SlideShare une entreprise Scribd logo
1  sur  57
Télécharger pour lire hors ligne
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Lord, help us in our
work today. Give us
concentration so that
may we listen,
understand, learn and
have a peaceful mind
and may we always
remember that Jesus
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Loading
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
th GRADING PERIOD
4

Digestive System
Genetics

Evolution and Biodiversity
Ecosystem
The Digestive System
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
GENETICS
Quit
Hello There! Would
you like to learn
about Evolution and
Biodiversity?

Overview

STAR
T
Overview on Evolution
 Evolution as Theory and Fact
 Discoveries
 Mechanisms

 Evidences
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
WHAT IS LIFE?
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
CHARLES

JESUS CHRIST
CHARLES DARWIN
The Tree of Life
 All living things share a
common ancestor.
 We can draw a Tree of Life
to
show how every species is
related.
 Evolution is the process by
which one species gives
rise to another and the Tree
of Life grows.
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Evolution as Theory and Fact

• Confusion sometimes arises as to
whether Evolution is a theory or a fa
Actually it is both!

• The theory of Evolution deals with h
Evolution happens. Our understand
of this process is always changing.

• Evolution is also a fact as there is a
huge amount of indisputable eviden
for its occurrence.
Talk Outline
Part 1: How was evolution
discovered?
Discussion: Should Creationism
and Evolution be
given “equal time” in science
lessons?
Part 2: How does evolution work?
Practical: Natural Selection in the
Peppered Moth
Part 3: What is the evidence for
evolution?
Discovery (1) Fixed species
Michelangelo’s Fresco on the ceiling
of the Sistine Chapel

From Classical times until long after the Renaissance, species
were considered to be special creations, fixed for all time.
Discovery (2): Transmutation
• Around 1800, scientists began to
wonder whether species could
change or transmute.
• Lamarck thought that if an animal
acquired a characteristic during its
lifetime, it could pass it onto its
offspring.

Jean Baptiste de Lamarck

• Hence giraffes got their long necks
through generations of straining to
reach high branches.
Discovery (3): Fossils and Strata
http://en.wikipedia.org/wiki/
ImageWilliam_Smith.g.jpg

http://en.wikipedia.org/wiki/Image:
Geological_map_of_Great_Britain.jpg

http://en.wikipedia.org/wiki/Image:Smith_fossils2.jpg

William Smith, his geology map & some of his fossil specimens

At about the same time, geologists like William Smith were
mapping the rocks and fossils of Britain. He and others showed
that different species existed in the past compared with today.
Discovery (4): Darwin’s Voyage
• From 1831-1836, a
young naturalist called
Charles Darwin toured
the world in HMS
Beagle.

Voyage of the Beagle
en.wikipedia.org/wiki/Image:Charles_Darwin_by_G._Richmond.jpg
en.wikipedia.org/wiki/Image:HMS_Beagle_by_Conrad_Martens.jpg

• He was dazzled by the
amazing diversity of
life and started to
wonder how it might
have originated
Discovery (5): Survival of the Fittest
• In his Origin of Species,
published in 1859, Darwin
proposed how one species
might give rise to another.

Natural Selection
explains adaption

• Where food was limited,
competition meant that only
the fittest would survive.
• This would lead to the natural selection
of the best adapted individuals and
eventually the evolution of a new species.
en.wikipedia.org/wiki/Image:Darwin%27s_finches.jpeg

Darwin in 1860
Discovery (6): Huxley v. Wilberforce
• Darwin’s idea of
Evolution by Natural
Selection was met with
huge controversy.

Bishop Wilberforce v. T. H. Huxley

• A famous debate in
1860 pitted Bishop
Wilberforce against
Darwin’s bulldog,
Thomas Henry Huxley.

• Evolutionists got the better of the debate, but few were convinced
by Darwin’s idea of Natural Selection.
www.bbc.co.uk/religion/galleries/spiritualhistory/images/9.jpg
Discovery (7): Genetics
Mendel and his peas

• From 1856-63, a monk called Gregor
Mendel cultivated 29,000 pea plants
to investigate how evolution worked
i.e., how characteristics were passed
down the generations.
• He figured out the basic principles of
genetics. He showed that offspring
received characteristics from both
parents, but only the dominant
characteristic trait was expressed.
Mendel’s work only came to light in
1900, long after his death

en.wikipedia.org/wiki/Image:Mendel.png
en.wikipedia.org/wiki/Image:Doperwt_rijserwt_peulen_Pisum_sativum.jpg
Discovery (8): Making Sense
• In the early 20th century, scientist started to
make sense of how evolution worked.
• Building on Mendel’s genetics, studies
showed how characteristics in a population
could be selected by environmental
pressures.

Julian Huxley
and the
Modern Synthesis

• This Modern Synthesis, as Julian Huxley
called it, brought Darwin’s Natural Selection
back to the centre of evolutionary theory.

en.wikipedia.org/wiki/Image:Hux-Oxon-72.jpg
Discovery (9): Opposition
• Despite the achieval of
scientific consensus on
evolution, some Christian
groups continued to
oppose the concept.

Outside the Scopes Trial

• In 1925, the teaching of
evolution was outlawed
in Tennessee, USA,
resulting in the infamous
Scopes Monkey Trial

www.templeton-cambridge.org/fellows/vedantam/publications/2006.02.05/eden_and_evolution/
Discussion: Should Creationism and Evolution
be given equal time in science lessons?

science.kukuchew.com/wp-content/uploads/
2008/01/stop_following_me_creationist.jpg
Mechanism (1): All in the Genes
• The genetic make-up of
an organism is known as
its genotype.
• An organism’s genotype
and the environment in
which it lives determines
its total characteristic traits
i.e. its phenotype.
Genotype

Phenotype

commons.wikimedia.org/wiki/Image:DNA_double_helix_vertikal.PNG
Mechanism (2): DNA
• The double-helix
structure of DNA
was discovered
in 1953.

Watson and Crick and
their model of DNA

DNA
replication

www.chem.ucsb.edu/~kalju/chem110L/public/tutorial/images/WatsonCrick.jpg
en.wikipedia.org/wiki/DNA

• This showed how
genetic information
is transferred from
one cell to another
almost without error.
Mechanism (3): Mutation
Types of mutation

• However, occasional
mutations or copying errors
can and do occur when
DNA is replicated.

• Mutations may be caused
by radiation, viruses, or
carcinogens.

