SlideShare a Scribd company logo
1 of 49
Angel Carracedo
Fundación Gallega de
Medicina Genómica-SERGAS
Universidad de Santiago de Compostela
Centro Nacional de Genotipado-ISCIII
Genética del transtorno
obsesivo-compulsivo
Fundación
Ramón Areces,
Madrid, 2013
The Problem of Variability
“Variability is the law of life, and
as no two faces are the same,
so no two bodies are alike,
and no two individuals react alike,
and behave alike under the
abnormal conditions which we
know as disease.”
Sir William Osler
(1849-1919)
TAT ACT GCG TCG GAT GCT GCG ATT GCT GAC CAA CAT CGT GAC AGT TAG ACA
AAC GAT TGA CTG TTA GGA TTG ACCA CCA ATT ACG ATG ACG TTG GAC … 3,3 x
109
ATT ACT GAT CGG TAG CTG AGC CAA TGG CAG
TGA TGG ATG GTA GCT GAG TGC TGG….
Why is genetic variation important?
variation
no variation
north
south
north
south
Variation
No variation
EXTINCTION!!
Envirenomental
change SURVIVAL
Sedentary populations, migratory populations
showed a higher proportion of long alleles for
DRD4 (p .001).
Adaptive value of long alleles of in migratory
societies and the possibility of natural selection
for a migration gene??.
DRD4— has been linked in some studies to the
personality trait of novelty-seeking and to
hyperactivity
Population Migration and the Variation of
Dopamine D4 Receptor (DRD4) Allele
Frequencies Around the Globe, Chen et al.
Evolution and Human Behavior 20: 309–324
(1999)
2,320 individuals from 39
populations
Genes
Ambiente
Genes
Ambiente
Genes
Ambiente
Environmental
traits
Complex traits
Mendelian traits
But still the advance in knowledge in
genes involved in complex traits is
limited !
Why is it important to find
the genes involved in OCD?
Disease stratification
Molecular classification
Target for drugs
Risk prediction Many genes
Low ORs
Epidemiology
• Estimated Europe prevalence 1–2% of adult population
• 75% adults often report experiencing first symptoms in childhood
•Symptoms of OCD usually begin in individuals aged 10-24 years.
• Prevalence in populations- Unknown (probably similar)
•The overall prevalence of OCD is equal in males and females,
Increased number of infections (specially stretococcal infections in
childhood
PANDAS as a subset
OCD cases after herpes infections
Evidence that serotonergic
systems modulate OCD
symptomatology.
OR for first degree relatives: 4-5
Concordance in MZ twins 70-90%
Hededability higher in<15y
P. Sklar Annu. Rev. Genomics Hum. Genet. 2002. 3:371–413OCD Heredabilility = 0.40-0.60
% explained genetic variance
Using genetics to find genes that underlie complex traits is a potential
useful tool for a better understanding of the disease (therapeutic
targets), risk stratification, subclassification and pharmacogenetics and
pharmacogenomics
magnitudeofeffect
frequency of trait in the population
Linkage analysis of families
association studies in
populations
obtainable sample size
Linkage analysis or association studies ?
•linkage analysis is usually more robust in the identification of
mendelian traits
• association studies have more power to detect genes with small
effects (Risch & Merikangas, Science 1996)
Biological Psychiatry
Volume 72, Issue 8, 15 October 2012, Pages 629–636
Matthews et al.
Genome-Wide Linkage Analysis of Obsessive-Compulsive Disorder
Implicates Chromosome 1p36
33 Caucasian families with
≥2 childhood-onset OCD-
affected individuals from
the United States (n =
245)
The strongest result was
on chromosome
1p36.33-p36.32 (HLOD
= 3.77). At this location,
several of the families
showed haplotypes co-
segregating with OCD
Suicide Controls
Allele 1 Allele 2
SNP A is associated
with Phenotype
SNP A:
Allele 1 =
Allele 2 =
Human Genetic Association Study Design
Genotyping means patient classificationGenotyping means patient classification
SNP: SINGLE NUCLEOTIDE POLYMORPHISM
ATCGGCGTACCTGATTCCGAATCCGTATCG
ATCGGCGTACCTGAATCCGAATCCGTATCG
3.3 Gigabases Human Genome / >18 M SNP
1 SNP/<200 bp
1M SNPs
Coordination
NODE 1
Santiago de
Compostela (USC)
NODE 2
Madrid
(CNIO)
Scientific advisory board Board
Management unit
CENTRO NACIONAL DE GENOTIPADO –
CEGEN ISCIII
Association studies
Candidate gene approach
-Causative hypothesis or
candidate genes
Genome wide analysis (GWAs)
-No need of gene selection
-Lack of bias towards specific
genes
SCLA1
Glutamate
transporter
9p24
Mol Psychiatry. 2012 Jun 5. doi: 10.1038/mp.2012.76. [Epub ahead of print]
Molecular genetics of obsessive-compulsive disorder: a comprehensive
meta-analysis of genetic association studies. Taylor S.
A total of 230 polymorphisms from 113 genetic association studies were
identified. A full meta-analysis was conducted for 20 polymorphisms that were
examined in 5 or more data sets, and a secondary meta-analysis (limited to the
computation of mean effect sizes) was conducted for 210 polymorphisms that
were examined in fewer than 5 data sets. In the main meta-analysis, OCD was
associated with serotonin-related polymorphisms (5-HTTLPR and HTR2A)
and, in males only, with polymorphisms involved in catecholamine modulation
(COMT and MAOA). Non significant trends were identified for two dopamine-
related polymorphisms (DAT1 and DRD3) and a glutamate-related
polymorphism (rs3087879). The secondary meta-analysis identified another 18
polymorphisms with significant ORs that merit further investigation.
Illumina 1M
Affy 6.0
AXIOM
GWAS
P<5x10-8
Genome-wide association study
(GWAS) to identify low-penetrance
genes
• Require many cases and controls (but
not always)
• Can improve power by selecting cases
(early-onset, familial) and controls
(family-free)
• Search for alleles or genotypes over-
represented in cases
• Verify in other sample sets
Numero estimado de pacientes para el estudio de asociación conNumero estimado de pacientes para el estudio de asociación con
la enfermedadla enfermedad
NECESIDAD DE REDES-DEFINICIÓN DEL FENOTIPONECESIDAD DE REDES-DEFINICIÓN DEL FENOTIPO
NETWORKS
Molecular Psychiatry , 2013 Jul;18(7):788-98.
Genome-wide association study of obsessive-
compulsive disorder
S E Stewart et al.
The International OCD Foundation Genetics
Collaborative (IOCDF-GC)
1465 cases, 5557 ancestry-matched controls and 400
