Resolving Ambiguity in Target ID Screens - CRISPR-Cas9 Based Essentiality Profiling
•Télécharger en tant que PPTX, PDF•
1 j'aime•1,686 vues
Pathfinder Target Essentiality Assay Service A new CRISPR─Cas9 based medium throughput assay service for validation of target gene essentiality Can be used to resolve ambiguous screening results Can also provide information on drug target suitability This assay developed at Horizon will enable you to identify genes essential for the growth of specific cancer cell lines. It can be used to definitively resolve ambiguous screening results. Or to provide information on target suitability – by testing essentiality in “normal” cells, or in cancer subtypes different to the proposed patient population
Recommandé
Recommandé
Contenu connexe
Tendances
Tendances (20)
En vedette
En vedette (20)
Similaire à Resolving Ambiguity in Target ID Screens - CRISPR-Cas9 Based Essentiality Profiling
Similaire à Resolving Ambiguity in Target ID Screens - CRISPR-Cas9 Based Essentiality Profiling (20)
Plus de Candy Smellie
Plus de Candy Smellie (13)
Dernier
Dernier (20)
Resolving Ambiguity in Target ID Screens - CRISPR-Cas9 Based Essentiality Profiling
- 1. HORIZON DISCOVERY Resolving Ambiguity in Target ID Screens CRISPR-Cas9 Based Essentiality Profiling Julie Wickenden, PhD
- 2. 2 Pathfinder Target Essentiality Assay Service • A new CRISPR─Cas9 based medium throughput assay service for validation of target gene essentiality • Can be used to resolve ambiguous screening results • Can also provide information on drug target suitability
- 3. 3 Target ID and Validation | RNAi Loss of function analysis using RNAi is inexpensive and widely applicable However Shalem et al Science 2014 Problems with RNAi can result in false positives or negatives shRNA Total overlap only 3 genes HIV Host Factors Brass et al. Science 273 genes König et al. Cell 213 genes Zhou et al. Cell Host Microbe 300 genes Incomplete knockdown Lack of reproducibility Off-target effects
- 4. 4 The problems with RNAi Off-target effects of RNAi do not correlate with BLAST scores! Off-target effects can occur in a sequence-independent manner Sequence-related off-target effects of RNAi are driven by seed sequence
- 5. 5 Is there a better way to ID targets? High throughput KO screening with CRISPR-Cas9 Jinek et al. (2012) in Science Cong et al. (2013) in Science Mali et al. (2013) in Science Cho et al. (2013) in Nature Biotech Exploits NHEJ for KO generation
- 6. 6 Target Validation at Horizon | is CRISPR-Cas9 the answer? CRISPR-Cas9 KO technology is thought to have less severe off-target effects than shRNA Knock-out approaches can reveal phenotypes that are missed by knockdown approaches Cas9/sgRNA approaches to the validation of anti-proliferative targets have their own issues Only 2/3rd of repairs will cause a frameshift mutation that leads to early termination
- 7. 7 Pathfinder Target Essentiality Assay
- 8. 8 Target Essentiality Assay | Requirements 1. The cell line selected must robustly grow from single cells • 53 cell lines have been pre-evaluated for this assay (listed on a later slide) • Evaluation of your cell line of choice is possible should it not feature on this list 2. The guide RNA must efficiently direct Cas-9 nuclease activity to the DNA • If an efficient guide RNA has not been identified we can design and evaluate guides for you 3. The standard assay format is for cell lines where the copy number of the target gene is 2-3 • Should the copy number of your gene of interest be higher, we would recommend increasing the number of colonies screened to account for the expected increased diversity of allele editing combinations I will now outline the assay process using an essential gene as an example