Mutant fruitfly

• Mutations are rare and often have
damaging effects. Consequently organisms
have special enzymes whose job it is to
repair faulty DNA.
upload.wikimedia.org/wikipedia/commons/7/79/Types-of-mutation.png

humansystemstherapeutics.com/bb.htm
Mechanism (4): Variation
• Nevertheless, some
mutations will persist and
increase genetic variation
within a population.
• Variants of a particular
gene are known as alleles.
For example, the one of
the genes for hair colour
comprises brown/blonde
alleles.
majorityrights.com/index.php/weblog/comments/racial_variation_in_so
me_parts_of_the_skull_involved_in_chewing/
Mechanism (5): Natural Selection
Selection of dark gene

• Mutant alleles spread through a
population by sexual reproduction.
• If an allele exerts a harmful effect,
it will reduce the ability of the
individual to reproduce and the
allele will probably be removed
from the population.
• In contrast, mutants with favorable
effects are preferentially passed on

en.wikipedia.org/wiki/Image:Mutation_and_selection_diagram.svg
Mechanism (6): Peppered Moth

Haldane and the peppered moth • The Peppered Moth is an
example of Natural Selection
in action discovered by Haldane




http://en.wikipedia.org/wiki/Image:Biston.betularia.7200.jpg
en.wikipedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpg
en.wikipedia.org/wiki/J._B._S._Haldane

• During the Industrial Revolution
the trees on which the moth
rested became soot-covered.
• This selected against the allele for pale
colour in the population (which were
poorly camouflaged from predators)
and selected for the dark colour allele.
Mechanism (7): Microevolution
• The dog is another example of how
selection can change the frequency
of alleles in a population.

• Dogs have been artificially selected
for certain characteristics for many
years, and different breeds have
different alleles.

Dogs are
wolves

• All breeds of dog belong to the same
species, Canis lupus (the wolf) so this
is an example of Microevolution as no
new species has resulted.

www.puppy-training-solutions.com/image-files/dog-breed-information.jpg
Mechanism (8): Macroevolution
• However, if two populations of a
species become isolated from
one another for tens of thousands
of years, genetic difference may
become marked.
• If the two populations can no-longer
interbreed, new species are born.
This is called Macroevolution.

Galapagos finches

• Darwin’s Galapagos finches are
an example of this process in action.
www.ingala.gov.ec/galapagosislands/images/stories/ingala_images/galapagos_take_a_tour/small_pics/galapagos_map_2.jpg
Mechanism (9): Speciation Today?
• The mosquito was introduced to
the London Underground during
its construction around 1900.

London Underground Mosquito

en.wikipedia.org/wiki/Image:Gb-lu-Angel-southbound.jpg
en.wikipedia.org/wiki/Culex

• It became infamous in the War
for attacking people sheltering
from the Blitz.
• Studies indicate several genetic
differences from its above-ground
ancestors. Interbreeding between
populations is difficult suggesting
that speciation may be occurring.
Evidence (1): Biochemistry
• The basic similarity of all living things suggests
that they evolved from a single common ancestor.
• As we have already seen, all living things pass
on information from generation to generation
using the DNA molecule.
• All living things also use a molecule
called ATP to carry
energy around the
DNA for
Information organism.
Transfer
en.wikipedia.org/wiki/Image:ATP-xtal-3D-sticks.png

ATP for
Energy
Transfer
Evidence (2): Similar Genes
HUMAN
CHIMPANZEE
GORILLA

CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

Genetic code of chimps and gorillas is almost identical to humans
• If evolution is true then we might also expect that closely
related organisms will be more similar to one another than more
distantly related organisms.
• Comparison of the human genetic code with that of other
organisms show that chimpanzees are nearly genetically identical
(differ by less than 1.2%) whereas the mouse differs by ≈15%.
Evidence (3): Comparative Anatomy
• Similar comparisons can be made
based on anatomical evidence.
• The skeleton of humans and
gorillas are very similar suggesting
they shared a recent common
ancestor, but very different from the
more distantly related
woodlouse…

Human and
Gorilla

yet all have a common
shared characteristic:
bilateral symmetry
Woodlouse

en.wikipedia.org/wiki/Image:Primatenskelett-drawing.jpg
Evidence (4): Homology
The pentadactyl limb
is ancestral to all
vertebrates…

but modified for different uses

en.wikipedia.org/wiki/Image:Evolution_pl.png
Evidence (5): Vestigial Structures
• As evolution progresses, some
structures get side-lined as they
are not longer of use. These
are known as vestigial structures.
• The coccyx is a much reduced
version of an ancestral tail, which
was formerly adapted to aid
balance and climbing.
The coccyx is a vestigial tail • Another vestigial structure in
humans is the appendix.
en.wikipedia.org/wiki/Image:Illu_vertebral_column.jpg
Evidence (6): Fossil Record
http://en.wikipedia.org/wiki/Geologic_time_scale

© World Health Org.

en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png

© NASA

origins
bacteria complex cells dinosaurs
humans
The fossil record shows a sequence from simple bacteria to
more complicated organisms through time and provides the most
compelling evidence for evolution.
Evidence (7): Transitional fossils
• Many fossils show a clear
transition from one species,
or group, to another.
• Archaeopteryx was found
in Germany in 1861. It
share many characteristics
with both dinosaurs and
birds.
Archaeopteryx
en.wikipedia.org/wiki/Image:Archaeopteryx_lithographica_paris.JPG

• It provides good evidence
that birds arose from
dinosaur ancestors
Evidence (8): Geography
• Geographic spread of
Marsupials organisms also tells of
their past evolution.
• Marsupials occur in
two populations today
in the Americas and
Australia.

• This shows the group
evolved before the
continents drifted apart
evolution.berkeley.edu/evosite/lines/IVCexperiments.shtml
en.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg
Evidence (9): Antibiotic resistance
Staphylococcus

• We are all familiar with
the way that certain
bacteria can become
resistant to antibiotics

• This is an example of natural selection in
action. The antibiotic acts as an
environmental pressure. It weeds out
those bacteria with low resistance and
only those with high resistance survive
to reproduce.
http://en.wikipedia.org/wiki/Image:Antibiotic_resistance.svg
en.wikipedia.org/wiki/Image:Staphylococcus_aureus%2C_50%2C000x%2C_USDA%2C_ARS%2C_EMU.jpg
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem
Evolution and Biodiversity,Genetics,Digestive System,Ecosystem

Contenu connexe

Tendances

5.4 evolution
5.4 evolution5.4 evolution
5.4 evolutioncartlidge
 
Chapter 6 : The Process of Evolution
Chapter 6 : The Process of EvolutionChapter 6 : The Process of Evolution
Chapter 6 : The Process of EvolutionSimple ABbieC
 
The Diversity of Life on Earth
The Diversity of Life on EarthThe Diversity of Life on Earth
The Diversity of Life on EarthAmy Hollingsworth
 
3. Selection & Speciation
3. Selection & Speciation3. Selection & Speciation
3. Selection & Speciationrossbiology
 
CLASSIFICATION OF ORGANISMS
CLASSIFICATION OF ORGANISMS CLASSIFICATION OF ORGANISMS
CLASSIFICATION OF ORGANISMS SANDEEP PATRE
 
Ch17 evolution of life
Ch17 evolution of lifeCh17 evolution of life
Ch17 evolution of lifecoolscienceguy
 
Neo darwinism - post02
Neo darwinism - post02Neo darwinism - post02
Neo darwinism - post02LaibaMasood2
 
Pre IB Biology: Evolution
Pre IB Biology: EvolutionPre IB Biology: Evolution
Pre IB Biology: EvolutionBob Smullen
 