complete trios remained, with a common set of 469 
410 autosomal and 9657 X-chromosome single
nucleotide polymorphisms (SNPs)
Molecular Psychiatry advance online publication 14 August 2012.
doi:10.1038/mp.2012.85
The lowest two P-values were located within
DLGAP1 (P=2.49 × 10−6
and P=3.44 × 10−6
), a
member of the neuronal postsynaptic density
complex.
Genes within the imprinted
genomic region chr15q11-
13 have been reproducibly
associated with repetitive
behaviors, obsessive
compulsive behaviors, and
autism
(GWAS OCD consortium)
.
Davis et al. Partitioning the Heritability of Tourette Syndrome
and Obsessive Compulsive Disorder Reveals Differences in
Genetic Architecture- PLoS Genet Oct 2013
The use of the current classification schemas including DSM-IV undoubtedly
contributes to the difficulties in finding genes for psychiatric disorders. They are
based on clusters of symptoms and characteristics of clinical course that do not
necessarily describe homogenous disorders, and rather reflect common final
pathways of different pathophysiological processes
(Charney et al, 2002).
Sch 3%/75% GV
CCR 8%/35%
ADRs CCR
50%/80%
Common variants conferring risk of schizophrenia
Nature Stefansonn et al. Aug 2009 (SGENE Consortium)
19,000 cases and 35,000 controls from Iceland, Denmark (Aarhus), Denmark
(Copenhagen), Germany (Bonn), Germany (Munich), Hungary,
the Netherlands, Norway, Russia, Sweden, Finland;
Spain (Santiago) and Spain (Valencia)
1st
2,663 cases and 13,498 controls
2nd
top 1,500 in 4500 cases and 4500 controls
3rd
top 25 in 4,999 cases and 15,555 controls
4th
top 10 in 14,000 cases and 16,000 controls
Illumina 300 and 550 K
Strategies for looking missing variability in
Psychiatric Disorders
Grouping phenotypes: Phenotypes are badly defined
and overlap: Join many of them to increase numbers
Dissection of the phenotype: Endophenotypes
The use of the current classification schemas including DSM-IV undoubtedly
contributes to the difficulties in finding genes for psychiatric disorders. They are
based on clusters of symptoms and characteristics of clinical course that do not
necessarily describe homogenous disorders, and rather reflect common final
pathways of different pathophysiological processes
(Charney et al, 2002).
A polymorphism, located in an intron of ZNF804A, was reported to associate
with schizophrenia with a P-value of 1.61-7
, and with psychosis (schizophrenia
plus bipolar disorder) with a P-value of 1.01-8
. In this study, using 5164
schizophrenia cases and 20 709 controls, we replicated the association with
schizophrenia and, by adding bipolar disorder patients, we also confirmed the
association with psychosis
Expanding the range of ZNF804A variants conferring risk
of psychosis. Steinberg et al. Molecular Psychiatry (2010), 1–8
OCD + Depression
OCD +Tourette
OCD+ Anoexia
Common genetic background in anorexia nervosa and obs
Mas et al. J Psychiatr Res. 2013
Jun;47(6):747-54
CNVs:
Li et al.
A preliminary study of genotype-phenotype correlations
for rare copy number variants in children with Obsessive-Compulsive Disorder
Six CNV regions were found to be disrupting exons
in functionally relevant genes involved in neurobiological processes,
including NRXN1, SLC2A3, PRODH, CAPN14, ADRA2B2, NOTCH4 and PLXNA3.
A patient with a deletion in NRXN1, a gene previously implicated in autism
and schizophrenia, showed very early onset of severe OCD symptoms
at 4 years of age. Another patient with a deletion
in SLC2A3, a showed very low glutamatergic concentrations (and strong OCD)
Meeting ASHG 2011
Recurrent
protein-altering
mutations were
observed in two
genes:CHD8 and
NTNG1. M
OTHER GENETIC APPROACHES
Explore correlations in pathways
EXOME SEQUENCING
Exome sequencing 50 OCDs
700 genes target resequencing
Final replication
Danielle Cath- 800 muestras
Ampliar 68 exomas más
AXIOM EXOME ARRAYS
OTHER GENETIC APPROACHES
Explore ns SNPs i.e. Exome AXIOM arrays
rs12151009 7,85E-06
rs11685700 8,05E-06
rs114880897 1,80E-05
rs12327049 2,81E-05
rs114371521 2,84E-05
rs9523762 3,03E-05
rs116383774 3,22E-05
rs9903348 4,69E-05
rs198857 4,74E-05
rs7997883 9,33E-05
rs6601764 9,90E-05
376 casos, 446
controles y 37.015
marcadores (nsSNPs)
SLC6A15 (P = 2,81 x 10-5),
gen que codifica una proteína
implicada en el transporte
específico neuronal de
aminoácidos neutros que se
ha asociado previamente a
depresión mayor en un estudio
de genoma completo (Khohli
et al, Neuron 2011)
PLXNA4 (P = 3 x 10-5), gen
que codifica una proteína
implicada en la guía axonal,
cuya expresión se ha visto
disminuida en una muestra de
cerebro de pacientes con
diagnóstico de autismo (Suda
S et al, Mol Autism 2011).
Réplica Danielle Cath
800 muestras Univ. Utrecht
Trends Cogn Sci. 2012 Jan;16(1):81-91. Epub 2011 Dec 10.
Neurocognitive endophenotypes of impulsivity and compulsivity: towards
dimensional psychiatry.
Robbins TW, Gillan CM, Smith DG, de Wit S, Ersche KD.
CLEANING THE PHENOTYPE
Explore image-endophenotype
definitions
Various animal models have confirmed the importance of the 5-HT,
and dopamine systems in the neurobiology and treatment of OCD
DNA methylation is a major epigenetic
modification with direct implications in gene
expression patterns
DNA methylation occurs at the cytosine bases in
CG dinucleotides, which are often located in
enriched regions called CpG islands. When CpG
islands become methylated, the promoter
becomes stably silent
New challenges: Methylation
.
DEEP OMIC APPROACHES
DNA SEQUENCING AND METHYLATION
RNA SEQ (SMALL AND LONG)
METABOLITES
MICROBIOME
INTEGRATIVE BIOLOGY APPROACHES
EXPLORE
G x E
INTERACTIONS
Genomics
Micro RNA
Transcriptomics
Epigenomics
Expert Opin Drug Discov. 2013 Oct 23.
[Glutamate drugs and pharmacogenetics of
OCD: a pathway-based exploratory approach.
Expert opinion: In the genetically informed
network, known genes and identified key
connecting components, including DLG4 (a
developmental gene), PSD-95 (a synaptic
scaffolding protein) and PSEN1 (presenilin, a
regulator of secretase), conform a group of
potential pharmacological targets.
Pino Alonso – Hospital de Bellvitge
Xavier Estivill-CRG
Noa Carrera-JavierCostas