- 9. 9 Target Essentiality Assay | Part 1 - Restriction Digest Analysis Selection of a suitable restriction enzyme • Target site of the guide RNA assessed for restriction endonuclease sites • The ideal digest site spans the Cas9 cut site TGGGAAATAGAAGCCAGTGAAGTGATGCTGTCCACTCGGATTGGGTCAGGCTCTTTTGGAACTGTTTAT • Cells are infected with sgRNA in pLentiCRISPR (Sanjana et al, 2015) • Cells are cultured in the presence of Puromycin for 2-3 weeks prior to plating for single cell colonies • The relevant region is amplified and analysed by restriction digest • Editing is detected by loss of the restriction digest site • Both heterozygous and homozygous editing can be detected sgRNA_Target Hpy188 PAM
- 10. 10 Target Essentiality Assay | Part 1 - Restriction Digest Analysis Modelled data • Disruption of the gene results in loss of the restriction enzyme site. • The method can only determine whether disruption has occurred, not whether it is a frameshift. All Alleles disrupted Some Alleles disrupted No Alleles disrupted
- 11. 11 Target Essentiality Assay | Part 1 – Restriction Digest Analysis Example results in a gene-target-dependent and -independent cell line Cell line A – Independent of Target Cell line B – Dependent on Target
- 12. 12 Target Essentiality Assay | Part 2 – Fragment Analysis • Selected colonies are analysed by fragment analysis PCR Fragment analyser Fragment size In-del Sample Name Allele 1 Allele 2 Allele 1 Allele 2 F12_Parental 417 0 A01_1D1 387 -30 G01_4H6 413 415 -4 -2 B03_2I9 402 417 -15 0 D04_3A12 422 5 B05_1N13 418 1 B01_4E1 416 417 -1 0 D02_5C7 414 417 -3 0 C03_3F9 418 1 E02_1F8 334 414 -83 -3 E03_4D9 369 417 -48 0 F04_4D12 413 -4 E05_2L13 374 -43 D01_3N2 408 417 -9 0 F02_2C8 426 9 F03_4G9 301 -116 F05_3B13 414 -3 B02_2E7 399 -18 G02_2L8 416 417 -1 0 B04_4J11 400 -17 G04_5I12 414 417 -3 0 G05_5E13 405 407 -12 -10 E01_1D3 369 -48 C04_5J11 417 423 0 6 H05_5O13 417 0 C06_4C17 414 418 -3 1 F01_3H3 390 -27 C02_4B7 413 -4 Non-disrupted Allele Disrupted Allele Expected size – 417bp
- 13. 13 Target Essentiality Assay | Part 2 – Fragment Analysis • Results are correlated with restriction digest results to identify the true editing events in the clones Homozygous editing confirmed by fragment analysis. Homozygous editing revealed by fragment analysis. Heterozygous editing confirmed by fragment analysis, presence of WT length fragment. Heterozygous for fragment length, WT length fragment present.
- 14. 14 Target Essentiality Assay | Optional – Sequencing • If further confirmation of the editing events is required we can perform Sanger sequencing • This can be used to verify the fidelity of the fragment analysis assay Restriction digest assay Fragment length assay Deletion by Fragment assay Sequencing data Parental cells No disruption of FauI site 394 0bp …TTTGTGGTGGATGCAACCCGCAAGGGTAACAA… Wild type sequence Example clone A Homozygous disruption of FauI site 394 & 379 0bp & 15bp …TTTGTGGTGGATGCAACCCGGAAGGGTAACAA… 1 bp substitution in FauI site …TTTGTGGTGGATG----------------CAA… 16 bp deletion Example clone B Homozygous disruption of FauI site 394 & 347 0bp & 47bp …TTTGTGGTGGATGCAACCTGCAAGGGTAACAA… 1 bp substitution in FauI site …TTTGTGGT------------------------… 47 bp deletion Example clone C Homozygous disruption of FauI site 394 & 379 0bp & 15bp …TTTGTGGTGGATGCAAAAAGCAAGGGTAACAA… 3 bp substitution …TTAA----------------AAGGGTAACAA… 17 bp deletion + 2 bp substitution Example clone D Homozygous disruption of FauI site 394 0bp …TTTGTGGTGGATGCAACCCGAAAGGGTAACAA… 1 bp substitution in FauI site …TTTGTGGTGGATGCAACCCGAAAGGGTAACAA… 1 bp substitution in FauI site
- 15. 15 Target Validation at Horizon | CRAF CRAF was a target gene in Horizon’s Target Validation alliance with H3 Biomedicine Aim: Validate CRAF dependence in human KRAS mutant NSCLC – prediction of Barbacid and Tuveson papers Cancer Discovery. 2011 Jul;1(2):128-36 Cancer Cell. 2011 May 17;19(5):652-63