Review organic evolution
Review organic evolutionReview organic evolution
Review organic evolutionguest5032a7
 
Isolating mechanism and speciation in time 1
Isolating mechanism and speciation in time 1Isolating mechanism and speciation in time 1
Isolating mechanism and speciation in time 1bhavnesthakur
 
IB Biology Option D.2: Species and speciation
IB Biology Option D.2: Species and speciationIB Biology Option D.2: Species and speciation
IB Biology Option D.2: Species and speciationJason de Nys
 
Speciation powerpoint
Speciation powerpointSpeciation powerpoint
Speciation powerpointtowanda7979
 
Speciation and-evolution-
Speciation and-evolution-Speciation and-evolution-
Speciation and-evolution-Naeem Ahmed
 

Tendances (19)

5.4 evolution
5.4 evolution5.4 evolution
5.4 evolution
 
Chapter 6 : The Process of Evolution
Chapter 6 : The Process of EvolutionChapter 6 : The Process of Evolution
Chapter 6 : The Process of Evolution
 
B2.8 speciation
B2.8 speciationB2.8 speciation
B2.8 speciation
 
The Diversity of Life on Earth
The Diversity of Life on EarthThe Diversity of Life on Earth
The Diversity of Life on Earth
 
Evolution
EvolutionEvolution
Evolution
 
3. Selection & Speciation
3. Selection & Speciation3. Selection & Speciation
3. Selection & Speciation
 
CLASSIFICATION OF ORGANISMS
CLASSIFICATION OF ORGANISMS CLASSIFICATION OF ORGANISMS
CLASSIFICATION OF ORGANISMS
 
Evolution
EvolutionEvolution
Evolution
 
BIODIVERSITY:EVOLUTION
BIODIVERSITY:EVOLUTIONBIODIVERSITY:EVOLUTION
BIODIVERSITY:EVOLUTION
 
Ch17 evolution of life
Ch17 evolution of lifeCh17 evolution of life
Ch17 evolution of life
 
Neo darwinism - post02
Neo darwinism - post02Neo darwinism - post02
Neo darwinism - post02
 
Pre IB Biology: Evolution
Pre IB Biology: EvolutionPre IB Biology: Evolution
Pre IB Biology: Evolution
 
Review organic evolution
Review organic evolutionReview organic evolution
Review organic evolution
 
5.1 & 5.2 Notes
5.1 & 5.2 Notes5.1 & 5.2 Notes
5.1 & 5.2 Notes
 
Isolating mechanism and speciation in time 1
Isolating mechanism and speciation in time 1Isolating mechanism and speciation in time 1
Isolating mechanism and speciation in time 1
 
IB Biology Option D.2: Species and speciation
IB Biology Option D.2: Species and speciationIB Biology Option D.2: Species and speciation
IB Biology Option D.2: Species and speciation
 
Speciation powerpoint
Speciation powerpointSpeciation powerpoint
Speciation powerpoint
 
Evolution
EvolutionEvolution
Evolution
 
Speciation and-evolution-
Speciation and-evolution-Speciation and-evolution-
Speciation and-evolution-
 

En vedette

Edu290 part 1 evolution and biodiversity
Edu290 part 1 evolution and biodiversityEdu290 part 1 evolution and biodiversity
Edu290 part 1 evolution and biodiversitycone2bk
 
The evolution of life science ecosystems: Five effective innovation approache...
The evolution of life science ecosystems: Five effective innovation approache...The evolution of life science ecosystems: Five effective innovation approache...
The evolution of life science ecosystems: Five effective innovation approache...IBM in Healthcare
 
Evolution in ecosystems
Evolution in ecosystemsEvolution in ecosystems
Evolution in ecosystemswja10255
 
Ecological succession
Ecological successionEcological succession
Ecological successionBharat Lodha
 
Ecological succession
Ecological successionEcological succession
Ecological successionNanda Palit
 
Biodiversity and Evolution
Biodiversity and EvolutionBiodiversity and Evolution
Biodiversity and EvolutionARCHIE PAGAURA
 
Ecosystem
EcosystemEcosystem
EcosystemKumar
 
Theory of Evolution
Theory of EvolutionTheory of Evolution
Theory of Evolutionimlovestruck
 
Ecosystems PowerPoint Presentation
Ecosystems PowerPoint PresentationEcosystems PowerPoint Presentation
Ecosystems PowerPoint Presentationmaldjuan
 
Evolution Power Point
Evolution Power PointEvolution Power Point
Evolution Power Pointlisashrider
 
Design in Tech Report 2017
Design in Tech Report 2017Design in Tech Report 2017
Design in Tech Report 2017John Maeda
 

En vedette (15)

Edu290 part 1 evolution and biodiversity
Edu290 part 1 evolution and biodiversityEdu290 part 1 evolution and biodiversity
Edu290 part 1 evolution and biodiversity
 
The evolution of life science ecosystems: Five effective innovation approache...
The evolution of life science ecosystems: Five effective innovation approache...The evolution of life science ecosystems: Five effective innovation approache...
The evolution of life science ecosystems: Five effective innovation approache...
 
Evolution in ecosystems
Evolution in ecosystemsEvolution in ecosystems
Evolution in ecosystems
 
Ecological succession
Ecological successionEcological succession
Ecological succession
 
Biodiversity and evolution
Biodiversity and evolutionBiodiversity and evolution
Biodiversity and evolution
 
Ecological succession
Ecological successionEcological succession
Ecological succession
 
Biodiversity and Evolution
Biodiversity and EvolutionBiodiversity and Evolution
Biodiversity and Evolution
 
Ecosystem
EcosystemEcosystem
Ecosystem
 
Theory of Evolution
Theory of EvolutionTheory of Evolution
Theory of Evolution
 
Ecosystems PowerPoint Presentation
Ecosystems PowerPoint PresentationEcosystems PowerPoint Presentation
Ecosystems PowerPoint Presentation
 
SEM,TEM & AFM
SEM,TEM & AFMSEM,TEM & AFM
SEM,TEM & AFM
 
Ecology and ecosystem
Ecology and ecosystemEcology and ecosystem
Ecology and ecosystem
 
Evolution Power Point
Evolution Power PointEvolution Power Point
Evolution Power Point
 
Evolution powerpoint
Evolution powerpointEvolution powerpoint
Evolution powerpoint
 
Design in Tech Report 2017
Design in Tech Report 2017Design in Tech Report 2017
Design in Tech Report 2017
 

Similaire à Evolution and Biodiversity,Genetics,Digestive System,Ecosystem

History of evolutionery thought
History of evolutionery thoughtHistory of evolutionery thought
History of evolutionery thoughtHafiz M Waseem
 
Ch 15 Darwin's Theory of Evolution
Ch 15 Darwin's Theory of EvolutionCh 15 Darwin's Theory of Evolution
Ch 15 Darwin's Theory of Evolutionlightrf
 
Evolution notes #1
Evolution notes #1Evolution notes #1
Evolution notes #1wja10255
 
evolution-161023055712.pptx GENERAL BIOLOGY
evolution-161023055712.pptx GENERAL BIOLOGYevolution-161023055712.pptx GENERAL BIOLOGY
evolution-161023055712.pptx GENERAL BIOLOGYIneleElliaAgRe
 