More Related Content

What's hot

Princeton Thesis on Neuroeconomics: Ambition and Reward
Princeton Thesis on Neuroeconomics: Ambition and Reward Princeton Thesis on Neuroeconomics: Ambition and Reward
Princeton Thesis on Neuroeconomics: Ambition and Reward Greg Schundler
 
A Comprehensive Comparison Research Paper
A Comprehensive Comparison Research PaperA Comprehensive Comparison Research Paper
A Comprehensive Comparison Research PaperJennifer Ocasio
 
KMorton Gender dimorphism and its effect on mortality in traumatically brain ...
KMorton Gender dimorphism and its effect on mortality in traumatically brain ...KMorton Gender dimorphism and its effect on mortality in traumatically brain ...
KMorton Gender dimorphism and its effect on mortality in traumatically brain ...Karissa Morton
 
Genomic analysis of diffuse intrinsic pontine gliomas identifies three molecu...
Genomic analysis of diffuse intrinsic pontine gliomas identifies three molecu...Genomic analysis of diffuse intrinsic pontine gliomas identifies three molecu...
Genomic analysis of diffuse intrinsic pontine gliomas identifies three molecu...Joshua Mangerel
 
Nature medicine 09 03 2014
Nature medicine 09 03 2014Nature medicine 09 03 2014
Nature medicine 09 03 2014Davide Borsani
 
N-of-1-pathways MixEnrich
N-of-1-pathways MixEnrichN-of-1-pathways MixEnrich
N-of-1-pathways MixEnrichQike (Max) Li
 
Smocking can cause macular degeneration
Smocking can cause macular degenerationSmocking can cause macular degeneration
Smocking can cause macular degenerationMohammad Manzoor
 
Austin Journal of Genetics and Genomic Research
Austin Journal of Genetics and Genomic ResearchAustin Journal of Genetics and Genomic Research
Austin Journal of Genetics and Genomic ResearchAustin Publishing Group
 
Anti‑nucleosome antibodies
Anti‑nucleosome antibodiesAnti‑nucleosome antibodies
Anti‑nucleosome antibodiesRebekEscutia
 
Model based prediction of human hair color using DNA variants
Model based prediction of human hair color using DNA variantsModel based prediction of human hair color using DNA variants
Model based prediction of human hair color using DNA variantsJosé Luis Moreno Garvayo
 
Searching for phenotypes of sepsis an application of machine learning to elec...
Searching for phenotypes of sepsis an application of machine learning to elec...Searching for phenotypes of sepsis an application of machine learning to elec...
Searching for phenotypes of sepsis an application of machine learning to elec...TÀI LIỆU NGÀNH MAY
 
Enhancing Rare Disease Literature for Researchers and Patients
Enhancing Rare Disease Literature for Researchers and PatientsEnhancing Rare Disease Literature for Researchers and Patients
Enhancing Rare Disease Literature for Researchers and PatientsErin D. Foster
 
Research Updates in SJIA & MAS - Grant Schulert
Research Updates in SJIA & MAS - Grant SchulertResearch Updates in SJIA & MAS - Grant Schulert
Research Updates in SJIA & MAS - Grant SchulertSystemic JIA Foundation
 
Expression of Isocitrate Dehydrogenase-1 (IDH-1) Mutant Protein in Gliomas_Cr...
Expression of Isocitrate Dehydrogenase-1 (IDH-1) Mutant Protein in Gliomas_Cr...Expression of Isocitrate Dehydrogenase-1 (IDH-1) Mutant Protein in Gliomas_Cr...
Expression of Isocitrate Dehydrogenase-1 (IDH-1) Mutant Protein in Gliomas_Cr...CrimsonPublishersTNN
 
Plasma phospholipids identify antecedent memory impairment in older adults
Plasma phospholipids identify antecedent memory impairment in older adultsPlasma phospholipids identify antecedent memory impairment in older adults
Plasma phospholipids identify antecedent memory impairment in older adultsJosé Luis Moreno Garvayo
 

What's hot (20)

Princeton Thesis on Neuroeconomics: Ambition and Reward
Princeton Thesis on Neuroeconomics: Ambition and Reward Princeton Thesis on Neuroeconomics: Ambition and Reward
Princeton Thesis on Neuroeconomics: Ambition and Reward
 
A Comprehensive Comparison Research Paper
A Comprehensive Comparison Research PaperA Comprehensive Comparison Research Paper
A Comprehensive Comparison Research Paper
 
KMorton Gender dimorphism and its effect on mortality in traumatically brain ...
KMorton Gender dimorphism and its effect on mortality in traumatically brain ...KMorton Gender dimorphism and its effect on mortality in traumatically brain ...
KMorton Gender dimorphism and its effect on mortality in traumatically brain ...
 
Genomic analysis of diffuse intrinsic pontine gliomas identifies three molecu...
Genomic analysis of diffuse intrinsic pontine gliomas identifies three molecu...Genomic analysis of diffuse intrinsic pontine gliomas identifies three molecu...
Genomic analysis of diffuse intrinsic pontine gliomas identifies three molecu...
 
Nature medicine 09 03 2014
Nature medicine 09 03 2014Nature medicine 09 03 2014
Nature medicine 09 03 2014
 
nihms 2015
nihms 2015 nihms 2015
nihms 2015
 
N-of-1-pathways MixEnrich
N-of-1-pathways MixEnrichN-of-1-pathways MixEnrich
N-of-1-pathways MixEnrich
 
0505-0513
0505-05130505-0513
0505-0513
 
Smocking can cause macular degeneration
Smocking can cause macular degenerationSmocking can cause macular degeneration
Smocking can cause macular degeneration
 
Polimorfismos
PolimorfismosPolimorfismos
Polimorfismos
 
seteven jhonson
seteven jhonsonseteven jhonson
seteven jhonson
 
Austin Journal of Genetics and Genomic Research
Austin Journal of Genetics and Genomic ResearchAustin Journal of Genetics and Genomic Research
Austin Journal of Genetics and Genomic Research
 
Anti‑nucleosome antibodies
Anti‑nucleosome antibodiesAnti‑nucleosome antibodies
Anti‑nucleosome antibodies
 
Model based prediction of human hair color using DNA variants
Model based prediction of human hair color using DNA variantsModel based prediction of human hair color using DNA variants
Model based prediction of human hair color using DNA variants
 
2710801
27108012710801
2710801
 
Searching for phenotypes of sepsis an application of machine learning to elec...
Searching for phenotypes of sepsis an application of machine learning to elec...Searching for phenotypes of sepsis an application of machine learning to elec...
Searching for phenotypes of sepsis an application of machine learning to elec...
 
