East Coast fever—Outlook for a new vaccine
•
3 likes•1,982 views
Presented by Vish Nene at the Workshop on the Distribution, Delivery and Improvement of the Infection and Treatment Method Vaccine for East Coast Fever, Nairobi, 19-20 August 2014
Recommended
More Related Content
What's hot
What's hot (20)
Similar to East Coast fever—Outlook for a new vaccine
Similar to East Coast fever—Outlook for a new vaccine (20)
More from ILRI
More from ILRI (20)
Recently uploaded
Recently uploaded (20)
East Coast fever—Outlook for a new vaccine
- 1. East Coast fever – outlook for a new vaccine Vish Nene Workshop on the distribution, delivery and improvement of the Infection and Treatment Method vaccine for East Coast fever Nairobi, 19-20 August 2014
- 2. A live vaccine via ITM for the control of ECF A live infection and treatment based method of vaccination Caused by Theileria parva – a tick transmitted pathogen Vaccination method developed by KARI and ILRI in mid-1970’s The Muguga cocktail a commercial enterprise at CTTBD
- 3. Entry points for subunit vaccine intervention Infected R. appendiculatus ticks schizont-infected cells sporozoites piroplasms merogony Antigenic diversity - a hallmark of T. parva sporozoite neutralizing Abs sporozoite bovine cell schizont-specific CD8 killer T-cells (CTLs) CTL P CTL P
- 4. Technical advances in DNA/RNA/protein sequencing, glycomics, molecular & cellular biology, immunology, bioinformatics, nano-tech, computational biology, structural biology, microbiomes, etc. New paradigms in science are accelerating vaccine development research 1.Identification of candidate vaccine antigens 2.Immunogenicity studies with antigens 3.Laboratory challenge studies 4.Contained field trials
- 5. p67N p67M p67C 21 225 226 571 572 651 9 709 Average sporozoite bovine cell Parasite neutralizing Abs Antibodies to p67 mediate immunity to ECF
- 6. A novel human antibody discovery platform
- 7. T-cell antigen discovery pipeline at ILRI - I ACTGGTACGTAGGGCATCGATCGACATGATAGAGCATATAGCATGACGATGCGATCGACAGTCGACAGCTGACAGCTGAGGGTGACACCAGCTGCCAGCTGGACCACCATTAGGACAGATGACCACACACAAATAGACGATTAGGACCAGATGAGCCACATTTTAGGAGGACACACACCA Bioinformatics tools Predict ~ 5000 gene sequences & list candidate vaccine antigens Clone genes of vaccine interest Filter genes via IFN-g ELISPOT and lytic assays T. parva genome sequence A Random cDNA library B Candidate CTL antigens Map CTL epitopes
- 8. T-cell antigen discovery pipeline at ILRI - II By Anne Mølgaard High information positions HLA-A0201 Pep de in MHC groove Pep des exhibit a mo f Various algorithms available for predic on of pep de epitopes [Peptide] Control BoLA-N*04101/ no peptide BoLA-N*04101/Tp227-37 BoLA-N*04101/Tp229-37 CD8+ (PerCP) Flow cytometry assay
- 9. Mapped parasite CTL antigens/epitopes CTL epitope Peptide sequence MHC class I gene BoLA sero-type Tp1214-224 VGYPKVKEEML N*01301 A18 (HD6) Tp227-37 SHEELKKLGML T2b~ Tp249-59 KSSHGMGKVGK N*01201 A10 (T2a) Tp296-104 FAQSLVCVL T2c~ Tp298-106 QSLVCVLMK N*01201 A10 (T2a) Tp4328-336 TGASIQTTL N*00101 A10 (5.1) Tp587-95 SKADVIAKY T5~ Tp7206-214 EFISFPISL T7~ Tp8379-387 CGAELNHFL N*00101 A10 (5.1)
- 10. East Coast fever vaccine trials in cattle One candidate B-cell vaccine antigen ~50% cattle immune to challenge in lab trials How can this be improved? Twelve candidate T-cell vaccine antigens ~30% cattle immune to challenge in lab trials How can this be improved?
- 11. An East Coast fever R & D consortium Inception workshop: 27-29th Jan 2014
- 12. Antibodies Killer T-cells (CTLs) Map new pathogen antigens Map host response to infection & vaccination Comparative pathogen genomics Fill knowledge gaps for vaccine development & proof-of-concept (POC) Compare different vaccination systems
- 13. Improve live vaccine – sporozoite counts 1.Enumerate live sporozoites 2.Relate sporozoite counts to infectivity 3.Relate sporozoite counts to immunogenicity Guava easyCyte™ 5 high power laser (Merck-Millipore)
- 14. Vaccines? Novel acaricides? Anti-tick? A role for vector control?
- 15. ECF Consortium -POC – in four years 1.Best bet sporozoite antigens 2.Best bet schizont antigens 3.Best bet delivery systems 4.Combination of sporozoite and schizont antigens Phase 1: 70~80% immunity to defined parasite challenge/defined cattle Phase 2: broad-spectrum immunity
- 16. The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is given to ILRI. better lives through livestock ilri.org