Branche-technical report 1

254 vues

Publié le

0 commentaire
0 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Vues
Nombre de vues
254
Sur SlideShare
0
Issues des intégrations
0
Intégrations
3
Actions
Partages
0
Téléchargements
1
Commentaires
0
J’aime
0
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

Branche-technical report 1

  1. 1. Branche Emilie Mai 2009 Rapport technique Master 2 : Génétique fonctionnelle et pathologie cellulaire (46 700 caractères) Implication du virus de l’hépatite C dans les métabolismes lipidique et glucidique. Inserm U871 Physiopathologie moléculaire et nouveaux traitements des hépatites virales 151 cours Albert Thomas - 69424 LYON cedex 03 Responsable : Dr Bartosch
  2. 2. 2 Abréviations ACC : acétyl-CoA carboxylase AG : acides gras ApoB : apolipoprotéine B bHLH/ZIP : famille des basics helix loophelix- leucine zipper ChoRE : l’élément de réponse aux carbohydrates ChREBP : protéine liant l’élément de réponse aux carbohydrates Domaine PTB : domaine liant les tyrosines phosphorylées Domaine SH2 : domaine Src homology 2 E2 : protéine d’enveloppe du virus de l’hépatite C FAS : synthase des acides gras GK : glucokinase GSK-3 : Glycogène synthase kinase 3 G6P : glucose-6-phosphate G6PDH : glucose-6-phosphate déshydrogénase IRS : substrat du récepteur à l’insuline JNK : C-Jun N-terminal kinase L-PK : L-pyruvate kinase LXR : récepteur X du foie mTOR : mammalian target of rapamycin MTP : protéine de transfère des triglycérides microsomales PDE : phosphodiestérase PDK1 : phosphatidylinositol-dependent kinase 1 PIP2 : phosphatidylinositol biphosphate PIP3 : phosphatidylinositol triphosphate PI-3K : phosphatidylinositol 3 kinase PKB : protein kinase B PKC : protéine kinase C PTEN : homologue de la phosphatase et de la tensine deleté du chromosome 10 P85 : sous-unité régulatrice de la phosphatidylinositol-3-kinase p110 : sous-unité catalytique de la phosphatidylinositol-3-kinase RI : récepteur à l’insuline SHIP-2 : inositol 5’-phosphatase contenant un domaine SH2 SRE : élément de réponse aux carbohydrates SREBP-1c : protéine liant l’élément de réponse aux stérols VHC : virus de l’hépatite C VLVD : lipoprotéine de très faible densité TG : triglycérides
  3. 3. 3 Résumé L’infection par le virus de l’hépatite C (VHC) est une cause majeure de maladies chroniques du foie avec une estimation de 170 millions de personnes infectées à travers le monde. La gravité des maladies du foie associées au virus est très variable allant d’une inflammation minime à la cirrhose et le carcinome hépato-cellulaire. Il s’agit du seul virus connu pour perturber les métabolismes lipidique et glucidique entrainant le développement de stéatose, de diabète de type 2 et/ou d’une résistance à insuline. Les mécanismes par lesquels le VHC altère ces deux voies métaboliques sont encore peu connus. Dans cette étude nous avons analysé la régulation de l’expression de certaines protéines impliquées dans la voie de signalisation de l’insuline ainsi que dans celle du glucose dans un contexte d’infection ou non par le VHC. Pour les protéines impliquées dans la signalisation insuline, nous avons montré que le récepteur à l’insuline ainsi que son substrat étaient sous-régulés lors de l’infection, et que des protéines régulant négativement cette voie, comme l’homologue de la phosphatase et de la tensine deleté du chromosome 10 (PTEN), l’inositol 5’-phosphatase contenant un domaine SH2 (SHIP2) et la C-Jun N-terminal kinase (JNK) étaient induites par l’infection. Nous avons montré qu’en plus de la signalisation de l’insuline, celle du glucose était également modifiée par l’infection par le VHC, en effet, le principal facteur de transcription sensible au glucose, la protéine liant l’élément de réponse aux carbohydrates (ChREBP) est sur-régulé. L’ensemble de ces résultats montre que le VHC ciblerai et modulerai l’expression et l’activité de plusieurs protéines cellulaires afin d’induire une résistance à l’insuline favorable à la réplication virale. Ces résultats ont été obtenus dans un système d’infection par le VHC in vitro, il serait important de les valider dans des études cliniques.
  4. 4. 4 Introduction L’agent étiologique de la majorité des cas d’hépatite non-A et non-B a été identifié comme le virus de l’hépatite C (VHC) en 1989. En accord avec son génome, il a été premièrement classé dans le genre des Flavivirus de la famille des Flaviviridae. Cependant, ce virus a plusieurs particularités qui le distinguent des autres flavivirus, comme par exemple son nombre limité d’hôtes sensibles (Pringle et al., 1999), il a de ce fait été classé dans le genre des Hepacivirus. En effet, l’infection par le VHC est restreinte à l’homme et au chimpanzé, alors que les Flavivirus peuvent infecter une gamme importante d’hôtes allant des insectes aux Mammifères (Rice et al., 1996). De plus, le VHC est limité à certains tissus : il se réplique essentiellement dans le foie (Hoofnagle, 2002), mais des expériences cliniques et expérimentales indiquent qu’il peut s’échapper du foie et se répliquer dans d’autres cellules, en particulier celles du système immunitaire (Radkowski et al., 2002 ; Blackard et al., 2006 ; Pham et al., 2006). Toutefois, ce virus est principalement hépatotropique et est une cause majeure de maladie chronique du foie avec une estimation de 170 millions de personnes infectées à travers le monde (Liang et al., 2000). La gravité des maladies du foie associées au VHC est très variable allant d’une inflammation minime à une cirrhose et le carcinome hépati-cellulaire (CHC) (Lerat et al., 2002). Le taux de progression de l’hépatite C chronique est aussi assez variable et dépendant de différents co-facteurs incluant l’âge, le sexe, la consommation d’alcool, le surpoids et les co-infections (Steff LB, 2002). Il s’agit du seul virus connu pour perturber les métabolismes lipidique et glucidique entrainant le développement d’une stéatose (correspondant à une accumulation de triglycérides dans les hépatocytes), d’un diabète de type 2 ou d’une résistance à l’insuline chez l’hôte (Alaei et al., 2008). Il modulerait le métabolisme lipidique afin de pouvoir se répliquer efficacement (Burlon et al., 2009). En fait, l’assemblage du VHC semble intimement lié à l’activité hépatique lipidique et plus particulièrement aux lipoprotéines de très faible densité (VLDL) (Miyanari et al., 2007). Différentes études ont observé une association entre le VHC et les lipoprotéines in vitro et in vivo (Burlone et al., 2009 ; Andre et al. 2002). En effet, il a été démontré que des VHC associés aux lipoprotéines de faible densité présentent une augmentation spécifique de l’infectiosité. De plus, certains pensent que l’association des particules virales avec les lipoprotéines pourrait masquer des épitopes neutralisants et ainsi faciliter l’échappement du virus au système immunitaire (Maillard et al., 2006). Le lien entre le cycle viral du VHC et le métabolisme hépatique lipidique peut donc avoir des effets significatifs sur le fitness viral. Le foie synthétise des acides gras (AG), stockés sous forme de gouttelettes lipidiques avant d’être transférées dans des VLDL