Enhancing Rare Disease Literature for Researchers and Patients
Enhancing Rare Disease Literature for Researchers and PatientsEnhancing Rare Disease Literature for Researchers and Patients
Enhancing Rare Disease Literature for Researchers and Patients
 
Research Updates in SJIA & MAS - Grant Schulert
Research Updates in SJIA & MAS - Grant SchulertResearch Updates in SJIA & MAS - Grant Schulert
Research Updates in SJIA & MAS - Grant Schulert
 
Expression of Isocitrate Dehydrogenase-1 (IDH-1) Mutant Protein in Gliomas_Cr...
Expression of Isocitrate Dehydrogenase-1 (IDH-1) Mutant Protein in Gliomas_Cr...Expression of Isocitrate Dehydrogenase-1 (IDH-1) Mutant Protein in Gliomas_Cr...
Expression of Isocitrate Dehydrogenase-1 (IDH-1) Mutant Protein in Gliomas_Cr...
 
Plasma phospholipids identify antecedent memory impairment in older adults
Plasma phospholipids identify antecedent memory impairment in older adultsPlasma phospholipids identify antecedent memory impairment in older adults
Plasma phospholipids identify antecedent memory impairment in older adults
 

Viewers also liked

Elizabeth Wellington -Simposio Microbiología: Transmisión
Elizabeth Wellington -Simposio Microbiología: TransmisiónElizabeth Wellington -Simposio Microbiología: Transmisión
Elizabeth Wellington -Simposio Microbiología: TransmisiónFundación Ramón Areces
 
Innovación incipiente en economías emergentes: ¿puede traspasar Rusia sus bar...
Innovación incipiente en economías emergentes: ¿puede traspasar Rusia sus bar...Innovación incipiente en economías emergentes: ¿puede traspasar Rusia sus bar...
Innovación incipiente en economías emergentes: ¿puede traspasar Rusia sus bar...Fundación Ramón Areces
 
How did you use media technologies in the
How did you use media technologies in theHow did you use media technologies in the
How did you use media technologies in theAlbertmood1
 
Malot hector sin familia
Malot hector sin familiaMalot hector sin familia
Malot hector sin familiaRoberto Jaimes
 
Przewodnik po grantach i stypendiach dla młodych naukowców
Przewodnik po grantach i stypendiach dla młodych naukowcówPrzewodnik po grantach i stypendiach dla młodych naukowców
Przewodnik po grantach i stypendiach dla młodych naukowcówgranty-na-badania
 
IUGTE
IUGTEIUGTE
IUGTEIUGTE
 
Datación de sedimentos y evaluación de tasas de sedimentación mediante anális...
Datación de sedimentos y evaluación de tasas de sedimentación mediante anális...Datación de sedimentos y evaluación de tasas de sedimentación mediante anális...
Datación de sedimentos y evaluación de tasas de sedimentación mediante anális...alberto fernández garcía
 

Viewers also liked (12)

Elizabeth Wellington -Simposio Microbiología: Transmisión
Elizabeth Wellington -Simposio Microbiología: TransmisiónElizabeth Wellington -Simposio Microbiología: Transmisión
Elizabeth Wellington -Simposio Microbiología: Transmisión
 
Programul COP21
Programul COP21Programul COP21
Programul COP21
 
Témoignage 2015 LTS
Témoignage 2015 LTSTémoignage 2015 LTS
Témoignage 2015 LTS
 
Termodinámica
TermodinámicaTermodinámica
Termodinámica
 
Innovación incipiente en economías emergentes: ¿puede traspasar Rusia sus bar...
Innovación incipiente en economías emergentes: ¿puede traspasar Rusia sus bar...Innovación incipiente en economías emergentes: ¿puede traspasar Rusia sus bar...
Innovación incipiente en economías emergentes: ¿puede traspasar Rusia sus bar...
 
How did you use media technologies in the
How did you use media technologies in theHow did you use media technologies in the
How did you use media technologies in the
 
Past perfect tense
Past perfect tensePast perfect tense
Past perfect tense
 
Malot hector sin familia
Malot hector sin familiaMalot hector sin familia
Malot hector sin familia
 
Przewodnik po grantach i stypendiach dla młodych naukowców
Przewodnik po grantach i stypendiach dla młodych naukowcówPrzewodnik po grantach i stypendiach dla młodych naukowców
Przewodnik po grantach i stypendiach dla młodych naukowców
 
IUGTE
IUGTEIUGTE
IUGTE
 
Datación de sedimentos y evaluación de tasas de sedimentación mediante anális...
Datación de sedimentos y evaluación de tasas de sedimentación mediante anális...Datación de sedimentos y evaluación de tasas de sedimentación mediante anális...
Datación de sedimentos y evaluación de tasas de sedimentación mediante anális...
 
Past perfect tense
Past perfect tensePast perfect tense
Past perfect tense
 

Similar to Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'

Genome Wide Association Studies in Psychiatry
Genome Wide Association Studies in PsychiatryGenome Wide Association Studies in Psychiatry
Genome Wide Association Studies in PsychiatryDr.Guru S Gowda
 
Секвенирование как инструмент исследования сложных фенотипов человека: от ген...
Секвенирование как инструмент исследования сложных фенотипов человека: от ген...Секвенирование как инструмент исследования сложных фенотипов человека: от ген...
Секвенирование как инструмент исследования сложных фенотипов человека: от ген...BioinformaticsInstitute
 
Genetics of cognitive dysfunction in Schizophrenia
Genetics of cognitive dysfunction in SchizophreniaGenetics of cognitive dysfunction in Schizophrenia
Genetics of cognitive dysfunction in SchizophreniaStudy Buddy
 
Deletion 17q12 recurrent copy number variant ashadeep chandrareddy daniel d...
Deletion 17q12  recurrent copy number variant ashadeep  chandrareddy daniel d...Deletion 17q12  recurrent copy number variant ashadeep  chandrareddy daniel d...
Deletion 17q12 recurrent copy number variant ashadeep chandrareddy daniel d...surabhisupraja
 
Cell biology review paper
Cell biology review paperCell biology review paper
Cell biology review paperBrendan Kelemen
 
Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016Semel Admin
 
Screening Of Mdr1 [Autosaved]
Screening Of  Mdr1 [Autosaved]Screening Of  Mdr1 [Autosaved]
Screening Of Mdr1 [Autosaved]Pooja1923
 
Montgomery expression
Montgomery expressionMontgomery expression
Montgomery expressionmorenorossi
 
Genes in psychiatry (1)
Genes in psychiatry (1)Genes in psychiatry (1)
Genes in psychiatry (1)Dan Sfera
 
Mark Daly - Finding risk genes in psychiatric disorders
Mark Daly - Finding risk genes in psychiatric disordersMark Daly - Finding risk genes in psychiatric disorders
Mark Daly - Finding risk genes in psychiatric disorderswef
 