Evolution by Dr. Azharuddin Daphedar
Evolution by Dr. Azharuddin DaphedarEvolution by Dr. Azharuddin Daphedar
Evolution by Dr. Azharuddin DaphedarDrAzharuddinDaphedar
 
Chapter15 evolution(darwin)
Chapter15 evolution(darwin)Chapter15 evolution(darwin)
Chapter15 evolution(darwin)katiecam21
 
Darwinism (Feb 2009)
Darwinism (Feb 2009)Darwinism (Feb 2009)
Darwinism (Feb 2009)Oon Chye Yeo
 
Cambridge Pre-U Biology - 2.3 Evolution of Life
Cambridge Pre-U Biology - 2.3 Evolution of LifeCambridge Pre-U Biology - 2.3 Evolution of Life
Cambridge Pre-U Biology - 2.3 Evolution of Lifemrexham
 
Charles Darwin On The Origin Of Species
Charles Darwin On The Origin Of SpeciesCharles Darwin On The Origin Of Species
Charles Darwin On The Origin Of SpeciesKatherine Alexander
 
Understanding Evolution - Life goes on
Understanding Evolution - Life goes onUnderstanding Evolution - Life goes on
Understanding Evolution - Life goes onHarshal Hayatnagarkar
 
Evolution natural selection_and_speciation
Evolution natural selection_and_speciationEvolution natural selection_and_speciation
Evolution natural selection_and_speciationiowahawki
 
I EvolutionIf I have seen further it is by standing on th
I EvolutionIf I have seen further it is by standing on thI EvolutionIf I have seen further it is by standing on th
I EvolutionIf I have seen further it is by standing on thNarcisaBrandenburg70
 
Evolution presentation I & II.
Evolution presentation I & II.Evolution presentation I & II.
Evolution presentation I & II.Lorraine Stratton
 
The-TIES-Middle-School-Evolution-Presentation-1-1.pptx
The-TIES-Middle-School-Evolution-Presentation-1-1.pptxThe-TIES-Middle-School-Evolution-Presentation-1-1.pptx
The-TIES-Middle-School-Evolution-Presentation-1-1.pptxTonyStark449263
 
Presentation-WPS Office.pptx
Presentation-WPS Office.pptxPresentation-WPS Office.pptx
Presentation-WPS Office.pptxabenezer47
 

Similaire à Evolution and Biodiversity,Genetics,Digestive System,Ecosystem (20)

Evolution
EvolutionEvolution
Evolution
 
History of evolutionery thought
History of evolutionery thoughtHistory of evolutionery thought
History of evolutionery thought
 
Chapter 15 Evolution - All Sections 15.1 - 15.3
Chapter 15 Evolution - All Sections 15.1 - 15.3Chapter 15 Evolution - All Sections 15.1 - 15.3
Chapter 15 Evolution - All Sections 15.1 - 15.3
 
Ch 15 Darwin's Theory of Evolution
Ch 15 Darwin's Theory of EvolutionCh 15 Darwin's Theory of Evolution
Ch 15 Darwin's Theory of Evolution
 
Evolution notes #1
Evolution notes #1Evolution notes #1
Evolution notes #1
 
evolution-161023055712.pptx GENERAL BIOLOGY
evolution-161023055712.pptx GENERAL BIOLOGYevolution-161023055712.pptx GENERAL BIOLOGY
evolution-161023055712.pptx GENERAL BIOLOGY
 
Evolution by Dr. Azharuddin Daphedar
Evolution by Dr. Azharuddin DaphedarEvolution by Dr. Azharuddin Daphedar
Evolution by Dr. Azharuddin Daphedar
 
Chapter15 evolution(darwin)
Chapter15 evolution(darwin)Chapter15 evolution(darwin)
Chapter15 evolution(darwin)
 
Evolution
EvolutionEvolution
Evolution
 
Darwinism (Feb 2009)
Darwinism (Feb 2009)Darwinism (Feb 2009)
Darwinism (Feb 2009)
 
Cambridge Pre-U Biology - 2.3 Evolution of Life
Cambridge Pre-U Biology - 2.3 Evolution of LifeCambridge Pre-U Biology - 2.3 Evolution of Life
Cambridge Pre-U Biology - 2.3 Evolution of Life
 
Charles Darwin On The Origin Of Species
Charles Darwin On The Origin Of SpeciesCharles Darwin On The Origin Of Species
Charles Darwin On The Origin Of Species
 
Understanding Evolution - Life goes on
Understanding Evolution - Life goes onUnderstanding Evolution - Life goes on
Understanding Evolution - Life goes on
 
AP Evolution Notes
AP Evolution NotesAP Evolution Notes
AP Evolution Notes
 
Evolution natural selection_and_speciation
Evolution natural selection_and_speciationEvolution natural selection_and_speciation
Evolution natural selection_and_speciation
 
HISTORY OF EVOLUTION
HISTORY OF EVOLUTION HISTORY OF EVOLUTION
HISTORY OF EVOLUTION
 
I EvolutionIf I have seen further it is by standing on th
I EvolutionIf I have seen further it is by standing on thI EvolutionIf I have seen further it is by standing on th
I EvolutionIf I have seen further it is by standing on th
 
Evolution presentation I & II.
Evolution presentation I & II.Evolution presentation I & II.
Evolution presentation I & II.
 
The-TIES-Middle-School-Evolution-Presentation-1-1.pptx
The-TIES-Middle-School-Evolution-Presentation-1-1.pptxThe-TIES-Middle-School-Evolution-Presentation-1-1.pptx
The-TIES-Middle-School-Evolution-Presentation-1-1.pptx
 
Presentation-WPS Office.pptx
Presentation-WPS Office.pptxPresentation-WPS Office.pptx
Presentation-WPS Office.pptx
 

Dernier

Maximizing Impact_ Nonprofit Website Planning, Budgeting, and Design.pdf
Maximizing Impact_ Nonprofit Website Planning, Budgeting, and Design.pdfMaximizing Impact_ Nonprofit Website Planning, Budgeting, and Design.pdf
Maximizing Impact_ Nonprofit Website Planning, Budgeting, and Design.pdfTechSoup
 
CAULIFLOWER BREEDING 1 Parmar pptx
CAULIFLOWER BREEDING 1 Parmar pptxCAULIFLOWER BREEDING 1 Parmar pptx
CAULIFLOWER BREEDING 1 Parmar pptxSaurabhParmar42
 
Human-AI Co-Creation of Worked Examples for Programming Classes
Human-AI Co-Creation of Worked Examples for Programming ClassesHuman-AI Co-Creation of Worked Examples for Programming Classes
Human-AI Co-Creation of Worked Examples for Programming ClassesMohammad Hassany
 
Diploma in Nursing Admission Test Question Solution 2023.pdf
Diploma in Nursing Admission Test Question Solution 2023.pdfDiploma in Nursing Admission Test Question Solution 2023.pdf
Diploma in Nursing Admission Test Question Solution 2023.pdfMohonDas
 