  5. 5. 5 contenant l’apolipoprotéine B (ApoB) qui vont être sécrétées dans le sang (Huang H et al., 2007). Ce processus est régulé à différents niveaux par les voies de signalisation du glucose et de l’insuline (Gibbons GF et al., 2002). Il a été montré que le VHC pouvait interférer directement avec la voie de l’insuline, induire une résistance à l’insuline menant à l’augmentation de la lipogenèse et de la synthèse des VLDL favorisant ainsi la production du VHC (Alaei M et al., 2008 ; Kasai D et al., 2009). Cette résistance à l’insuline peut également entrainer une stéatose ou un diabète de type 2 (Mason et al., 1999). On parle de résistance à l’insuline quand la concentration d’insuline nécessaire pour avoir une réponse métabolique est plus importante que la normale, ou alternativement quand la concentration normale d’insuline n’est plus suffisante pour avoir une réponse métabolique normale (Bugianesi et al., 2005). La signalisation de l’insuline est une voie très complexe impliquée dans de nombreux processus tels que la lipolyse, la lipogenèse, la glycogenèse ou encore la protéogenèse (Figure 1). Cette voie débute par la liaison de l’insuline sur son récepteur, un hétérotétramère constitué de deux sous-unités α liant le ligand et de deux sous-unités β à activité tyrosine kinase. La liaison de l’insuline sur les sous-unités α active l’une des sous- unité β engendrant une cascade d’autophosphorylation menant à l’activation complète du récepteur. Un des sites phosphorylés est reconnu par le domaine liant les tyrosines phosphorylées (PTB) des substrats du récepteur à l’insuline (IRS) dont IRS-1, IRS-2, IRS-3, IRS-4, Gab1 et Shc (Taha et al., 1999). Pendant cette interaction les substrats du récepteur à l’insuline sont phosphorylés sur différentes tyrosines, reconnues par des protéines possédant un domaine Src homology 2 (SH2) incluant le complexe Grb-2-SOS, SHP2, Nck et la sous-unité régulatrice p85 de la phosphatidylinositol-3-kinase (PI-3K). La liaison de Grb-2-SOS aux IRS ou à Shc initie la voie des MAP kinases qui entraine l’expression de gènes cibles impliqués dans la prolifération cellulaire. La liaison de la PI-3K à IRS active la sous-unité catalytique, p110, de la PI-3K qui va pouvoir phosphoryler le phosphatidylinositol biphosphate (PIP2) en phosphatidylinositol triphosphate (PIP3) (Canteley et al., 2002). Le PIP3 va activer la kinase-1 dépendante du phosphoinositol (PDK1) qui va alors phosphoryler AKT et mTOR. L’activation d’AKT va permettre d’activer, par l’intermédiaire de différentes protéines, la synthèse de lipides et de glycogène et d’inhiber la lipolyse et l’apoptose. L’activation de mTOR va stimuler la synthèse protéique. Plusieurs protéines exercent un contrôle négatif sur différentes étapes de cette signalisation, c’est le cas de la C-Jun N-terminal kinase (JNK) qui phosphoryle IRS sur une sérine à proximité du domaine PTB afin de l’inactiver (Lee et al., 2003) ou encore des deux lipides phosphatases PTEN (homologue de la phosphatase et de la tensine déleté du chromosome 10) et SHIP-2 (l’inositol 5’-phosphatase contenant un domaine SH2 )qui déphosphorylent le PIP3 en PIP2 (Clement S et al., 2001).
  6. 6. 6 Figure 1 : Représentation simplifiée de la voie de signalisation de l’insuline. La voie mitogénique est représentée en bleu. Les voies lipogénique et glucogénique sont représentées en vert. Une autre voie de signalisation activée par l’insuline induit l’expression de gènes lipogéniques (l’acétyl-coA carboxylase (ACC) et la synthase d’AG (FAS)) menant à la synthèse de lipides favorable au VHC. Jusqu’à récemment, seule la protéine liant l’élément régulateur des stérols (SREBP-1c) semblait être impliquée (Canbay A et al., 2007). Mais des études récentes ont identifié la protéine liant l’élément de réponse aux carbohydrates (ChREBP, aussi nommée MLX interacting protein-like (MLXIPL)) comme un autre activateur important de l’expression des gènes lipogéniques (Kawaguchi T et al., 2001 ; Yamashita H et al., 2001) mais également glycolytiques (la L-pyruvate kinase (L-PK)). Comme SREBP-1C, ChREBP est un facteur de transcription appartenant à la famille des basics helix-loophelix-leucine-zipper (bHLH/ZIP), exprimé principalement dans le foie. Le glucose stimule la lipogenèse en activant ChREBP et plus particulièrement en régulant son transport du
  7. 7. 7 cytoplasme au noyau (Kawaguchi T et al., 2001). L’insuline, quant à elle, est capable d’activer le récepteur X du foie (LXR) qui est un facteur de transcription permettant l’expression des gènes ChREBP et SREBP-1C. ChREBP agirait en synergie avec SREBP-1c en se liant à l’élément de réponse aux carbohydrates (ChoRE) situé dans les régions promotrices des gènes lipogéniques (ACC et FAS). En revanche, il serait seul pour induire l’expression du gène L-PK impliqué dans la glycolyse. Or il a été montré que la lipogenèse n’était pas seulement régulée par les voies insuline/SREBP- 1C mais aussi par la signalisation du glucose (Dentin et al., 2005), par conséquent le VHC, en régulant cette voie, pourrait augmenter la lipogenèse et donc la quantité de lipides disponibles pour la formation de VLDL favorable à la production virale. Figure 2 : Signalisation simplifiée du glucose et de l’insuline. La voie de signalisation du glucose est représentée en bleu et celle de l’insuline en rose. Les gènes lipogéniques peuvent être activés par deux voies distinctes, une dépendante du facteur de transcription ChREBP qui est activée par la fixation de l’insuline sur son récepteur ou par l’entrée du glucose dans la cellule et l’autre dépendante de SREBP-1C activée seulement par l’insuline Étant donné que le VHC est impliqué dans le développement de la résistance à l’insuline, Nous avons étudié la sur- ou sous-régulation de certaines protéines impliquées dans les voies de signalisation de l’insuline et du glucose dans un contexte d’infection par le VHC ou non. Nous avons sommes intéressés à la régulation du récepteur à l’insuline (RI) et de IRS-1 ainsi qu’à celle de PTEN, SHIP2 et JNK qui sont des régulateurs négatifs de la voie de l’insuline. Concernant la signalisation du glucose nous avons observé la régulation de la protéine ChREBP. Nous avons utilisé pour ces études la seule lignée cellulaire capable de répliquer efficacement le VHC, les cellules Huh 7.5, ainsi qu’une lignée cellulaire beaucoup
  8. 8. 8 moins permissive, HepG2 CD81. Afin d’étendre ces études à d’autres lignées cellulaires du foie ou à des tissus primaires, nous avons en parallèle développé un génome infectieux du VHC exprimant des marqueurs de sélection nous permettant d’obtenir une lignée cellulaire compétente pour la réplication du VHC.
  9. 9. 9 Matériel et méthode Culture cellulaire: La lignée Huh 7.5 est un clone dérivé de Huh 7 qui réplique fortement le VHC (Blight KJ et al., 2002).Les cellules sont maintenes en culture à 37°C et 5% de CO2, elles sont cultivées en DMEM (Invitrogen) supplémenté avec 10% de SVF, 2,4% de pénicilline/streptomycine (GIBCO), glutamax (GIBCO) et 1,2% de sodium pyruvate (GIBCO). Les cellules d’hépatocarinome humain, Hep G2, sont cultivées dans les même conditions et le même milieu. Production de VHCcc: Le plasmide pJFH1, codant pour l’intégralité du génome du VHC et contenant trois mutations adaptatives qui augmentent l’infectiosité, deux dans le protéine core, F172C et P173S et une dans la glycoprotéine d’enveloppe E2, N534K (Delgrange et al., 2007). Afin de réaliser une transcription in vitro, l’ADN est linéarisé avec XbaI, ce site est situé en 3’ après la queue polyA, purifié avec le kit Qiagen, puis transcrit en ARN avec le kit Megascript®T7 (Ambion). L’ARN est purifié par une méthode de phénol-chloroforme acide (Ambion) et électroporé dans les cellules Huh7.5 comme décrit précédemment (Kato et al., 2003). Pour l’électroporation la quantité d’ARN est ajustée à 10µg, les cellules sont traitées avec de la trypsine, lavées dans du Opti-MEM puis sont resuspendues à 2.107 cellules/ml dans du PBS froid. Les 10µg d’ARN sont ensuite mis en contact avec 200µl de suspension cellulaire dans une cuvette d’électroporation 0,2 cm (Bio-Rad). Les cellules sont ensuite électroporées à 140V avec le système d’électroporation Gene Pulser Xcell (Bio-Rad). Les cellules électroporées sont transférées dans des boites de 10cm de diamètre contenant 12 ml de milieu DMEM complet. Après 7-15 jours, en fonction de la croissance cellulaire, le milieu contenant les virus est récolté, filtré et ajouté sur les cellules cibles pour l’infection. Infection par les VHCcc: Les cellules Huh 7.5 ou HepG2 CD81 sont ensemencées 24 h avant l’inoculation. Pour l’infection, le milieu est remplacé par le surnageant viral dilué et les cellules sont incubées pendant 4h à 37°C. Les surnageants sont enlevés et les cellules infectées restent dans du milieu DMEM complet durant 72h avant d’être analysées par immunofluorescence en utilisant un anticorps dirigé contre la protéine core du VHC (Abcam) comme décrit précédemment (Wakita et al., 2005).