Genetic polymorphisms
Genetic polymorphisms Genetic polymorphisms
Genetic polymorphisms cindyzeta
 
Genetic polymorphisms pptx
Genetic polymorphisms pptxGenetic polymorphisms pptx
Genetic polymorphisms pptxcindyzeta
 
Genetics In Psychiatry
Genetics In PsychiatryGenetics In Psychiatry
Genetics In PsychiatryFrank Meissner
 
Genetic polymorphisms
Genetic polymorphisms Genetic polymorphisms
Genetic polymorphisms cindyzeta
 
From reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingFrom reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingJoaquin Dopazo
 

Similar to Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC' (20)

Genome Wide Association Studies in Psychiatry
Genome Wide Association Studies in PsychiatryGenome Wide Association Studies in Psychiatry
Genome Wide Association Studies in Psychiatry
 
Секвенирование как инструмент исследования сложных фенотипов человека: от ген...
Секвенирование как инструмент исследования сложных фенотипов человека: от ген...Секвенирование как инструмент исследования сложных фенотипов человека: от ген...
Секвенирование как инструмент исследования сложных фенотипов человека: от ген...
 
Genetics of cognitive dysfunction in Schizophrenia
Genetics of cognitive dysfunction in SchizophreniaGenetics of cognitive dysfunction in Schizophrenia
Genetics of cognitive dysfunction in Schizophrenia
 
Deletion 17q12 recurrent copy number variant ashadeep chandrareddy daniel d...
Deletion 17q12  recurrent copy number variant ashadeep  chandrareddy daniel d...Deletion 17q12  recurrent copy number variant ashadeep  chandrareddy daniel d...
Deletion 17q12 recurrent copy number variant ashadeep chandrareddy daniel d...
 
Cell biology review paper
Cell biology review paperCell biology review paper
Cell biology review paper
 
Genes in psychiatry
Genes in psychiatryGenes in psychiatry
Genes in psychiatry
 
Genetics in Psychiatry
Genetics in PsychiatryGenetics in Psychiatry
Genetics in Psychiatry
 
Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016
 
Screening Of Mdr1 [Autosaved]
Screening Of  Mdr1 [Autosaved]Screening Of  Mdr1 [Autosaved]
Screening Of Mdr1 [Autosaved]
 
Montgomery expression
Montgomery expressionMontgomery expression
Montgomery expression
 
Genes in psychiatry (1)
Genes in psychiatry (1)Genes in psychiatry (1)
Genes in psychiatry (1)
 
Genes In Psychiatry
Genes In PsychiatryGenes In Psychiatry
Genes In Psychiatry
 
Mark Daly - Finding risk genes in psychiatric disorders
Mark Daly - Finding risk genes in psychiatric disordersMark Daly - Finding risk genes in psychiatric disorders
Mark Daly - Finding risk genes in psychiatric disorders
 
Genetic polymorphisms
Genetic polymorphisms Genetic polymorphisms
Genetic polymorphisms
 
Genetic polymorphisms pptx
Genetic polymorphisms pptxGenetic polymorphisms pptx
Genetic polymorphisms pptx
 
Genetics In Psychiatry
Genetics In PsychiatryGenetics In Psychiatry
Genetics In Psychiatry
 
Genetic polymorphisms
Genetic polymorphisms Genetic polymorphisms
Genetic polymorphisms
 
Lecture6b sn ps
Lecture6b sn psLecture6b sn ps
Lecture6b sn ps
 
Gasparini_2014_02Thesis
Gasparini_2014_02ThesisGasparini_2014_02Thesis
Gasparini_2014_02Thesis
 
From reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingFrom reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene finding
 

More from Fundación Ramón Areces

Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...Fundación Ramón Areces
 
Dominique L. Monnet Director del programa ARHAI (Antimicrobial Resistance an...
Dominique L. Monnet  Director del programa ARHAI (Antimicrobial Resistance an...Dominique L. Monnet  Director del programa ARHAI (Antimicrobial Resistance an...
Dominique L. Monnet Director del programa ARHAI (Antimicrobial Resistance an...Fundación Ramón Areces
 
Antonio Cabrales -University College of London.
Antonio Cabrales -University College of London. Antonio Cabrales -University College of London.
Antonio Cabrales -University College of London. Fundación Ramón Areces
 
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...Fundación Ramón Areces
 
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...Fundación Ramón Areces
 
Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
Jonathan D. Ostry - Fondo Monetario Internacional (FMI). Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
Jonathan D. Ostry - Fondo Monetario Internacional (FMI). Fundación Ramón Areces
 
Juan Carlos López-Gutiérrez - Unidad de Anomalías Vasculares, Hospital Unive...
Juan Carlos López-Gutiérrez  - Unidad de Anomalías Vasculares, Hospital Unive...Juan Carlos López-Gutiérrez  - Unidad de Anomalías Vasculares, Hospital Unive...
Juan Carlos López-Gutiérrez - Unidad de Anomalías Vasculares, Hospital Unive...Fundación Ramón Areces
 
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM). I...
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM).  I...Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM).  I...
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM). I...Fundación Ramón Areces
 
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...Fundación Ramón Areces
 
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research. Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research. Fundación Ramón Areces
 
Diego Valero - Presidente del Grupo Novaster.
Diego Valero - Presidente del Grupo Novaster. Diego Valero - Presidente del Grupo Novaster.
Diego Valero - Presidente del Grupo Novaster. Fundación Ramón Areces
 
Nicholas Barr - Profesor de Economía Pública, London School of Economics.
Nicholas Barr - Profesor de Economía Pública, London School of Economics. Nicholas Barr - Profesor de Economía Pública, London School of Economics.
Nicholas Barr - Profesor de Economía Pública, London School of Economics. Fundación Ramón Areces
 
Juan Manuel Sarasua - Comunicador y periodista científico.
Juan Manuel Sarasua - Comunicador y periodista científico. Juan Manuel Sarasua - Comunicador y periodista científico.
Juan Manuel Sarasua - Comunicador y periodista científico. Fundación Ramón Areces
 
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...Fundación Ramón Areces
 
Frederic Lluis - Investigador principal en KU Leuven.
Frederic Lluis - Investigador principal en KU Leuven. Frederic Lluis - Investigador principal en KU Leuven.
Frederic Lluis - Investigador principal en KU Leuven. Fundación Ramón Areces
 

More from Fundación Ramón Areces (20)

Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
Jordi Torren - Coordinador del proyecto ESVAC. Agencia Europea de Medicamento...
 