5 charts on South Africa as a source country for international student recrui...
5 charts on South Africa as a source country for international student recrui...5 charts on South Africa as a source country for international student recrui...
5 charts on South Africa as a source country for international student recrui...CaraSkikne1
 
The Singapore Teaching Practice document
The Singapore Teaching Practice documentThe Singapore Teaching Practice document
The Singapore Teaching Practice documentXsasf Sfdfasd
 
How to Add Existing Field in One2Many Tree View in Odoo 17
How to Add Existing Field in One2Many Tree View in Odoo 17How to Add Existing Field in One2Many Tree View in Odoo 17
How to Add Existing Field in One2Many Tree View in Odoo 17Celine George
 
HED Office Sohayok Exam Question Solution 2023.pdf
HED Office Sohayok Exam Question Solution 2023.pdfHED Office Sohayok Exam Question Solution 2023.pdf
HED Office Sohayok Exam Question Solution 2023.pdfMohonDas
 
PISA-VET launch_El Iza Mohamedou_19 March 2024.pptx
PISA-VET launch_El Iza Mohamedou_19 March 2024.pptxPISA-VET launch_El Iza Mohamedou_19 March 2024.pptx
PISA-VET launch_El Iza Mohamedou_19 March 2024.pptxEduSkills OECD
 
Drug Information Services- DIC and Sources.
Drug Information Services- DIC and Sources.Drug Information Services- DIC and Sources.
Drug Information Services- DIC and Sources.raviapr7
 
How to Use api.constrains ( ) in Odoo 17
How to Use api.constrains ( ) in Odoo 17How to Use api.constrains ( ) in Odoo 17
How to Use api.constrains ( ) in Odoo 17Celine George
 
General views of Histopathology and step
General views of Histopathology and stepGeneral views of Histopathology and step
General views of Histopathology and stepobaje godwin sunday
 
How to Make a Field read-only in Odoo 17
How to Make a Field read-only in Odoo 17How to Make a Field read-only in Odoo 17
How to Make a Field read-only in Odoo 17Celine George
 
CHUYÊN ĐỀ DẠY THÊM TIẾNG ANH LỚP 11 - GLOBAL SUCCESS - NĂM HỌC 2023-2024 - HK...
CHUYÊN ĐỀ DẠY THÊM TIẾNG ANH LỚP 11 - GLOBAL SUCCESS - NĂM HỌC 2023-2024 - HK...CHUYÊN ĐỀ DẠY THÊM TIẾNG ANH LỚP 11 - GLOBAL SUCCESS - NĂM HỌC 2023-2024 - HK...
CHUYÊN ĐỀ DẠY THÊM TIẾNG ANH LỚP 11 - GLOBAL SUCCESS - NĂM HỌC 2023-2024 - HK...Nguyen Thanh Tu Collection
 
Clinical Pharmacy Introduction to Clinical Pharmacy, Concept of clinical pptx
Clinical Pharmacy  Introduction to Clinical Pharmacy, Concept of clinical pptxClinical Pharmacy  Introduction to Clinical Pharmacy, Concept of clinical pptx
Clinical Pharmacy Introduction to Clinical Pharmacy, Concept of clinical pptxraviapr7
 
Practical Research 1 Lesson 9 Scope and delimitation.pptx
Practical Research 1 Lesson 9 Scope and delimitation.pptxPractical Research 1 Lesson 9 Scope and delimitation.pptx
Practical Research 1 Lesson 9 Scope and delimitation.pptxKatherine Villaluna
 
How to Solve Singleton Error in the Odoo 17
How to Solve Singleton Error in the  Odoo 17How to Solve Singleton Error in the  Odoo 17
How to Solve Singleton Error in the Odoo 17Celine George
 
Patterns of Written Texts Across Disciplines.pptx
Patterns of Written Texts Across Disciplines.pptxPatterns of Written Texts Across Disciplines.pptx
Patterns of Written Texts Across Disciplines.pptxMYDA ANGELICA SUAN
 
How to Manage Cross-Selling in Odoo 17 Sales
How to Manage Cross-Selling in Odoo 17 SalesHow to Manage Cross-Selling in Odoo 17 Sales
How to Manage Cross-Selling in Odoo 17 SalesCeline George
 

Dernier (20)

Maximizing Impact_ Nonprofit Website Planning, Budgeting, and Design.pdf
Maximizing Impact_ Nonprofit Website Planning, Budgeting, and Design.pdfMaximizing Impact_ Nonprofit Website Planning, Budgeting, and Design.pdf
Maximizing Impact_ Nonprofit Website Planning, Budgeting, and Design.pdf
 
CAULIFLOWER BREEDING 1 Parmar pptx
CAULIFLOWER BREEDING 1 Parmar pptxCAULIFLOWER BREEDING 1 Parmar pptx
CAULIFLOWER BREEDING 1 Parmar pptx
 
Human-AI Co-Creation of Worked Examples for Programming Classes
Human-AI Co-Creation of Worked Examples for Programming ClassesHuman-AI Co-Creation of Worked Examples for Programming Classes
Human-AI Co-Creation of Worked Examples for Programming Classes
 
Diploma in Nursing Admission Test Question Solution 2023.pdf
Diploma in Nursing Admission Test Question Solution 2023.pdfDiploma in Nursing Admission Test Question Solution 2023.pdf
Diploma in Nursing Admission Test Question Solution 2023.pdf
 
5 charts on South Africa as a source country for international student recrui...
5 charts on South Africa as a source country for international student recrui...5 charts on South Africa as a source country for international student recrui...
5 charts on South Africa as a source country for international student recrui...
 
The Singapore Teaching Practice document
The Singapore Teaching Practice documentThe Singapore Teaching Practice document
The Singapore Teaching Practice document
 
How to Add Existing Field in One2Many Tree View in Odoo 17
How to Add Existing Field in One2Many Tree View in Odoo 17How to Add Existing Field in One2Many Tree View in Odoo 17
How to Add Existing Field in One2Many Tree View in Odoo 17
 
HED Office Sohayok Exam Question Solution 2023.pdf
HED Office Sohayok Exam Question Solution 2023.pdfHED Office Sohayok Exam Question Solution 2023.pdf
HED Office Sohayok Exam Question Solution 2023.pdf
 
PISA-VET launch_El Iza Mohamedou_19 March 2024.pptx
PISA-VET launch_El Iza Mohamedou_19 March 2024.pptxPISA-VET launch_El Iza Mohamedou_19 March 2024.pptx
PISA-VET launch_El Iza Mohamedou_19 March 2024.pptx
 
Drug Information Services- DIC and Sources.
Drug Information Services- DIC and Sources.Drug Information Services- DIC and Sources.
Drug Information Services- DIC and Sources.
 