  10. 10. 10 Immunorévélation: L’infection des cellules Huh 7.5 et HepG2 CD81 est réalisée avec une MOI (multiplicity of infection) supérieure à 1. Après 0, 24, 48, 72 ou 120h d’infection, les cellules sont récoltées par un traitement à la versene puis lysées dans une solution de lyse (0.5% triton X-100, 50mM Tris-Cl pH 7.5, 150 mM NaCl, 2 mM EDTA (inhibiteur de protéases) (Roche)). Les lysats sont ensuite clarifiés par centrifugation à 14000 rpm pendant 10 min à 4°C. Puis la concentration est déterminée par méthode de Bradford (Sigma). Les lysats cellulaires sont tout d’abord préparés avec du tampon de charge dénaturant 5X (250mM Tris pH 6,8, 10% SDS, 50% glycérol, 0,02%bleu de bromophénol, 10% de β-mercaptoethanol). Enfin, les échantillons sont chauffés à 95°C pendant 1min puis analysés par SDS-PAGE (à 4% pour le gel de concentration et 12% pour le gel de séparation). Les protéines sont ensuite transférées sur une membrane de nitrocellulose (Hybond ECL, Amersham Biosciences). La membrane est saturée durant 1h dans du TBST (25mM Tris-HCL (pH 7,5), 150mM NaCl, 0,1% Tween 20) supplémenté de 4% lait écrémé. La membrane est incubée dans l’anticorps primaire puis dans l’anticorps secondaire couplé à la péroxydase, tous deux dilués dans du TBST-lait 4%. Les dilutions des anticorps ont été mises au point. Différents anticorps primaires sont utilisés : un anticorps AP33 (Arvin Patel) anti-glycoprotéine E2 ; un anti-récepteur à l’insuline, un anti-IRS-1, un anti PTEN, un anti-SHIP2 et un anti-P-JNK (Santa Cruz) ; un anti-ChREBP (Thermo scientific). Les anticorps secondaire anti-chèvre et anti-lapin proviennent de chez Dako et l’anti-souris de chez Sigma. La membrane est ensuite révélée avec le kit de révélation ECL Supersignal West dura (Pierce). L’actine cellulaire est détectée en utilisant un anticorps spécifique (Sigma) afin de comparer la quantité de protéine chargée dans chaque puits. Clonage : Nous utilisons un plasmide approprié à la transcription de JFH1. Dans le cadre de ouvert lecture de JFH1, le Dr Durantel (Inserm U871) avait déjà inséré les sites de restriction Mlu et BglII permettant l’insertion de séquence ectopique en phase avec le gène NS5A (Moradpour D et al., 2004). Nous avons inséré grâce au site MluI et BglII un fragment amplifié par PCR en utilisant la Taq polymérase de chez NEB comme recommandé par le fabricant. Les produits PCR codant pour les gènes de résistances à l’hygromycine ou la blasticidine grâce aux amorces utilisées ont un site MluI au début de la séquence codante et un site BamHI (compatible avec BglII) en C-terminal (Hygromycine anti-sens: 5’CTAGggatccATGACCGAGTACAAGCCCAC 3’, Hygromycine sens : 5’ GCG GacgcgtGGCACCGGGCTTGCGGG 3’, Blasticidine anti- sens : 5’ GAACggatccATGG CCAAGCCTTTGTCTCA 3’, Blasticidine sens : 5’ GAAGacgcgtGCCCTCCCACACAT AACCA 3’). Les codons stop des gènes de sélection sont enlevés afin de permettre la traduction en phase avec le cadre ouvert de lecture du génome du VHC. Les produits PCR sont purifiés avec le kit de
  11. 11. 11 purification Qiagen puis digérés avec MluI et BamHI (NEB) et ligués dans le plasmide JFH1 modifié et ouvert par MluI et BglII. Les ligations sont ensuite transformées dans des bactéries compétentes Top10 (Invitrogen). Les mini et maxi préparations sont vérifiées par séquençage des inserts. RT-PCR Les cellules infectées et non infectées sont récoltées après trypsination et l’ARN total est préparé (RNeasy; QIAGEN) et quantifié. La synthèse d’ADNc est réalisée avec le kit SuperScript III Reverse Transcriptase d’Invitrogen en mélangeant 1µg d’ARN avec 200 ng d’oligo dT et 1 µl de dNTP 10mM. Le mélange est incubé à 65°C pour 1 min et dans la glace 1min également. Puis 4 µl de mélange de réaction First strand, 1 µl de dithiothreitol 0,1 M, 1 µl de RNAse Out et 1 µl de transcriptase inverse sont ajoutés, le mélange est incubé à 50°C durant 60 min dans un volume final de 20 µl. Afin d’éliminer l’ARN matrice, la RNAse H est ajoutée, suivie d’une incubation de 20 min à 37°C. Des dilutions au 10ème en séries sont effectuées avec l’ADNc obtenu et 1µl de chaque est utilisé pour une réaction PCR, réalisé avec une Taq polymérase (NEB) et des amorces spécifiques des gènes (tableau 1) dans les conditions standards. Gène Amorces spécifiques SREBP-1c sens 5’ ACACAGCGGTTTTGAACGACATC 3’ SREBP-1c anti-sens 5’ ACGGACGGGTACATCTTTACAG 3’ CHREB sens 5’ CAGCGTCGAGGTTTCACACT 3’ CHREB anti-sens 5’ CTGCTGTTTCCACGGTTGAG 3’ β-actine sens 5’ TTGTAACCAACTGGGACGATATGG 3’ β-actine anti-sens 5’ CGACCAGAGGCATACAGGGACAAC 3’ Tableau 1: Les différentes amorces utilisées pour la PCR.