- 16. 16 Target Validation at Horizon | CRAF Approach • 8 KRAS wild-type and 13 KRAS mutant NSCLC cell lines • Expression of dox-inducible shRNAs vs. KRAS (x3) , CRAF (x3) or controls in those lines • Assay CRAF dependence of growth in 2D – with follow up in spheroids, soft agar and in vivo experiments • Confirm knockdown and check for pathway modulation • Rescue phenotypes with shRNA resistant cDNAs & KI mutations 100ng/ml Dox WB: CRAF WB: β-Actin + − + − + − + − + − CRAF#1 CRAF#2 CRAF#3 Scrambled Uninfected KRAS WT NCI-H1299 cells KRASWT cells were generally resistant to shRNA vs CRAF
- 17. 17 Target Validation at Horizon | CRAF • shRNA results investigating CRAF dependence in KRAS mutant cells were ambiguous • Good knockdown of the target was achieved, but only 2 of the shRNA produced an anti-proliferative phenotype +− +− +− +− +− CRAF#1 CRAF#784 CRAF#911 Scrambled Uninfected 100ng/ml Dox WB: CRAF WB: β-Actin 50% 25% KRASMT A549 cells Overall KRAS mutant cells tended to be sensitive to shRNA vs CRAF, But effective CRAF KD can occur without growth inhibition (CRAF#784)cDNA rescue experiments were also inconclusive.
- 18. 18 Target Essentiality Assay | CRAF We attempted to validate CRAF using an array- based sgRNA method, but this also resulted in ambiguous results . An anti-proliferative phenotype was observed but this was not complete. The Pathfinder Essentiality Assay, revealed CRAF was dispensable: ~30% of A549/sgCRAF clones have out-of-frame or large deletions in all 3 alleles of CRAF
- 19. 19 Target Essentiality Assay | Workflow This offering consists of a basic workflow, with optional “add-ons”; so you can tailor the work-plan to fit your needs. Guide RNA evaluation (5xsgRNA) Cell line evaluation (6 lines) Main workflow Optional “add-ons”* Fragment analysis (48 samples per cell line per target) Additional fragment analysis (per 48 samples) Restriction digest analysis (384 samples per cell line per target) Additional restriction digest analysis (per 384 samples) Cell line infection, growth and plate out (4 cell lines and 5x384-well plates per target) Plate out of additional plates (per 5x384 well plates) Sanger Sequencing * May incur additional costs
- 20. 20 Cell lines Available for Target Essentiality Assay (53 cell lines) *Other cell lines can be evaluated for suitability with an extra fee Tissue Bone marrow K-562 KG-1 Breast MCF7 MCF10A MDA-MB-231 BT-474 BT-549 CAL-148 T47D Colon/cecum DLD-1 HCT116 SW48 COLO 320DM LoVo LS411N RKO VACO 432 SW480 HT29 HT55 Kidney 786-O RCC-MF G401 Lung A549 HCC827 NCI-H460 NCI-H520 NCI-H838 SK-LU-1 Oesophagus KYSE-70 KYSE-150 KYSE-270 TE-4 Ovarian A2780 CHO K1 ES-2 Pancreatic PANC-1 MIA-Paca-2 Prostate PC-3 DU145 LNCaP Peripheral blood JURKAT NALM-6 RPMI-8226 Skin A375 IGR-1 Soft Tissue KYM-1 RD Urinary bladder HT 1376 J82 Uterus/Cervix HEC-1-A HeLa SK-UT-1
- 21. 21 CRISPR-Cas9 | Functional Genomic Screening • Functional genomic screening in pooled lentiviral system • Infrastructure adopted from shRNA screening • sgRNA enrichment scored by next generation sequencing Mixed population Resistant cells SequencesgRNA Library Library AssemblyLibrary Design sgRNA Library Compound Treatment Cas9 + sgRNA transduction
- 22. 22 CRISPR-Cas9 | CRISPRi and CRISPRa • Repurposed screening using CRISPR technology • Catalytically-inactivated Cas9 (dCas9) fused to transactivation domain (CRISPRa for activation) or repressor domain (CRISPRi for inhibition) • Target to gene promoters using sgRNAs • CRISPRi: Tackle essential genes • CRISPRa: Screen for gain-of-function mutations CRISPRa West Coast CRISPRa East CoastCRISPRi dCas9 Catalytically inactive dCas9-KRAB fusion Version 1 (2013) Version 2 (2014) Qi et al 2013 Gilbert et al 2013 Gilbert et al 2014 Konermann et al 2015 Mali et al 2014Gilbert et al 2013