Dominique L. Monnet Director del programa ARHAI (Antimicrobial Resistance an...
Dominique L. Monnet  Director del programa ARHAI (Antimicrobial Resistance an...Dominique L. Monnet  Director del programa ARHAI (Antimicrobial Resistance an...
Dominique L. Monnet Director del programa ARHAI (Antimicrobial Resistance an...
 
Antonio Cabrales -University College of London.
Antonio Cabrales -University College of London. Antonio Cabrales -University College of London.
Antonio Cabrales -University College of London.
 
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
Teresa Puig - Institut de Ciència de Materials de Barcelona, ICMAB-CSIC, Espa...
 
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
Elena Bascones - Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Es...
 
Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
Jonathan D. Ostry - Fondo Monetario Internacional (FMI). Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
Jonathan D. Ostry - Fondo Monetario Internacional (FMI).
 
Martín Uribe - Universidad de Columbia.
Martín Uribe - Universidad de Columbia.Martín Uribe - Universidad de Columbia.
Martín Uribe - Universidad de Columbia.
 
Thomas S. Robertson - The Wharton School.
Thomas S. Robertson - The Wharton School. Thomas S. Robertson - The Wharton School.
Thomas S. Robertson - The Wharton School.
 
Diana Robertson - The Wharton School.
Diana Robertson - The Wharton School. Diana Robertson - The Wharton School.
Diana Robertson - The Wharton School.
 
Juan Carlos López-Gutiérrez - Unidad de Anomalías Vasculares, Hospital Unive...
Juan Carlos López-Gutiérrez  - Unidad de Anomalías Vasculares, Hospital Unive...Juan Carlos López-Gutiérrez  - Unidad de Anomalías Vasculares, Hospital Unive...
Juan Carlos López-Gutiérrez - Unidad de Anomalías Vasculares, Hospital Unive...
 
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM). I...
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM).  I...Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM).  I...
Víctor Martínez-Glez. - Instituto de Genética Médica y Molecular (INGEMM). I...
 
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
Rudolf Happle - Dermatología, University of Freiburg Medical Center, Freiburg...
 
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research. Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
Rafael Doménech - Responsable de Análisis Macroeconómico, BBVA Research.
 
Diego Valero - Presidente del Grupo Novaster.
Diego Valero - Presidente del Grupo Novaster. Diego Valero - Presidente del Grupo Novaster.
Diego Valero - Presidente del Grupo Novaster.
 
Mercedes Ayuso - Universitat de Barcelona.
Mercedes Ayuso -  Universitat de Barcelona. Mercedes Ayuso -  Universitat de Barcelona.
Mercedes Ayuso - Universitat de Barcelona.
 
Nicholas Barr - Profesor de Economía Pública, London School of Economics.
Nicholas Barr - Profesor de Economía Pública, London School of Economics. Nicholas Barr - Profesor de Economía Pública, London School of Economics.
Nicholas Barr - Profesor de Economía Pública, London School of Economics.
 
Julia Campa - The Open University.
Julia Campa - The Open University. Julia Campa - The Open University.
Julia Campa - The Open University.
 
Juan Manuel Sarasua - Comunicador y periodista científico.
Juan Manuel Sarasua - Comunicador y periodista científico. Juan Manuel Sarasua - Comunicador y periodista científico.
Juan Manuel Sarasua - Comunicador y periodista científico.
 
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
Marta Olivares - Investigadora Postdoctoral en Université catholique de Louva...
 
Frederic Lluis - Investigador principal en KU Leuven.
Frederic Lluis - Investigador principal en KU Leuven. Frederic Lluis - Investigador principal en KU Leuven.
Frederic Lluis - Investigador principal en KU Leuven.
 

Recently uploaded

Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTSérgio Sacani
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPirithiRaju
 
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |aasikanpl
 
Botany krishna series 2nd semester Only Mcq type questions
Botany krishna series 2nd semester Only Mcq type questionsBotany krishna series 2nd semester Only Mcq type questions
Botany krishna series 2nd semester Only Mcq type questionsSumit Kumar yadav
 
G9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.pptG9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.pptMAESTRELLAMesa2
 
Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...Nistarini College, Purulia (W.B) India
 
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...anilsa9823
 
Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?Patrick Diehl
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxgindu3009
 
Botany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfBotany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfSumit Kumar yadav
 
Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx  .This slides helps to know the different types of biop...Biopesticide (2).pptx  .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...RohitNehra6
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...Sérgio Sacani
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Sérgio Sacani
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsAArockiyaNisha
 
Botany 4th semester file By Sumit Kumar yadav.pdf
Botany 4th semester file By Sumit Kumar yadav.pdfBotany 4th semester file By Sumit Kumar yadav.pdf
Botany 4th semester file By Sumit Kumar yadav.pdfSumit Kumar yadav
 
A relative description on Sonoporation.pdf
A relative description on Sonoporation.pdfA relative description on Sonoporation.pdf
A relative description on Sonoporation.pdfnehabiju2046
 
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...ssifa0344
 

Recently uploaded (20)

Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOST
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
 
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |
Call Us ≽ 9953322196 ≼ Call Girls In Mukherjee Nagar(Delhi) |
 
Engler and Prantl system of classification in plant taxonomy
Engler and Prantl system of classification in plant taxonomyEngler and Prantl system of classification in plant taxonomy
Engler and Prantl system of classification in plant taxonomy
 
Botany krishna series 2nd semester Only Mcq type questions
Botany krishna series 2nd semester Only Mcq type questionsBotany krishna series 2nd semester Only Mcq type questions
Botany krishna series 2nd semester Only Mcq type questions
 
G9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.pptG9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.ppt
 
Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...Bentham & Hooker's Classification. along with the merits and demerits of the ...
Bentham & Hooker's Classification. along with the merits and demerits of the ...
 
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
 
Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptx
 
Botany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfBotany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdf
 
Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx  .This slides helps to know the different types of biop...Biopesticide (2).pptx  .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based Nanomaterials
 
CELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdfCELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdf
 
Botany 4th semester file By Sumit Kumar yadav.pdf
Botany 4th semester file By Sumit Kumar yadav.pdfBotany 4th semester file By Sumit Kumar yadav.pdf
Botany 4th semester file By Sumit Kumar yadav.pdf
 
A relative description on Sonoporation.pdf
A relative description on Sonoporation.pdfA relative description on Sonoporation.pdf
A relative description on Sonoporation.pdf
 
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
 
The Philosophy of Science
The Philosophy of ScienceThe Philosophy of Science
The Philosophy of Science
 

Dr. Ángel Carracedo - Simposio Internacional 'La enfermedad de la duda: el TOC'