  12. 12. 12 Résultats Régulation des protéines impliquées dans la voie métabolique lipidique dans un contexte d’infection par le VHC. Pour essayer de comprendre comment une infection par le VHC peut entrainer une résistance à l’insuline, nous avons étudié la régulation de l’expression de certaines protéines impliquées dans la signalisation de l’insuline. Pour cela, nous avons infecté des cellules Huh 7.5 avec le VHC et suivi l’expression de ces protéines par immunorévélation. Toutes les cellules sont infectées par VHCcc avec une MOI supérieure à 1. En général les cellules sont récoltées pour l’analyse avant infection (0h) puis à 24 et 72 h après l’infection. Dans quelques expériences, du fait d’une croissance lente des cellules infectées, nous avons changé le protocole pour maximiser la quantité de lysat cellulaire et nous avons récolté les cellules à 0, 48 et 120 heures. En effet, l’infection par le VHC avec une forte MOI a été décrite pour ralentir la croissance. Une immunorévélation avec un anticorps anti-actine a été réalisé afin de contrôler la quantité de lysat cellulaire déposée dans chaque puits (Figure 3). Ce control a été réalisé dans toutes les expériences suivantes. Figure 3 : Les cellules Huh 7.5 sont infectées par les VHC pendant différents temps, 0, 24 et 72 h puis sont récoltées et lysées. Afin de voir si la quantité de protéine déposée dans chaque puits est identique, les lysats sont analysés par immunomarquage avec un anticorps anti-actine. En plus d’avoir vérifié que la quantité chargée de lysats cellulaire était égale dans chaque puits, nous nous sommes assuré que les cellules avaient bien été infectées par les VHCcc en réalisant une immunorévélation avec un anticorps AP33 dirigé contre la protéine d’enveloppe E2 du VHC. Comme montré dans la figure 4, l’expression de la protéine E2 augmente au cours du temps d’infection. Par conséquent nous pouvons affirmer que les cellules Huh 7.5 sont bien infectées par le VHC. Comme pour l’actine nous avons réalisé ce control dans toutes les expériences.
  13. 13. 13 Figure 4 : Vérification de l’infection des cellules Huh 7.5 par les VHC. Les cellules infectées et non infectées sont récoltées à 0h, 48h et 120 h après l’infection par le VHC. Les lysats cellulaires sont fractionnés par SDS-PAGE et immunomarqués avec un anticorps anti-E2. Tout d’abord nous avons étudié l’expression de RI (récepteur à l’insuline) et d’IRS-1 (substrats liant le récepteur à l’insuline), car ces protéines sont toutes deux sous- régulées lors de la résistance à l’insuline (Okabayashi et al., 1989 ; Carvalho E et al., 1999 ; Renström F et al., 2007). Nous observons que l’expression du récepteur à l’insuline est diminuée après 24 h d’infection, puis semble rester stable (Figure 5A). L’expression de IRS-1 n’est pas affectée à 24 h mais à 72 h post-infection où elle est sous régulée de façon importante (Figure 5B); cette protéine pourrait même subir une dégradation par le protéasome comme cela déjà été décrit ( Zlande et al., 2002). Figure 5 : Analyse de l’expression du récepteur à l’insuline et de IRS-1 dans un contexte d’infection par le VHC. Les cellules Huh 7.5 infectées et non infectées sont récoltées à 0 h, 48 h et 72 h après l’infection par le VHC. Les lysats cellulaires sont fractionnés par SDS-PAGE et immunomarqués avec un anticorps polyclonal anti-récepteur à l’insuline (A) ou anti-IRS-1 (B). Puis nous avons étudié l’expression des différentes protéines régulant négativement la voie de signalisation de l’insuline, PTEN, SHIP2 et JNK. Les deux lipides phosphatases, PTEN et SHIP2 déphosphorylent le PIP3 en PIP2 empêchant ainsi la phosphorylation de AKT. JNK et plus précisément JNK phosphorylée (P-JNK) qui est la forme active, va phosphoryler IRS-1 sur une sérine à proximité du domaine PTB afin de l’inactiver. En effet, IRS-1 activé est phosphorylé sur des tyrosines. Comme montré en figure 6, ces protéines sont régulées différemment au cours du temps mais au final elles sont toutes sur régulées. Dans les premières 24 heures après l’infection l’expression des protéines PTEN et JNK n’est pas modifiée, mais elle est induite après 72h (Figure 6A, C). L’expression de SHIP2, quant à elle, augmente progressivement au cours de l’infection (Figure 6B).
  14. 14. 14 Figure 6 : Analyse de l’expression de protéines régulatrices impliquées dans la signalisation de l’insuline dans un contexte ou non d’infection par le VHC. Les cellules Huh 7.5 infectées et non infectées sont récoltées à 0 h, 24 h et 72 h après l’infection par le VHC. Les protéines cellulaires sont séparées par SDS-PAGE et immunomarquées avec un anticorps anti-PTEN (A) ou un polyclonal anti-SHIP2 (B) ou un monoclonal anti-P-JNK (C). Expression de la protéine ChREBP impliquée dans le métabolisme glucidique. Le lien entre l’assemblage du VHC et la production de VLDL est en accord avec les observations faites montrant que le VHC favorise l’insulino-résistance (Alaei et al., 2008). Il est également clair que le VHC induit une sur-régulation de la lipogenèse (Alaei et al., 2008), probablement en fournissant une quantité de lipides nécessaire pour augmenter le taux de synthèse de VLDL. En effet, le VHC induit l’activation de l’un des facteur clé de la signalisation de l’insuline, le facteur de transcription SREBP- 1 (Oem et al., 2008). Cependant la lipogenèse n’est pas régulée que par la signalisation de l’insuline, la signalisation du glucose jouant également un rôle important (Dentin et al., 2005). Il est suggéré que le VHC sur-régulerait cette voie afin d’augmenter la lipogenèse et donc la synthèse de VLDL favorable au VHC. Nous avons voulu étudier le rôle de la signalisation du glucose dans la régulation lipidique, pour cela nous avons observé les effets de l’infection sur l’expression du principal facteur de transcription sensible au glucose, ChREBP. Les résultats sont encore préliminaires et devront être approfondis, mais il semblerait que l’expression de cette protéine soit induite lors de l’infection par le VHC. Dans la lignée cellulaire Huh 7.5, la quantité de protéine ChREBP est augmentée dès 48 h après l’infection (Figure 7A). Cette augmentation est également observée dans la lignée hépatocytaire HepG2 CD81 mais à 72h après l’infection (Figure 7B). Ce retard est surement due au fait que cette lignée est moins permissive à la réplication du virus. En effet, la réplication de HCV dans les cellules HepG2 CD81 contrairement à ce qui était observé dans les cellules Huh 7.5, était indétectable par western blot avec l’anticorps AP33 mais nous avons détecté un signal par RT-PCR en utilisant des amorces du brin positif du génome du VHC (données non présentées).
  15. 15. 15 Figure 7 : Analyse de l’expression de la protéine ChREBP dans des cellules infectées par le VHC. Les cellules Huh 7.5 (A) et HepG2 (B) sont infectées par les VHC pendant différents temps, 0, 24 et 72 h puis sont récoltées et lysées. Les lysats cellulaires sont fractionnés par SDS-PAGE et immunomarqués avec un anticorps polyclonal anti-ChREBP. Afin de voir si l’augmentation de niveau de la protéine ChREBP est due à une augmentation de la transcription, à une réduction de la dégradation ou à autre chose, nous avons réalisé une RT-PCR avec des amorces spécifiques de ChREBP et d’autres gènes contrôles que sont SREBP-1c et l’actine. La transcription de SREBP-1c a été décrite pour être sur-régulé par le VHC, et donc, sert de control positif. La transcription du gène de l’actine est utilisée comme contrôle négatif comme elle n’est pas modifiée par le VHC. En effet, la détection de transcrits de l’actine est identique dans les cellules infectées (Figure 8Aa) et non infectées (Figure 8Ab). Le premier couple d’amorces utilisé pour détecter les transcrits de SREBP-1c est peu sensible mais nous pouvons voir que SREBP-1c est visible seulement dans les cellules infectées par le VHC (avec l’ADNc le moins dilué), illustrant que ce gène est plus activement transcrit dans les cellules infectées (Figure 8Ba) que dans les cellules non infectées (Figure 8Bb). Ce résultat est confirmé par un deuxième couple d’amorces toujours spécifique de SREBP-1c (Figure 8C). Nous observons qu’il y a une quantité plus importante de SREBP-1c transcrit dans les cellules infectées. En effet, à la plus forte dilution (1/100), les transcrits sont détectables uniquement dans les cellules infectées (Figure 8Ca). Des résultats similaires sont observés pour ChREBP (Figure 8D), confirmant et appuyant les résultats obtenus par western blot. Mais cette expérience nous apporte une information complémentaire, puisqu’elle nous indique que la surexpression de protéine observée précédemment est due, au moins en partie à une sur-régulation de la transcription du gène ChREBP.