- 23. 23 Repositioning Patient stratification LOH2LTarget ValidationTarget ID Genetic screens Gene trap CRISPR-Cas9 siRNA Knockdown or KO Activity dead KI mutations Generation of isogenic cell lines MOA cell-based assays Compound profiling in isogenic and non-isogenic cell panels Working with Horizon | Services Available Drug combination screening Genetic screens Target essentiality assay TIDVAL alliances Target validation & early stage drug discovery collaborations Finding a development path for stranded clinical assets In vivo models including PDX models
- 24. Your Horizon Contact: t + 44 (0)1223 655580 f + 44 (0)1223 655581 e info@horizondiscovery.com w www.horizondiscovery.com Horizon Discovery, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom Julie Wickenden Team Leader j.wickenden@horizondiscovery.com +44 1223 655580 (ext 5664)
Notes de l'éditeur
- Pleasure to be here to today to tell you more about Horizon and our suite of technologies based around a core expertise in human genome editing and how we are applying this to better understand the human genome, find new validated targets and support targeted drug discovery with predictive, genetically-defined, in vitro models that accurately represent target patient groups.
- Welcome and thank you for joining me today to talk about the Pathfinder Target Essentiality assay. This assay developed at Horizon will enable you to identify genes essential for the growth of specific cancer cell lines. It can be used to definitively resolve ambiguous screening results. Or to provide information on target suitability – by testing essentiality in “normal” cells, or in cancer subtypes different to the proposed patient population
- But first lets talk about traditional methods of Target Validation A typical approach to both target ID and target validation is the use of RNAi, knocking down the target and looking for phenotypic effects. It is not without it’s weaknesses however. Whilst easy to use it is often challenging to achieve a complete knockdown of expression, and residual 5-10% of a transcript can result in masked phenotypes. Further to this, as this study demonstrates, RNAi screens are often difficult to reproduce – here we see three screens looking for HIV host factors, with an overlap of just 3 genes between the three. Hence there is a very real risk of false positives or negatives inherent to the technology.
- One of the most widely accepted caveats to using RNAi is that there can be significant off-target effects. These off-targets can be difficult to predict as they often don’t correlate with BLAST predictions There are known sequence independent off target effects Exogenous expression of shRNA can overload the Drosha/Dicer machinery, interfering with normal miRNA processing Introduction of RNAi in a cell can displace exogenous miRNA from RISC, altering normal patterns of gene expression Seed sequence is a known driver of off-target effects, complementarity between the 5’ region of the shRNA and 3’UTR of mRNA means that a single shRNA can affect hundreds of mRNA Moreover, imprecise hairpin processing leads to multiple siRNAs each with its own seed sequence
- The discovery of CRISPR-Cas9 has revolutionised Target ID. The CRISPR-Cas9 machinery can be used to generate complete genetic knockouts, overcoming false negatives due to incomplete knockdown in shRNA screening. The technology relies on a single guide RNA sequence to direct Cas-9 to the gene of interest where it introduces a double strand break. The break is then repaired by Non-homologous end joining (NHEJ) resulting in insertions or deletions at the cut site. Frameshift mutations should result in knockout of the gene of interest.