  • 1. Angel Carracedo Fundación Gallega de Medicina Genómica-SERGAS Universidad de Santiago de Compostela Centro Nacional de Genotipado-ISCIII Genética del transtorno obsesivo-compulsivo Fundación Ramón Areces, Madrid, 2013
  • 2. The Problem of Variability “Variability is the law of life, and as no two faces are the same, so no two bodies are alike, and no two individuals react alike, and behave alike under the abnormal conditions which we know as disease.” Sir William Osler (1849-1919)
  • 3. TAT ACT GCG TCG GAT GCT GCG ATT GCT GAC CAA CAT CGT GAC AGT TAG ACA AAC GAT TGA CTG TTA GGA TTG ACCA CCA ATT ACG ATG ACG TTG GAC … 3,3 x 109
  • 4. ATT ACT GAT CGG TAG CTG AGC CAA TGG CAG TGA TGG ATG GTA GCT GAG TGC TGG….
  • 5. Why is genetic variation important? variation no variation north south north south
  • 7. Sedentary populations, migratory populations showed a higher proportion of long alleles for DRD4 (p .001). Adaptive value of long alleles of in migratory societies and the possibility of natural selection for a migration gene??. DRD4— has been linked in some studies to the personality trait of novelty-seeking and to hyperactivity Population Migration and the Variation of Dopamine D4 Receptor (DRD4) Allele Frequencies Around the Globe, Chen et al. Evolution and Human Behavior 20: 309–324 (1999) 2,320 individuals from 39 populations
  • 8.
  • 10. But still the advance in knowledge in genes involved in complex traits is limited ! Why is it important to find the genes involved in OCD? Disease stratification Molecular classification Target for drugs Risk prediction Many genes Low ORs
  • 11. Epidemiology • Estimated Europe prevalence 1–2% of adult population • 75% adults often report experiencing first symptoms in childhood •Symptoms of OCD usually begin in individuals aged 10-24 years. • Prevalence in populations- Unknown (probably similar) •The overall prevalence of OCD is equal in males and females, Increased number of infections (specially stretococcal infections in childhood PANDAS as a subset OCD cases after herpes infections Evidence that serotonergic systems modulate OCD symptomatology.
  • 12. OR for first degree relatives: 4-5 Concordance in MZ twins 70-90% Hededability higher in<15y
  • 13. P. Sklar Annu. Rev. Genomics Hum. Genet. 2002. 3:371–413OCD Heredabilility = 0.40-0.60
  • 14. % explained genetic variance Using genetics to find genes that underlie complex traits is a potential useful tool for a better understanding of the disease (therapeutic targets), risk stratification, subclassification and pharmacogenetics and pharmacogenomics
  • 15. magnitudeofeffect frequency of trait in the population Linkage analysis of families association studies in populations obtainable sample size Linkage analysis or association studies ? •linkage analysis is usually more robust in the identification of mendelian traits • association studies have more power to detect genes with small effects (Risch & Merikangas, Science 1996)
  • 16. Biological Psychiatry Volume 72, Issue 8, 15 October 2012, Pages 629–636 Matthews et al. Genome-Wide Linkage Analysis of Obsessive-Compulsive Disorder Implicates Chromosome 1p36 33 Caucasian families with ≥2 childhood-onset OCD- affected individuals from the United States (n = 245) The strongest result was on chromosome 1p36.33-p36.32 (HLOD = 3.77). At this location, several of the families showed haplotypes co- segregating with OCD
  • 17. Suicide Controls Allele 1 Allele 2 SNP A is associated with Phenotype SNP A: Allele 1 = Allele 2 = Human Genetic Association Study Design
  • 18. Genotyping means patient classificationGenotyping means patient classification
  • 19. SNP: SINGLE NUCLEOTIDE POLYMORPHISM ATCGGCGTACCTGATTCCGAATCCGTATCG ATCGGCGTACCTGAATCCGAATCCGTATCG 3.3 Gigabases Human Genome / >18 M SNP 1 SNP/<200 bp 1M SNPs
  • 20. Coordination NODE 1 Santiago de Compostela (USC) NODE 2 Madrid (CNIO) Scientific advisory board Board Management unit CENTRO NACIONAL DE GENOTIPADO – CEGEN ISCIII
  • 21. Association studies Candidate gene approach -Causative hypothesis or candidate genes Genome wide analysis (GWAs) -No need of gene selection -Lack of bias towards specific genes
  • 22.
  • 23. SCLA1 Glutamate transporter 9p24 Mol Psychiatry. 2012 Jun 5. doi: 10.1038/mp.2012.76. [Epub ahead of print] Molecular genetics of obsessive-compulsive disorder: a comprehensive meta-analysis of genetic association studies. Taylor S. A total of 230 polymorphisms from 113 genetic association studies were identified. A full meta-analysis was conducted for 20 polymorphisms that were examined in 5 or more data sets, and a secondary meta-analysis (limited to the computation of mean effect sizes) was conducted for 210 polymorphisms that were examined in fewer than 5 data sets. In the main meta-analysis, OCD was associated with serotonin-related polymorphisms (5-HTTLPR and HTR2A) and, in males only, with polymorphisms involved in catecholamine modulation (COMT and MAOA). Non significant trends were identified for two dopamine- related polymorphisms (DAT1 and DRD3) and a glutamate-related polymorphism (rs3087879). The secondary meta-analysis identified another 18 polymorphisms with significant ORs that merit further investigation.
  • 25.
  • 26. Genome-wide association study (GWAS) to identify low-penetrance genes • Require many cases and controls (but not always) • Can improve power by selecting cases (early-onset, familial) and controls (family-free) • Search for alleles or genotypes over- represented in cases • Verify in other sample sets
  • 27. Numero estimado de pacientes para el estudio de asociación conNumero estimado de pacientes para el estudio de asociación con la enfermedadla enfermedad NECESIDAD DE REDES-DEFINICIÓN DEL FENOTIPONECESIDAD DE REDES-DEFINICIÓN DEL FENOTIPO
  • 29. Molecular Psychiatry , 2013 Jul;18(7):788-98. Genome-wide association study of obsessive- compulsive disorder S E Stewart et al. The International OCD Foundation Genetics Collaborative (IOCDF-GC) 1465 cases, 5557 ancestry-matched controls and 400 complete trios remained, with a common set of 469  410 autosomal and 9657 X-chromosome single nucleotide polymorphisms (SNPs)
  • 30. Molecular Psychiatry advance online publication 14 August 2012. doi:10.1038/mp.2012.85 The lowest two P-values were located within DLGAP1 (P=2.49 × 10−6 and P=3.44 × 10−6 ), a member of the neuronal postsynaptic density complex.