  16. 16. 16 Figure 8 : Analyse de la régulation de la quantité de d’ARNm codant ChREBP dans les cellules Huh 7.5 infectées par le VHC. Après 72 heures d’infection les cellules sont récoltées, les ARN totaux sont extraits et préparés. Puis l’ADNc est synthétisé, des dilutions au 10ème en séries sont effectuées et 1µl de chaque est utilisé pour les différentes réactions PCR réalisées avec des couples d’amorces spécifiques de l’actine (A), SREBP-1C (B,C) et de ChREBP (D). Nous détectons la différence de transcription de ces gènes dans les cellules infectées (a) et celles non infectées (b). Développement de nouvelles lignées capables de répliquer HCV efficacement. La lignée cellulaire hépatocytaire Huh 7.5 est hautement transformée, par conséquent son utilisation du glucose est très probablement altérée. En effet les cellules tumorales utilisent beaucoup de glucose du fait de leur fort taux de réplication. De plus, la réduction de la formation et de la sécrétion des lipides dans cette lignée cellulaire a déjà été décrite (Icard et al., 2009). Il semble donc nécessaire d’étudier les effets du VHC sur le métabolisme cellulaire lipidique et glucidique dans un contexte plus physiologique. Pour cette raison nous avons commencé à développer un système cellulaire alternatif plus physiologique du point de vue du métabolisme lipidique et glucidique qui serait également capable de supporter l’infection par le VHC. Un génome adapté du VHC exprimant différents marqueurs de sélection a été développé, afin de permettre la sélection de clones et de lignées cellulaire permissifs à la production du VHC. Comme pour les études sur les régulations des protéines impliquées dans les métabolismes glucidique et lipidique, nous avons utilisé le génome JFH1 contenant trois mutations spécifiques décrites pour augmenter l’infectiosité (Delgrange et al., 2007). Nous avons inséré dans ce plasmide des sites de restriction en phase avec le cadre de lecture ouverte du gène NS5A, nous permettant d’insérer des fragments obtenus par PCR codant pour des marqueurs de sélection comme les gènes de
  17. 17. 17 résistance à l’hygromycine ou à la blasticidine. En effet, il a été montré que l’insertion de gènes dans la région N-terminale de NS5A ne perturbait pas la réplication virale (Moradpour et al., 2004). Les plasmides obtenus sont ensuite vérifiés par séquençage et testés pour leur fonctionnalité. Après une transcription in vitro, les génomes de sélection sont électroporés dans les cellules Huh 7.5, qui sont ensuite cultivées trois jours sans pression de sélection, puis des quantités appropriées minimales d’antibiotiques nécessaires pour tuer les cellules non transfectées sont ajoutées dans le milieu. L’électroporation des génomes JFH1 codant pour l’hygromycine ou la blasticidine mène à un retard de croissance et des clones sont obtenus après 7-15 jours de culture dans le milieu sélectif. Une titration préliminaire indique que le titre viral est de 6.102 FFU/ml. Ce titre est probablement fortement sous-estimé (plusieurs magnitudes) comme les cultures n’ont pas été effectuées de manière appropriée due à des raisons de logistique. En effet, les pièces de culture cellulaire du laboratoire ont été fermées pour le déménagement de l’unité Inserm (avril-mai). Nous reprendrons ces cultures prochainement afin de réaliser une titration plus correcte.
  18. 18. 18 Discussion L’infection par le VHC induit une résistance à l’insuline, un syndrome métabolique associé à une augmentation de la lipogenèse et de la biosynthèse de VLDL pourrait favoriser la production et le fitness du virus. Les observations faites chez l’hôte démontrent que la résistance à l’insuline induite par le VHC a de fréquentes et sérieuses conséquences pathologiques qui se manifestent sous forme de stress oxydant ou de stéatose. L’interaction entre la résistance à l’insuline, le stress oxydant et la stéatose favorise fortement l’induction de la réponse inflammatoire et conduit à la fibrose du foie. L’infection chronique par le VHC peut donc créer un environnement extrêmement oxydatif qui favorise l’instabilité génomique, et qui, combiné avec les effets mitogènes directs de certaines protéines du VHC, doit probablement contribuer au processus de transformation maligne conduisant au cancer du foie (Caldwell et al., 2004 ; McGivern et al., 2008). En effet, l’infection chronique par le VHC est un facteur de risque majeur pour le développement d’un CHC (carcinome hépato-cellulaire); chaque année, 4-5% des patients infectés par le VHC développent un CHC. Des marqueurs sérologiques de l’infection par le VHC sont trouvés dans 27 à 80% des CHC, ce pourcentage variant en fonction de la localisation géographique. L’infection par le VHC augmente de 17 fois le risque de développer un CHC comparé à des patients sains (Donato et al., 2002 ; El-Serag HB 2002 ; Imazeki et al., 2003 ; Sun et al., 2003). Comme l’infection chronique du VHC est impliquée dans cette pathologie, il est important de comprendre le rôle de la résistance à l’insuline dans le cycle viral et ces effets dans la lipogenèse et l’assemblage de VLDL. Il apparait que le VHC induit une résistance à l’insuline et par conséquent une sur-régulation de la lipogenèse (Alaei et al., 2008) probablement pour fournir la quantité de lipides nécessaire pour augmenter le taux de synthèse de VLDL. En effet, le VHC permet l’activation de SREBP-1c, qui est un régulateur majeur de la lipogenèse induite par l’insuline (Oem et al., 2008). Cependant la lipogenèse n’est pas régulée uniquement par la voie insuline/SREBP-1c, mais également par la signalisation du glucose (Dentin et al., 2005), suggérant que le VHC peut sur-réguler cette voie de signalisation afin d’assurer l’augmentation de la lipogenèse. Dans cette étude nous avons étudié la régulation de l’expression de différentes protéines impliquées dans la signalisation de l’insuline comme du glucose, dans le but de mieux comprendre leurs impacts dans le processus d’assemblage, le cycle viral et plus particulièrement le rôle des lipoprotéines dans ce cycle. Comme le seul système in vitro de réplication du VHC disponible est basé sur un seul isolat viral très
  19. 19. 19 particulier et une seule lignée cellulaire hépatocytaire (Huh 7.5), nous avons analysé des modifications des signalisations de insuline et du glucose induite par le VHC dans ce système. Le récepteur à l’insuline qui est la première protéine jouant un rôle la signalisation de l’insuline, est, dans notre étude, sous-régulée dans les cellules infectées par le VHC ; ces résultats contredisent ceux observés dans l’étude de Kawaguchi et al. Ils observent que le niveau d’expression de ce récepteur reste inchangé après une expression de la protéine core du VHC que ce soit dans des cellules HepG2 transfectées ou dans des souris transgénique pour cette protéine (Kawaguchi et al., 2004). Cette différence peut-être due au fait que les systèmes d’étude ne sont pas identiques. En effet, notre étude est réalisée dans des cellules Huh 7.5 infectées par l’isolat JFH1 qui est de génotype 2a alors que Kawaguchi et al. travaillent dans des cellules HepG2 transfectées par la protéine core d’un virus de génotype 1a. Il est possible que les protéines régulées par le VHC pour induire une résistance à l’insuline varient en fonction des génotypes. La lignée cellulaire peut également avoir son importance, mais nous pouvons aussi penser que la diminution de l’expression du récepteur à l’insuline est due à une autre protéine que le core du VHC. Nous avons également étudié la régulation de IRS-1, qui une fois phosphorylée sur des tyrosines va pouvoir activer différentes voies dont la synthèse lipidique. La sous-régulation hépatique de cette protéine mène à une augmentation de la résistance à l’insuline (Araki et al., 1994). Lors de l’infection par le VHC, l’expression de IRS-1 est diminuée dans notre modèle d’étude. Ceci est en accord avec différentes études plus ou moins récentes qui ont montré que la protéine core du VHC induit la dégradation de IRS-1 (Kawaguchi et al., 2004 ; Pazienza et al., 2007). En effet, Rui L et al. ont observé que les protéines suppressives de la signalisation des cytokines, SOCS1 et SOCS3 induisent l’ubiquitination et la dégradation par le protéasome de IRS-1 dans l’ensemble des cellules et des tissus animaux étudiés, contribuant ainsi à l’établissement de la résistance à l’insuline ( Rui et al., 2002). Une étude semble contredire le fait que IRS-1 soit sous-régulée par le VHC. Elle démontre que l’association du récepteur à l’insuline avec IRS-1 est diminuée malgré l’augmentation de la quantité de ces deux protéines chez les patients infectés. Il semblerait que cette faible association soit due à la diminution de la phosphorylation des tyrosines de IRS-1 (Aytug et al., 2004). Ceci étant, les auteurs de l’étude admettent que l’observation de l’augmentation de l’expression de ces deux protéines est inattendue car on s’attend plutôt à la réduction de leurs expressions due à une dégradation protéolytique excessive médiée par une signalisation exagérée via le relargage de cytokines du fait de l’inflammation induite par le VHC (Petit et al., 2001).