- CRISPR-Cas9 is thought to have less severe off target effects than shRNA Complete knock out of the target can overcome threshold effects that are seen in siRNA experiments However, sgRNA isn’t without it’s own issues: To help explain this here is some modelled data comparing shRNA and sgRNA Parental cell line (in red) grows exponentially with a doubling time of 24 hours. shRNA (in green) reduces proliferation by 75%, increasing doubling time to 72 hours. sgRNA (in blue) eliminates essential target in 80% of cells, but 20% of the remaining population continues to grow with the same 24 hour division time as the parental line Relying on gene editing by NHEJ means that only 2/3 repairs will cause a frameshift mutation, thus any in frame mutations may not fully disrupt the gene. However it is not possible to determine whether this is truly the case in a heterogeneous population.
- In order to overcome this problem we have used our vast experience in cell line engineering and the workflow required to analyse edited cells at a clonal level to develop the Pathfinder Target Essentiality assay. In this assay we target Cas9 to the gene of interest, and then culture colonies from single cells dilution. 100’s of colonies are analysed to determine whether any clones can be recovered that possess a complete genetic knockout. If either no or very few colonies contain frameshift knockouts on all alleles, the target is deemed essential in that cell line.
- To explain the requirements of the assay in more detail: The assay relies on being able to screen hundreds of colonies therefore the cell lines of choice must robustly grow from single cells We have a list of 53 cell lines which have been pre-evaluated for this assay, however we can evaluate any cell line for suitability in this assay. The guide RNA must efficiently direct cas-9 nuclease activity to the DNA If you do not already know of an efficient guide RNA then we can design and evaluate them for you. We have designed the standard assay to be suitable for cell lines where the copy number of your gene of interest is 2 or 3. If the copy number of your gene of interest is higher then we would recommend increasing the number of colonies screened to account for the expected increased diversity of allele editing combinations I will now outline the assay process using an essential gene as an example
- The first step in the process is to determine the restriction digest to be used in the assay. The ideal digest site spans the Cas-9 cut site The cell lines of choice are infected with the sgRNA in an all in one vector, we use the pLentiCRISPR vector from the Zhang lab. The infected population is cultured in the presence of puromycin for 2-3 weeks to ensure all alleles have been fully edited The cells are then plated as single cells and allowed to grow. Once the colonies have reached a sufficient size the colonies are harvested and we perform a PCR of and determine editing by restriction digest assay. Editing is detected by loss of the restriction digest site Using this method we can evaluate whether heterozygous or homozygous editing has occurred.
- Here is some modelled data to explain this part of the assay Digested PCR products are resolved by gel electrophoresis, the migration pattern of the band indicates whether editing has occurred. For example, in this lane labelled with a yellow star all of the PCR product has been digested, meaning the restriction digest site is intact in all alleles and therefore it is unlikely editing has occurred in this colony. In these lanes labelled with the orange stars, we have a proportion of digested and undigested product, this indicates that the colonies are heterogeneous for editing. In the lane labelled with a blue star none of the PCR product has been digested by the restriction enzyme, indicating that editing has occurred on all alleles *CLICK* We then allocate the colonies to each category to visualise the overall data.
- Here is an example of some real data generated using a target in two cell lines, one that is dependent on the target, and one that is independent. In the independent line, the gel image shows quite nicely that all the colonies have some editing and when we collate all the data in a graph we can see that there are no unedited colonies, the majority of the colonies are edited on all alelles *CLICK* When we look at the essential line, the data shows that the majority of colonies have no editing, with only very few colonies having either heterozygous or homozygous editing.
- Fragment analysis often produces a partial (??) number, therefore manual rounding of figures occurs. Sequencing a few samples enables the fidelity of the assay to be verified
- We predicted that these results were due to the occurrence of in-frame editing in the CRAF gene.
- So, what else are we doing with CRISPR-Cas9? We can…………