How to Use api.constrains ( ) in Odoo 17
How to Use api.constrains ( ) in Odoo 17How to Use api.constrains ( ) in Odoo 17
How to Use api.constrains ( ) in Odoo 17
 
General views of Histopathology and step
General views of Histopathology and stepGeneral views of Histopathology and step
General views of Histopathology and step
 
How to Make a Field read-only in Odoo 17
How to Make a Field read-only in Odoo 17How to Make a Field read-only in Odoo 17
How to Make a Field read-only in Odoo 17
 
CHUYÊN ĐỀ DẠY THÊM TIẾNG ANH LỚP 11 - GLOBAL SUCCESS - NĂM HỌC 2023-2024 - HK...
CHUYÊN ĐỀ DẠY THÊM TIẾNG ANH LỚP 11 - GLOBAL SUCCESS - NĂM HỌC 2023-2024 - HK...CHUYÊN ĐỀ DẠY THÊM TIẾNG ANH LỚP 11 - GLOBAL SUCCESS - NĂM HỌC 2023-2024 - HK...
CHUYÊN ĐỀ DẠY THÊM TIẾNG ANH LỚP 11 - GLOBAL SUCCESS - NĂM HỌC 2023-2024 - HK...
 
Clinical Pharmacy Introduction to Clinical Pharmacy, Concept of clinical pptx
Clinical Pharmacy  Introduction to Clinical Pharmacy, Concept of clinical pptxClinical Pharmacy  Introduction to Clinical Pharmacy, Concept of clinical pptx
Clinical Pharmacy Introduction to Clinical Pharmacy, Concept of clinical pptx
 
Practical Research 1 Lesson 9 Scope and delimitation.pptx
Practical Research 1 Lesson 9 Scope and delimitation.pptxPractical Research 1 Lesson 9 Scope and delimitation.pptx
Practical Research 1 Lesson 9 Scope and delimitation.pptx
 
How to Solve Singleton Error in the Odoo 17
How to Solve Singleton Error in the  Odoo 17How to Solve Singleton Error in the  Odoo 17
How to Solve Singleton Error in the Odoo 17
 
Patterns of Written Texts Across Disciplines.pptx
Patterns of Written Texts Across Disciplines.pptxPatterns of Written Texts Across Disciplines.pptx
Patterns of Written Texts Across Disciplines.pptx
 
Finals of Kant get Marx 2.0 : a general politics quiz
Finals of Kant get Marx 2.0 : a general politics quizFinals of Kant get Marx 2.0 : a general politics quiz
Finals of Kant get Marx 2.0 : a general politics quiz
 
How to Manage Cross-Selling in Odoo 17 Sales
How to Manage Cross-Selling in Odoo 17 SalesHow to Manage Cross-Selling in Odoo 17 Sales
How to Manage Cross-Selling in Odoo 17 Sales
 