  20. 20. 20 Le VHC sous-régule la signalisation de l’insuline également en induisant l’expression de deux lipides phosphatases, SHIP2 et PTEN. La seule étude qui observe l’expression de PTEN dans un contexte d’infection par le VHC est celle de Waris et al.. Ils montrent que l’expression de PTEN dans les cellules Huh 7.5 infectées avec le VHC est inchangée par rapport à celle des cellules non infectées, de manière intéressante ils observent une augmentation de PTEN-phosphorylé, la forme inactive de PTEN, dans les cellules infectées (Waris et al., 2007). Pour SHIP2 aucune étude dans la littérature n’avait encore suggéré que l’expression de cette lipide phosphatase était modulée par le VHC. JNK est une protéine appartenant à la famille de MAPkinases (Mitogen- activated protein kinases), elle est activée par les cytokines pro-inflammatoires mais également par l’insuline. Cette protéine exerce un rétrocontrôle négatif sur voie de l’insuline en phosphorylant IRS sur un résidu sérine proche du domaine PTB où normalement le récepteur à l’insuline phosphoryle une tyrosine. Nos résultats montrent que le VHC augmente l’expression de cette protéine JNK, ce qui est en accord avec différentes études qui observaient l’implication du VHC dans le développement de CHC. En effet, JNK ne joue pas uniquement un rôle de régulateur négatif de la voie de l’insuline mais également un rôle activateur d’AP-1, permettant la stimulation de la prolifération cellulaire. Différents travaux montraient que des protéines du VHC telle que la protéine core, NS3 (dans des cellules HepG2) et NS5A (dans des cellules de rein embryonnaire, les 293T) induisaient l’expression de JNK. (Erhardt et al., 2002 ; Hassan et al., 2005 ; Park et al., 2003). Ces résultats suggèrent que l’inhibition de JNK ou l’interférence dans l’association d’IRS-1 avec JNK pourrait être une bonne cible thérapeutique pour réduire la résistance à l’insuline induite ou non par le VHC. L’ensemble de ces résultats montre que le VHC cible et module l’expression et l’activité de plusieurs protéines cellulaires afin d’induire une résistance à l’insuline. D’un coté, le fait de diminuer l’expression du récepteur à l’insuline ainsi que celle de IRS-1 diminue la sensibilité à l’insuline puisque l’hormone se fixe moins et le signal est peu transmis. Et d’un autre coté l’augmentation de l’expression des protéines PTEN, SHIP2 et P-JNK régulant négativement la signalisation intracellulaire de l’insuline, contribue également à une diminution de la sensibilité à l’insuline. La réduction de la signalisation de l’insuline favorise la lipogenèse et donc probablement le processus d’assemblage du VHC. En effet, SREBP-1c, un régulateur majeur de la lipogenèse induite par l’insuline, est sur-régulée par l’infection du VHC. Cependant la synthèse lipidique n’est pas seulement régulée par la signalisation de l’insuline mais également par celle du glucose. Le glucose peut effectivement activer la synthèse de lipides via le facteur de transcription ChREBP. Cette protéine peut également être activée par l’insuline par l’intermédiaire de LXR. Similairement aux travaux de recherche effectués sur SREBP-1c, nous trouvons que l’expression de la
  21. 21. 21 protéine ChREBP est augmentée dans les cellules infectées. Ce résultat est en accord avec de précédentes études où la protéine core du VHC pouvait induire une accumulation de lipides dans les cellules Huh 7.5 (Abid et al., 2005 ; Jackel-Cram C et al., 2007 ; Waris et al., 2007). Nous avons donc identifié un nouveau facteur de transcription en plus de SREBP-1c, ChREBP, qui est induit par le VHC pour augmenter la synthèse de lipides et l’assemblage de VLDL. Des études complémentaires seront nécessaires pour savoir si la sur-régulation du niveau de protéine ChREBP due à l’augmentation de sa transcription est corrélée avec l’accentuation de la lipogenèse et avec l’assemblage des VLDL. La sur- ou sous- expression du récepteur à l’insuline, de IRS-1, PTEN, SHIP2, JNK ou ChREBP, pourra nous aider pour étudier le rôle exact de ces protéines dans le cycle viral et les pathologies associées. Même si les résultats précédents nous aident à comprendre le rôle de la résistance à l’insuline et des métabolismes lipidique et glucidique dans le cycle viral, il est important de rappeler qu’ils ont été obtenus dans un système in vitro assez artificiel. La souche virale JFH1 de génotype 2a dont la sequence diffère des isolats d’hépatite C chronique a été isolée à partir d’un patient ayant une hépatite fulminante (Kato et al., 2001). Ce genre d’hépatite virale sévère aigüe est caractérisé par une réplication virale importante et une intense réponse immunitaire de l’hôte contre les cellules ou les tissus infectés. Quelques cas d’hépatites fulminantes dus au VHC ont été rapportés après l’arrêt de chimiothérapie ou de drogues immunosuppressives. Dans ces cas, de hauts titres viraux étaient associés et il y avait l’apparition de sérieux problèmes hépatiques dues à une réplication viral illimitée, du fait des conditions d’immunosuppression (Vento et al., 1996). Ceci étant, ces hépatites restent assez atypiques et limitent notre système d’étude. De plus nous avons effectué la plupart de notre travail dans des cellules Huh 7.5. Cette lignée cellulaire hépatocytaire est transformée, entrainant surement des modifications dans son utilisation de glucose. Il semblerait également que le métabolisme lipidique de ces cellules soit assez altéré, entrainant un défaut dans l’assemblage des lipoprotéines (Icard et al., 2009). Donc le développement de lignées cellulaires permissives à la réplication du VHC ayant un métabolisme glucidique et lipidique physiologique est important. Dans cette optique, nous avons mis au point un génome du VHC sélectionnable. L’insertion des gènes de résistance dans le génome viral permettra à terme d’isoler une lignée cellulaire capable de supporter une infection par le VHC et permettra également de sélectionner des cellules infectées. Nous avons commencé à tester la fonctionnalité des génomes sélectionnables dans les lignées cellulaires Huh 7.5 et HepG2 CD81. Dès que nous aurons terminé la caractérisation basique de ces génomes, nous pourrons infecter des hépatocytes primaires humains et essayer d’isoler des clones hautement permissifs à la réplication du virus. Pour le moment,
  22. 22. 22 nous validons les résultats obtenus avec les cellules Huh 7.5 infectées par JFH1 pour ensuite envisager de réaliser des études cliniques. L’identification de l’altération des métabolismes glucidique et lipidique par le VHC ne nous éclaire pas seulement sur la nécessité de la lipogenèse pour la production virale mais nous aide également à mieux comprendre la pathogénèse associée à l’infection chronique et à établir de nouvelles approches thérapeutiques ou à revoir celles existantes (sensibilisateur à l’insuline ou médicaments diminuant le cholestérol) pour les traitements de l’infection chronique. Il existe différents traitement contre le diabète de type 2, comme les biguanides qui favorisent l’action de l’insuline au niveau du foie ou les Thiazolidinediones qui améliorent la sensibilité à l’insuline et réduisent la glycémie. Ces derniers activent le récepteur nucléaire PPARgamma (Peroxisome Proliferator-Activated Receptor gamma) afin d’altérer l’expression de gènes impliqués dans l’homéostasie lipidique et glucidique. L’utilisation de ces thérapies pour le traitement de l’infection chronique du VHC pourrait être considérée. De plus, notre étude pourra permettre d’identifier de nouvelles cibles thérapeutiques cellulaires ciblant les métabolismes glucidique et lipidiques aussi bien que l’infection chronique du VHC, telles que les lipides phosphatases (PTEN et SHIP2) et JNK. Remerciements Tout d’abord, je remercie le Dr Durantel de m’avoir fourni la construction du plasmide JFH1 muté contenant les sites de restriction, également Mr Jammard pour m’avoir assisté lors de manipulations mais aussi également pour ses conseils. Bien évidemment, je remercie ma responsable, le Dr Bartosch de m’avoir aussi bien encadré, tant dans la pratique que dans la rédaction. Et enfin je remercie le Dr Zoulim de m’avoir accueilli dans son équipe ainsi que toute l’unité Inserm U871 pour sa gentillesse et sa convivialité qui a rendu mon travail agréable.
