currently, a limitation of the method is that the lengths of individual reads of DNA sequence
are in the neighborhood of 300-500 nucleotides, shorter than the 800-1000 obtainable with
chain termination methods (e.g. Sanger sequencing). This can make the process of genome
assembly more difficult, particularly for sequence containing a large amount of repetitive
DNA. As of 2007, pyrosequencing is most commonly used for resequencing or sequencing of
genomes for which the sequence of a close relative is already available.
- 49. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Who owns it?
Pyrosequencing AB in Uppsala. Sweden, was started to
commercialize the machine and reagent for sequencing of short
stretches of DNA. Pyrosequencing AB was renamed to Biotage in
2003. Pyrosequencing technology was further licensed to 454 Life
Sciences. 454 developed an array-based Pyrosequencing which has
emerged as a rapid platform for large-scale DNA sequencing. Most
notable are the applications for genome sequencing and
metagenomics. GS FLX, the latest pyrosequencing platform by
454 Life Sciences (owned by Roche), can generate 100 million
nucleotide data in a 7 hour run with a single machine. It is
anticipated that the throughput would increase by 5-10 fold with
the next release. Each run would cost about 5,000-6,000 USD,
pushing de novo sequencing of mammalian genomes into the
million dollar range.
- 50. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Membrane sequencing
Single DNA molecules
pass through pore in
membrane
Each nucleotide has
slightly different charge
Charge detected as
nucleotides pass through
membrane
Many problems need to
be worked out before
this method can be used
for genomic sequencing
- 51. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
From http://www.foresight.org/Nanomedicine/Sequencing.html
Nov. 1996 "Characterization of individual polynucleotide molecules using
a membrane channel" (John J. Kasianowicz, Eric Brandin, Daniel Branton,
David W. Deamer)
Nov. 1998 "Use of a Single Nanometer-Scale Pore to Rapidly Examine
Individual DNA or RNA Strands" (Mark Akeson, Daniel Branton, John J.
Kasianowicz, Eric Brandin, David W. Deamer)
Dec. 1999 "Microsecond time-scale discrimination among polycytidylic
acid, polyadenylic acid, and polyuridylic acid as homopolymers or as
segments within single RNA molecules" (M. Akeson, D. Branton, J.J.
Kasianowicz, E. Brandin, D.W. Deamer) Abstract Paper
Feb. 2000 "Rapid nanopore discrimination between single polynucleotide
molecules" (Amit Meller, Lucas Nivon, Eric Brandin, Gene Golovchenko,
Daniel Branton)
Apr. 2000 "Nanopores and nucleic acids: prospects for ultrarapid
sequencing" (D.W. Deamer, M. Akeson)
Abstract
Sep. 2000 "Nanopore Sequencing. Probing Polynucleotides with a
Nanopore: High Speed, Single Molecule DNA Sequencing" (Daniel
Branton, Jene Golovchenko)
- 52. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Summary I
Basics of mapping
Genetic mapping
Based on recombination frequencies
Physical mapping
Requires overlapping DNA fragments
Can use restriction enzymes
Probing with end fragments
Combination: chromosome walking
- 53. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Summary II
Basics of sequencing
Chain-termination method
Radioactive or fluorescent labels
Separated by gel or capillary electrophoresis
Read from X-ray film or by laser detector
New technologies
Optical mapping
Pyrosequencing
Membrane sequencing
- 54. Thank You
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458