Evolution and Biodiversity,Genetics,Digestive System,Ecosystem

  • 2. Lord, help us in our work today. Give us concentration so that may we listen, understand, learn and have a peaceful mind and may we always remember that Jesus
  • 8. th GRADING PERIOD 4 Digestive System Genetics Evolution and Biodiversity Ecosystem
  • 13. Quit Hello There! Would you like to learn about Evolution and Biodiversity? Overview STAR T
  • 14. Overview on Evolution  Evolution as Theory and Fact  Discoveries  Mechanisms  Evidences
  • 21. The Tree of Life  All living things share a common ancestor.  We can draw a Tree of Life to show how every species is related.  Evolution is the process by which one species gives rise to another and the Tree of Life grows.
  • 23. Evolution as Theory and Fact • Confusion sometimes arises as to whether Evolution is a theory or a fa Actually it is both! • The theory of Evolution deals with h Evolution happens. Our understand of this process is always changing. • Evolution is also a fact as there is a huge amount of indisputable eviden for its occurrence.
  • 24. Talk Outline Part 1: How was evolution discovered? Discussion: Should Creationism and Evolution be given “equal time” in science lessons? Part 2: How does evolution work? Practical: Natural Selection in the Peppered Moth Part 3: What is the evidence for evolution?
  • 25. Discovery (1) Fixed species Michelangelo’s Fresco on the ceiling of the Sistine Chapel From Classical times until long after the Renaissance, species were considered to be special creations, fixed for all time.
  • 26. Discovery (2): Transmutation • Around 1800, scientists began to wonder whether species could change or transmute. • Lamarck thought that if an animal acquired a characteristic during its lifetime, it could pass it onto its offspring. Jean Baptiste de Lamarck • Hence giraffes got their long necks through generations of straining to reach high branches.
  • 27. Discovery (3): Fossils and Strata http://en.wikipedia.org/wiki/ ImageWilliam_Smith.g.jpg http://en.wikipedia.org/wiki/Image: Geological_map_of_Great_Britain.jpg http://en.wikipedia.org/wiki/Image:Smith_fossils2.jpg William Smith, his geology map & some of his fossil specimens At about the same time, geologists like William Smith were mapping the rocks and fossils of Britain. He and others showed that different species existed in the past compared with today.
  • 28. Discovery (4): Darwin’s Voyage • From 1831-1836, a young naturalist called Charles Darwin toured the world in HMS Beagle. Voyage of the Beagle en.wikipedia.org/wiki/Image:Charles_Darwin_by_G._Richmond.jpg en.wikipedia.org/wiki/Image:HMS_Beagle_by_Conrad_Martens.jpg • He was dazzled by the amazing diversity of life and started to wonder how it might have originated
  • 29. Discovery (5): Survival of the Fittest • In his Origin of Species, published in 1859, Darwin proposed how one species might give rise to another. Natural Selection explains adaption • Where food was limited, competition meant that only the fittest would survive. • This would lead to the natural selection of the best adapted individuals and eventually the evolution of a new species. en.wikipedia.org/wiki/Image:Darwin%27s_finches.jpeg Darwin in 1860
  • 30. Discovery (6): Huxley v. Wilberforce • Darwin’s idea of Evolution by Natural Selection was met with huge controversy. Bishop Wilberforce v. T. H. Huxley • A famous debate in 1860 pitted Bishop Wilberforce against Darwin’s bulldog, Thomas Henry Huxley. • Evolutionists got the better of the debate, but few were convinced by Darwin’s idea of Natural Selection. www.bbc.co.uk/religion/galleries/spiritualhistory/images/9.jpg
  • 31. Discovery (7): Genetics Mendel and his peas • From 1856-63, a monk called Gregor Mendel cultivated 29,000 pea plants to investigate how evolution worked i.e., how characteristics were passed down the generations. • He figured out the basic principles of genetics. He showed that offspring received characteristics from both parents, but only the dominant characteristic trait was expressed. Mendel’s work only came to light in 1900, long after his death en.wikipedia.org/wiki/Image:Mendel.png en.wikipedia.org/wiki/Image:Doperwt_rijserwt_peulen_Pisum_sativum.jpg
  • 32. Discovery (8): Making Sense • In the early 20th century, scientist started to make sense of how evolution worked. • Building on Mendel’s genetics, studies showed how characteristics in a population could be selected by environmental pressures. Julian Huxley and the Modern Synthesis • This Modern Synthesis, as Julian Huxley called it, brought Darwin’s Natural Selection back to the centre of evolutionary theory. en.wikipedia.org/wiki/Image:Hux-Oxon-72.jpg
  • 33. Discovery (9): Opposition • Despite the achieval of scientific consensus on evolution, some Christian groups continued to oppose the concept. Outside the Scopes Trial • In 1925, the teaching of evolution was outlawed in Tennessee, USA, resulting in the infamous Scopes Monkey Trial www.templeton-cambridge.org/fellows/vedantam/publications/2006.02.05/eden_and_evolution/
  • 34. Discussion: Should Creationism and Evolution be given equal time in science lessons? science.kukuchew.com/wp-content/uploads/ 2008/01/stop_following_me_creationist.jpg
  • 35. Mechanism (1): All in the Genes • The genetic make-up of an organism is known as its genotype. • An organism’s genotype and the environment in which it lives determines its total characteristic traits i.e. its phenotype. Genotype Phenotype commons.wikimedia.org/wiki/Image:DNA_double_helix_vertikal.PNG
  • 36. Mechanism (2): DNA • The double-helix structure of DNA was discovered in 1953. Watson and Crick and their model of DNA DNA replication www.chem.ucsb.edu/~kalju/chem110L/public/tutorial/images/WatsonCrick.jpg en.wikipedia.org/wiki/DNA • This showed how genetic information is transferred from one cell to another almost without error.
  • 37. Mechanism (3): Mutation Types of mutation • However, occasional mutations or copying errors can and do occur when DNA is replicated. • Mutations may be caused by radiation, viruses, or carcinogens. Mutant fruitfly • Mutations are rare and often have damaging effects. Consequently organisms have special enzymes whose job it is to repair faulty DNA. upload.wikimedia.org/wikipedia/commons/7/79/Types-of-mutation.png humansystemstherapeutics.com/bb.htm
  • 38. Mechanism (4): Variation • Nevertheless, some mutations will persist and increase genetic variation within a population. • Variants of a particular gene are known as alleles. For example, the one of the genes for hair colour comprises brown/blonde alleles. majorityrights.com/index.php/weblog/comments/racial_variation_in_so me_parts_of_the_skull_involved_in_chewing/
  • 39. Mechanism (5): Natural Selection Selection of dark gene • Mutant alleles spread through a population by sexual reproduction. • If an allele exerts a harmful effect, it will reduce the ability of the individual to reproduce and the allele will probably be removed from the population. • In contrast, mutants with favorable effects are preferentially passed on en.wikipedia.org/wiki/Image:Mutation_and_selection_diagram.svg
  • 40. Mechanism (6): Peppered Moth Haldane and the peppered moth • The Peppered Moth is an example of Natural Selection in action discovered by Haldane   http://en.wikipedia.org/wiki/Image:Biston.betularia.7200.jpg en.wikipedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpg en.wikipedia.org/wiki/J._B._S._Haldane • During the Industrial Revolution the trees on which the moth rested became soot-covered. • This selected against the allele for pale colour in the population (which were poorly camouflaged from predators) and selected for the dark colour allele.
  • 41. Mechanism (7): Microevolution • The dog is another example of how selection can change the frequency of alleles in a population. • Dogs have been artificially selected for certain characteristics for many years, and different breeds have different alleles. Dogs are wolves • All breeds of dog belong to the same species, Canis lupus (the wolf) so this is an example of Microevolution as no new species has resulted. www.puppy-training-solutions.com/image-files/dog-breed-information.jpg
  • 42. Mechanism (8): Macroevolution • However, if two populations of a species become isolated from one another for tens of thousands of years, genetic difference may become marked. • If the two populations can no-longer interbreed, new species are born. This is called Macroevolution. Galapagos finches • Darwin’s Galapagos finches are an example of this process in action. www.ingala.gov.ec/galapagosislands/images/stories/ingala_images/galapagos_take_a_tour/small_pics/galapagos_map_2.jpg
  • 43. Mechanism (9): Speciation Today? • The mosquito was introduced to the London Underground during its construction around 1900. London Underground Mosquito en.wikipedia.org/wiki/Image:Gb-lu-Angel-southbound.jpg en.wikipedia.org/wiki/Culex • It became infamous in the War for attacking people sheltering from the Blitz. • Studies indicate several genetic differences from its above-ground ancestors. Interbreeding between populations is difficult suggesting that speciation may be occurring.
  • 44. Evidence (1): Biochemistry • The basic similarity of all living things suggests that they evolved from a single common ancestor. • As we have already seen, all living things pass on information from generation to generation using the DNA molecule. • All living things also use a molecule called ATP to carry energy around the DNA for Information organism. Transfer en.wikipedia.org/wiki/Image:ATP-xtal-3D-sticks.png ATP for Energy Transfer
  • 45. Evidence (2): Similar Genes HUMAN CHIMPANZEE GORILLA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA Genetic code of chimps and gorillas is almost identical to humans • If evolution is true then we might also expect that closely related organisms will be more similar to one another than more distantly related organisms. • Comparison of the human genetic code with that of other organisms show that chimpanzees are nearly genetically identical (differ by less than 1.2%) whereas the mouse differs by ≈15%.
  • 46. Evidence (3): Comparative Anatomy • Similar comparisons can be made based on anatomical evidence. • The skeleton of humans and gorillas are very similar suggesting they shared a recent common ancestor, but very different from the more distantly related woodlouse… Human and Gorilla yet all have a common shared characteristic: bilateral symmetry Woodlouse en.wikipedia.org/wiki/Image:Primatenskelett-drawing.jpg
  • 47. Evidence (4): Homology The pentadactyl limb is ancestral to all vertebrates… but modified for different uses en.wikipedia.org/wiki/Image:Evolution_pl.png
  • 48. Evidence (5): Vestigial Structures • As evolution progresses, some structures get side-lined as they are not longer of use. These are known as vestigial structures. • The coccyx is a much reduced version of an ancestral tail, which was formerly adapted to aid balance and climbing. The coccyx is a vestigial tail • Another vestigial structure in humans is the appendix. en.wikipedia.org/wiki/Image:Illu_vertebral_column.jpg
  • 49. Evidence (6): Fossil Record http://en.wikipedia.org/wiki/Geologic_time_scale © World Health Org. en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png © NASA origins bacteria complex cells dinosaurs humans The fossil record shows a sequence from simple bacteria to more complicated organisms through time and provides the most compelling evidence for evolution.
  • 50. Evidence (7): Transitional fossils • Many fossils show a clear transition from one species, or group, to another. • Archaeopteryx was found in Germany in 1861. It share many characteristics with both dinosaurs and birds. Archaeopteryx en.wikipedia.org/wiki/Image:Archaeopteryx_lithographica_paris.JPG • It provides good evidence that birds arose from dinosaur ancestors
  • 51. Evidence (8): Geography • Geographic spread of Marsupials organisms also tells of their past evolution. • Marsupials occur in two populations today in the Americas and Australia. • This shows the group evolved before the continents drifted apart evolution.berkeley.edu/evosite/lines/IVCexperiments.shtml en.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg
  • 52. Evidence (9): Antibiotic resistance Staphylococcus • We are all familiar with the way that certain bacteria can become resistant to antibiotics • This is an example of natural selection in action. The antibiotic acts as an environmental pressure. It weeds out those bacteria with low resistance and only those with high resistance survive to reproduce. http://en.wikipedia.org/wiki/Image:Antibiotic_resistance.svg en.wikipedia.org/wiki/Image:Staphylococcus_aureus%2C_50%2C000x%2C_USDA%2C_ARS%2C_EMU.jpg