  23. 23. 23 Références -Abid K, Pazienza V, de Gottardi A, Rubbia-Brandt L, Conne B, Pugnale P, Rossi C, Mangia A, Negro F. An in vitro model of hepatitis C virus genotype 3a-associated triglycerides accumulation. J Hepatol. 2005;42:744-51. - Alaei M, Negro F. Hepatitis C virus and glucose and lipid metabolism. Diabetes Metab. 2008;34:692-700. -André P, Komurian-Pradel F, Deforges S, Perret M, Berland JL, Sodoyer M, Pol S, Bréchot C, Paranhos-Baccalà G, Lotteau V. Characterization of low- and very-low-density hepatitis C virus RNA-containing particles. J Virol. 2002;76:6919-6928 - Araki E, Lipes MA, Patti ME, Brüning JC, Haag B 3rd, Johnson RS, Kahn CR. Alternative pathway of insulin signalling in mice with targeted disruption of the IRS-1 gene. Nature. 1994;372:186-190. - Aytug S, Reich D, Sapiro LE, Bernstein D, Begum N. Impaired IRS-1/PI3-kinase signaling in patients with HCV: a mechanism for increased prevalence of type 2 diabetes. Hepatology. 2003;38:1384-1392. - Blackard JT, Kemmer N, Sherman KE. Extrahepatic replication of HCV: insights into clinical manifestations and biological consequences. Hepatology. 2006;44:15-22 - Blight KJ, McKeating JA, Rice CM. Highly permissive cell lines for subgenomic and genomic hepatitis C virus RNA replication. J Virol. 2002;76:13001-130014. -Bugianesi E, McCullough AJ, Marchesini G. Insulin resistance: a metabolic pathway to chonic liver diseases. Hepatology. 2005;42:987-1000. - Burlone ME, Budkowska A. Hepatitis C virus cell entry: role of lipoproteins and cellular receptors. J Gen Virol. 2009; 90: 1055-1070. - Caldwell SH, Crespo DM, Kang HS, Al-Osaimi AM. Obesity and hepatocellular carcinoma. Gastroenterology. 2004;127:97-103. - Canbay A, Bechmann L, Gerken G Lipid metabolism in the liver. Z Gastroenterol 2007;45: 35-41 - Cantley LC. The phophoinositide 3-kinase pathway. Science. 2002;296:1655-1657. - Carvalho E, Jansson PA, Axelsen M, Eriksson JW, Huang X, Groop L, Rondinone C, Sjöström L, Smith U. Low cellular IRS 1 gene and protein expression predict insulin resistance and NIDDM. FASEB J. 1999;13:2173-2178 - Clément S, Krause U, Desmedt F, Tanti JF, Behrends J, Pesesse X, Sasaki T, Penninger J, Doherty M, Malaisse W, Dumont JE, Le Marchand-Brustel Y, Erneux C, Hue L, Schurmans S. The lipid phosphatase SHIP2 controls insulin sensitivity. Nature. 2001; 409: 92-97 - Delgrange D, Pillez A, Castelain S, Cocquerel L, Rouillé Y, Dubuisson J, Wakita T, Duverlie G, Wychowski C. Robust production of infections viral particles in Huh-7 cells by introducing mutations in hepatitis C virus structural proteins. J Gen Virol. 2007;88:2495-2503.
  24. 24. 24 - Dentin R, Girard J, Postic C. Carbohydrate responsive element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c): two key regulators of glucose metabolism and lipid synthesis in liver. Biochimie. 2005;87:81-86 - Donato F, Tagger A, Gelatti U, Parrinello G, Boffetta P, Albertini A, Decarli A, Trevisi P, Ribero ML, Martelli C, Porru S, Nardi G. Alcohol and hepatocellular carcinoma: the effect of lifetime intake and hepatitis virus infections in men and women. Am J Epidemiol. 2002;155: 323-331 - El-Serag HB Hepatocellular carcinoma: an epidemiologic view. J Clin Gastroenterol. 2002; 35:72-78 - Erhardt A, Hassan M, Heintges T, Häussinger D. Hepatitis C virus core protein induces cell proliferation and activates ERK, JNK, and p38 MAP kinases together with the MAP kinase phosphatase MKP-1 in a HepG2 Tet-Off cell line. Virology. 2002;292:272-284. -Gibbons GF, Brown AM, Wiggins D, Pease R. The roles of insulin and fatty acids in the regulation of hepatic very-low-density lipoprotein assembly. J R Soc Med.2002;95:23-32. - Hassan M, Ghozlan H, Abdel-Kader O. Activation of c-Jun NH2-terminal kinase (JNK) signaling pathway is essential for the stimulation of hepatitis C virus (HCV) non-structural protein 3 (NS3)-mediated cell growth. Virology. 2005;333:324-336. - Hoofnagle JH. Course and outcome of hepatitis C. Hepatology. 2002;36:21-29. - Huang H, Sun F, Owen DM, Li W, Chen Y, Gale M Jr, Ye J. Hepatitis C virus production by human hepatocytes dependent on assembly and secretion of very low-density lipoproteins. Proc Natl Acad Sci U S A.2007;104:5848-5853. - Icard V, Diaz O, Scholtes C, Perrin-Cocon L, Ramière C, Bartenschlager R, Penin F, Lotteau V, André P. Secretion of hepatitis C virus envelope glycoproteins depends on assembly of apoloprotein B positive lipoproteins. Plos. 2009;4:1-13. - Imazeki F, Yokosuka O, Fukai K, Saisho H. Favorable prognosis of chronic hepatitis C after interferon therapy by long-term cohort study. Hepatology. 2003;38:493-502. -Jackel-Cram C, Babiuk LA, Liu Q. Up-regulation of fatty acid synthase promoter by hepatitis C virus core protein: genotype-3a core has a stronger effect than genotype-1b core. J Hepatol. 2007;46:985-1007. - Kasai D, Adachi T, Deng L, Nagano-Fujii M, Sada K, Ikeda M, Kato N, Ide YH, Shoji I, Hotta H. HCV replication suppresses cellular glucose uptake through down-regulation of cell surface expression of glucose transporters. J Hepatol. 2009;50:883–894. - Kato T, Furusaka A, Miyamoto M, Date T, Yasui K, Hiramoto J, Nagayama K, Tanaka T, Wakita T. Sequence analysis of hepatitis C virus isolated from a fulminant hepatitis patient. J Med Virol. 2001;64:334-339. - Kato T, Date T, Miyamoto M, Furusaka A, Tokushige K, Mizokami M, Wakita T. Efficient replication of the genotype 2a hepatitis C virus subgenomic replicon. Gastroenterology. 2003; 125:1808-1817.