  • 31. Genes within the imprinted genomic region chr15q11- 13 have been reproducibly associated with repetitive behaviors, obsessive compulsive behaviors, and autism (GWAS OCD consortium) . Davis et al. Partitioning the Heritability of Tourette Syndrome and Obsessive Compulsive Disorder Reveals Differences in Genetic Architecture- PLoS Genet Oct 2013
  • 32. The use of the current classification schemas including DSM-IV undoubtedly contributes to the difficulties in finding genes for psychiatric disorders. They are based on clusters of symptoms and characteristics of clinical course that do not necessarily describe homogenous disorders, and rather reflect common final pathways of different pathophysiological processes (Charney et al, 2002). Sch 3%/75% GV CCR 8%/35% ADRs CCR 50%/80%
  • 33. Common variants conferring risk of schizophrenia Nature Stefansonn et al. Aug 2009 (SGENE Consortium) 19,000 cases and 35,000 controls from Iceland, Denmark (Aarhus), Denmark (Copenhagen), Germany (Bonn), Germany (Munich), Hungary, the Netherlands, Norway, Russia, Sweden, Finland; Spain (Santiago) and Spain (Valencia) 1st 2,663 cases and 13,498 controls 2nd top 1,500 in 4500 cases and 4500 controls 3rd top 25 in 4,999 cases and 15,555 controls 4th top 10 in 14,000 cases and 16,000 controls Illumina 300 and 550 K
  • 34. Strategies for looking missing variability in Psychiatric Disorders Grouping phenotypes: Phenotypes are badly defined and overlap: Join many of them to increase numbers Dissection of the phenotype: Endophenotypes The use of the current classification schemas including DSM-IV undoubtedly contributes to the difficulties in finding genes for psychiatric disorders. They are based on clusters of symptoms and characteristics of clinical course that do not necessarily describe homogenous disorders, and rather reflect common final pathways of different pathophysiological processes (Charney et al, 2002).
  • 35. A polymorphism, located in an intron of ZNF804A, was reported to associate with schizophrenia with a P-value of 1.61-7 , and with psychosis (schizophrenia plus bipolar disorder) with a P-value of 1.01-8 . In this study, using 5164 schizophrenia cases and 20 709 controls, we replicated the association with schizophrenia and, by adding bipolar disorder patients, we also confirmed the association with psychosis Expanding the range of ZNF804A variants conferring risk of psychosis. Steinberg et al. Molecular Psychiatry (2010), 1–8 OCD + Depression OCD +Tourette OCD+ Anoexia Common genetic background in anorexia nervosa and obs Mas et al. J Psychiatr Res. 2013 Jun;47(6):747-54
  • 36. CNVs: Li et al. A preliminary study of genotype-phenotype correlations for rare copy number variants in children with Obsessive-Compulsive Disorder Six CNV regions were found to be disrupting exons in functionally relevant genes involved in neurobiological processes, including NRXN1, SLC2A3, PRODH, CAPN14, ADRA2B2, NOTCH4 and PLXNA3. A patient with a deletion in NRXN1, a gene previously implicated in autism and schizophrenia, showed very early onset of severe OCD symptoms at 4 years of age. Another patient with a deletion in SLC2A3, a showed very low glutamatergic concentrations (and strong OCD) Meeting ASHG 2011
  • 37.
  • 38. Recurrent protein-altering mutations were observed in two genes:CHD8 and NTNG1. M OTHER GENETIC APPROACHES Explore correlations in pathways
  • 39. EXOME SEQUENCING Exome sequencing 50 OCDs 700 genes target resequencing Final replication Danielle Cath- 800 muestras Ampliar 68 exomas más
  • 41. OTHER GENETIC APPROACHES Explore ns SNPs i.e. Exome AXIOM arrays
  • 42. rs12151009 7,85E-06 rs11685700 8,05E-06 rs114880897 1,80E-05 rs12327049 2,81E-05 rs114371521 2,84E-05 rs9523762 3,03E-05 rs116383774 3,22E-05 rs9903348 4,69E-05 rs198857 4,74E-05 rs7997883 9,33E-05 rs6601764 9,90E-05 376 casos, 446 controles y 37.015 marcadores (nsSNPs) SLC6A15 (P = 2,81 x 10-5), gen que codifica una proteína implicada en el transporte específico neuronal de aminoácidos neutros que se ha asociado previamente a depresión mayor en un estudio de genoma completo (Khohli et al, Neuron 2011) PLXNA4 (P = 3 x 10-5), gen que codifica una proteína implicada en la guía axonal, cuya expresión se ha visto disminuida en una muestra de cerebro de pacientes con diagnóstico de autismo (Suda S et al, Mol Autism 2011). Réplica Danielle Cath 800 muestras Univ. Utrecht
  • 43. Trends Cogn Sci. 2012 Jan;16(1):81-91. Epub 2011 Dec 10. Neurocognitive endophenotypes of impulsivity and compulsivity: towards dimensional psychiatry. Robbins TW, Gillan CM, Smith DG, de Wit S, Ersche KD.
  • 44. CLEANING THE PHENOTYPE Explore image-endophenotype definitions
  • 45. Various animal models have confirmed the importance of the 5-HT, and dopamine systems in the neurobiology and treatment of OCD
  • 46. DNA methylation is a major epigenetic modification with direct implications in gene expression patterns DNA methylation occurs at the cytosine bases in CG dinucleotides, which are often located in enriched regions called CpG islands. When CpG islands become methylated, the promoter becomes stably silent New challenges: Methylation .
  • 47. DEEP OMIC APPROACHES DNA SEQUENCING AND METHYLATION RNA SEQ (SMALL AND LONG) METABOLITES MICROBIOME INTEGRATIVE BIOLOGY APPROACHES EXPLORE G x E INTERACTIONS Genomics Micro RNA Transcriptomics Epigenomics
  • 48. Expert Opin Drug Discov. 2013 Oct 23. [Glutamate drugs and pharmacogenetics of OCD: a pathway-based exploratory approach. Expert opinion: In the genetically informed network, known genes and identified key connecting components, including DLG4 (a developmental gene), PSD-95 (a synaptic scaffolding protein) and PSEN1 (presenilin, a regulator of secretase), conform a group of potential pharmacological targets.
  • 49. Pino Alonso – Hospital de Bellvitge Xavier Estivill-CRG Noa Carrera-JavierCostas

Editor's Notes

  1. NOTES FOR PRESENTERS: According to some studies, OCD is the fourth most common mental disorder after depression, alcohol and substance misuse, and social phobia. It has a lifetime prevalence in community surveys of about 2–3%. However, the instruments used have been criticised and may have over-diagnosed OCD, so the true prevalence may be somewhat lower. There is remarkable consistency in the lifetime and annual prevalence of OCD from studies conducted across the world. The mean age of onset is in late adolescence for men and early twenties for women, although onset may occur in a wide range of ages. However, it may take individuals between 10–15 years or longer to seek professional help. There is often comorbidity with a range of disorders, especially depression, anxiety, alcohol or substance misuse, BDD, or an eating disorder.