  25. 25. 25 - Kawaguchi T, Takenoshita M, Kabashima T, Uyeda K. Glucose and cAMP regulate the Ltype pyruvate kinase gene by phosphorylation/dephosphorylation of the carbohydrate response element binding protein. Proc Natl Acad Sci U S A. 2001;98:13710-13715. - Kawaguchi T, Yoshida T, Harada M, Hisamoto T, Nagao Y, Ide T, Taniguchi E, Kumemura H, Hanada S, Maeyama M, Baba S, Koga H, Kumashiro R, Ueno T, Ogata H, Yoshimura A, Sata M. Hepatitis C virus down-regulates insulin receptor subtrates 1 and 2 through up- regulation of supressor of cytokine signalling 3. Am J Pathol. 2004;165:1499-1508. - Lee YH, Giraud J, Davis RJ, White MF. c-Jun N-terminal kinase (JNK) mediates feedback inhibition of the insulin signaling cascade. J Biol Chem. 2003;278:2896-2902. -Lerat H, Honda M, Bears MR, Loesch K, Sun J, Yang Y, Okuda M, Gosert R, Xiao SY, Weinman SA, Lemon SM. Steatosis and liver cancer in transgenic mice expressing the structural and non structural proteins of hepatitis C virus. Gastroenterology. 2002;122:352- 365. - Liang TJ, Rehermann B, Seeff LB, Hoofnagle JH. Pathogenesis, natural history, treatment, and prevention of hepatitis C. Ann Intern Med. 2000;132:296-305. - Maillard P, Huby T, Andréo U, Moreau M, Chapman J, Budkowska A. The interaction of natural hepatitis C virus with human scavenger receptor SR-BI/Cla1 is mediated by ApoB- containing lipoproteins. FASEB J. 2006;20:735-757. - Mason AL, Lau JY, Hoang N, Qian K, Alexander GJ, Xu L, Guo L, Jacob S, Regenstein FG, Zimmerman R, Everhart JE, Wasserfall C, Maclaren NK, Perrillo RP. Association of diabetes mellitus ans chronic hepatitis C virus infection. Hepatology. 1999;29:328-333. - McGivern DR, Lemon SM. Tumor suppressors, chromosomal instability, and hepatitis C virus-associated liver cancer. Annu Rev Pathol. 2009;4:399-415. - Miyanari Y, Atsuzawa K, Usuda N, Watashi K, Hishiki T, Zayas M, Bartenschlager R, Wakita T, Hijikata M, Shimotohno K. The lipid droplet is an important organelle for hepatitis C virus production. Nat Cell Biol. 2007;9:1089-1097. - Moradpour D, Evans MJ, Gosert R, Yuan Z, Blum HE, Goff SP, Lindenbach BD, Rice CM. Insertion of green fluorescent protein into nonstructural protein 5A allows direct visualization of functional hepatitis C virus replication complexes. J Virol. 2004;78:7400-7409. -Oem JK, Jackel-Cram C, Li YP, Zhou Y, Zhong J, Shimano H, Babiuk LA, Liu Q. Activation of sterol regulatory element-binding protein 1c and fatty acid synthase transcription by hepatitis C virus non-structural protein 2. J Gen Virol. 2008;89:1225-1230. - Okabayashi Y, Maddux BA, McDonald AR, Logsdon CD, Williams JA, Goldfine ID. Mechanisms of insulin-induced insulin-receptor downregulation. Decrease of receptor biosynthesis ans mRNA levels. Diabetes. 1989;38:182-187.
  26. 26. 26 - Park KJ, Choi SH, Choi DH, Park JM, Yie SW, Lee SY, Hwang SB. Hepatitis C virus NS5A protein modulates c-Jun N-terminal kinase through interaction with tumor necrosis factor receptor-associated factor 2. J Biol Chem. 2003;278:30711-30718. - Pazienza V, Clément S, Pugnale P, Conzelman S, Foti M, Mangia A, Negro F. The hepatitis C virus core protein of genotypes 3a and 1b downregulates insulin receptor substrate 1 through genotype-specific mechanisms. Hepatology. 2007;45:1164-71. - Petit JM, Bour JB, Galland-Jos C, Minello A, Verges B, Guiguet M, Brun JM, Hillon P. Risk factors for diabetes mellitus and early insulin resistance in chronic hepatitis C. J Hepatol. 2001;35:279-283. - Pham TN, Michalak TI. Occult hepatits C virus persistence: identification and characteristics. MLO Med Lab Obs. 2006;38:20-22. -Pringle CR. Virus taxonomy. The universal system of virus taxonomy, updated to include the new proposals ratified by the International Committee on Toxonomy of viruses during 1998. Arch Virol 1999;144:421-429. - Radkowski M, Wilkinson J, Nowicki M, Adair D, Vargas H, Ingui C, Rakela J, Laskus T. Search for hepatitis C virus negative-strand RNA sequences and analysis of viral sequences in the central nervous system: evidence of replication. J Virol. 2002;76:600-608. - Renström F, Burén J, Svensson M, Eriksson JW. Insulin resistance induced by high glucose and high insulin precedes insulin receptor substrate 1 protein depletion in human adipocytes. Metabolism. 2007;56:190-198. -Rice CM. Flaviviridae : the viruses and their replication. In:Fields BN, Knipe DM, Howley PM et al. Fields Virology, 3rd en, vol 1, Philadelphia: Lippincott-Raven. 1996:931-959. - Rui L, Yuan M, Frantz D, Shoelson S, White MF. SOCS-1 and SOCS-3 block insulin signaling by ubiquitin-mediated degradation of IRS1 and IRS2. J Biol Chem. 2002;277:42394- 42398. -Steff LB. Natural history of chronic hepatitis C. Hepatology. 2002;36:35-46. - Sun CA, Wu DM, Lin CC, Lu SN, You SL, Wang LY, Wu MH, Chen CJ Incidence and cofactors of hepatitis C virus-related hepatocellular carcinoma: a prospective study of 12,008 men in Taiwan. Am J Epidemiol. 2003;157:674-82. -Taha C, Klip A. The insulin signaling pathway. J Membr Biol. 1999;169:1-12. - Vento S, Cainelli F, Mirandola F, Cosco L, Di Perri G, Solbiati M, Ferraro T, Concia E. Fulminant hepatitis on withdrawal of chemotherapy in carriers of hepatitis C virus. Lancet. 1996;347:92-93.
  27. 27. 27 - Wakita T, Pietschmann T, Kato T, Date T, Miyamoto M, Zhao Z, Murthy K, Habermann A, Kräusslich HG, Mizokami M, Bartenschlager R, Liang TJ. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat Med. 2005; 11: 791-796. - Waris G, Felmlee DJ, Negro F, Siddiqui A. Hepatitis C virus induces proteolytic cleavage of sterol regulatory element binding proteins and stimulates their phosphorylation via oxidative stress. J Virol. 2007;81:8122-8130. - Yamashita H, Takenoshita M, Sakurai M, Bruick RK, Henzel WJ, Shillinglaw W, Arnot D,Uyeda K. A glucose-responsive transcription factor that regulates carbohydrate metabolism in the liver.Proc Natl Acad Sci U S A 2001;98:9116-9121. - Zlande R, Mitchell JJ, Wu J, Sun XJ. Molecular mechanism of insulin-induced degradation of insulin receptor substrate 1. Molecular and cellulair biology. 2002;22:1016-1026.

×