Notes de l'éditeur

  1. Presenter notes: So let’s start by thinking about the discovery of Evolution. Beginning in Classical times and persisting until long after the Renaissance, scientists thought species were fixed and unchangeable (or ‘immutable’ to use the language of the era). Their reasoning ran something like this: if God’s creation was perfect from the start, why would He bother to tinker with it at a later date?
  2. Presenter notes: However, around 1800, some scientists began to wonder if species could change their form or ‘transmute’. One of the early proponents of this idea was French scientist, Jean Baptiste de Lamarck (1744-1829). If species were able to change their form over time, then how did it happen? Lamarck thought that if an animal acquired a characteristic during its lifetime, it could pass it onto its offspring. One of his favorite examples was the giraffe. In his view, the giraffe got its long neck through straining to reach the leaves on high branches, and this characteristic got passed down the generations. Most scientists of his day thought that Lamarck was wrong. At that time, only a few radical thinkers like Charles Darwin’s grandfather, Erasmus, agreed that species could change over time.
  3. Presenter notes: In the early nineteenth century, Charles Darwin (1809-1882) rekindled ideas about evolution. In a sense, Evolution was in Darwin’s blood because, as we’ve already noted, his grandfather was an early supporter of the concept. From 1831-1836, Darwin toured the world on HMS Beagle as a young naturalist. He was dazzled by the amazing diversity of life, including some amazing fossils such as rodents the size of hippopotamuses and started to wonder how it might have originated.
  4. Presenter notes: On his return from the Beagle the jigsaw pieces started to fit together in his mind. Around 1842 Darwin read an essay about human population growth by Malthus. Malthus had argued that human population would grow more quickly than food supply. Consequently competition for food would become intense and only the fittest and most able would survive. Darwin applied these ideas to all of life and came up with his now famous concept of Natural Selection. Darwin reasoned that if an organism possessed a character that improved its chances of survival, then it would be more likely to pass on that character to the next generation. Therefore organisms would become progressively adapted to their environment, leading to the evolution of new species. Darwin published this idea in his “Origin of Species by means of Natural Selection” in 1859.
  5. Presenter notes: However, Darwin’s concept of Evolution by Natural Selection was met with considerable controversy and debate. Although some Christians were willing to accept Evolution, if God was allowed to guide the process, most were opposed to the idea of Evolution being driven by random competition and natural laws. However, some leading scientists did embrace Evolution. One of these was Thomas Henry Huxley (1825-1895), who became known as “Darwin’s bulldog” for his ferocious support of Darwin. On 30 June 1860, Huxley debated Evolution with Bishop Wilberforce at a British Association meeting in Oxford. In the debate, Wilberforce infamously inquired of Huxley whether it was through his grandfather or grandmother that he claimed descent from a monkey! Huxley then rose to the defence of Evolution, finishing his speech with the now legendary ‘put-down’ that he was not ashamed to have a monkey for his ancestor, but he would be ashamed to be connected with a man who used great gifts to obscure the truth! This debate saw many people come to accept Evolution. However, there was little support or enthusiasm for Darwin’s mechanism of Natural Selection.
  6. Presenter notes: While all this was going on, and unbeknown to the scientific elite in Britain, an Austrian monk called Gregor Mendel (1822-1884) was carrying out important experiments that would eventually prove that Darwin’s Natural Selection was in fact correct. For seven years, Mendel cross-bred different strains of pea plants to investigate how characteristics like the colour of the flowers got passed down the generations. In a quite amazing feat, he cultivated almost thirty thousand pea plants and in doing so figured out the basic principles of, what would later become known as, Genetics. He showed that offspring received characteristics from both parents, but only the dominant characteristic was expressed. This was contrary to the prevailing view at the time that the characteristics of both parents were somehow “blended” together. Unfortunately, Mendel’s work was overlooked by scientists in the West, only coming to light long after his death.
  7. Presenter notes: When Mendel’s work on Genetics was finally “re-discovered” in 1900, it started to make sense of evolution in a new way and stimulated renewed interest in Darwin’s work of fifty years earlier. Building on Mendel’s work, studies showed how genetic traits in a population of animals or plants could be selected by environmental pressures and how a population could become progressively adapted to its environment. This Modern Synthesis, as Julian Huxley called it, brought Darwin’s concept of Natural Selection right back to the centre of evolutionary theory, as we will see in the next part of the talk.
  8. Presenter notes: However, despite becoming universally accepted by the scientific community in the early 20th century, Evolution by Natural Selection continued to meet strong opposition by certain religious groups. This was especially true of Christian fundamentalists, who saw the concept as an erosion of God’s sovereignty. In 1925, the State of Tennessee, USA outlawed the teaching of Evolution completely. When one teacher, John Scopes, continued to teach evolution he was tried and found guilty in what is now infamously known as the “Scopes Monkey Trial”!
  9. Presenter notes: In this second part of the talk, we will think about the mechanism of evolution, or to put it more simply, how evolution works. Earlier, we’ve mentioned the importance of genetics in the discovery of Evolution, and we’ll think much more about that over the next few slides. But first of all, let’s introduce ourselves to a few technical terms. The genetic make-up of an organism is known as its genotype. The genotype of an organism and the environment in which it lives (nature and nurture together) determine the characteristic traits of the organism, or its phenotype.
  10. Presenter notes: The genotype of an organism is stored in DNA molecules, which are a sort of information bank found within the nucleus of every cell. Every time an organism grows a new cell a new copy of the DNA is created. It is important that every copy of the DNA is identical, since any errors copying the genotype may prevent the cell from functioning properly. In 1953, Watson and Crick figured out that DNA had a helical structure and showed how it copies itself with such amazing accuracy. When DNA replicates, the helix unwinds and each strand produces an exact mirror image copy of itself. This ensures that each copy is identical to the original.
  11. Presenter notes: However, very occasionally, tiny copying errors can and do occur when DNA is replicated. These copying errors are called mutations. Mutations may be caused by a number of factors including radiation, viruses, or carcinogens (cancer-causing materials). As the genotype provides the blueprint for how each cell should grow and function, even a tiny mutation might mean that the cells fail to work properly. Take for example the common fruitfly: a single mutation in the fruitfly can change the colour of the eye from red (its normal colour) to white. White-eyed fruitfly are less successful at mating. Because of the potential for mutation, most organisms have a group of special enzymes whose job it is to go round and repair any faulty DNA.
  12. Presenter notes: Mutations give rise to variants, or alleles, of the same gene. One person may have one set of alleles, and another person, a different set. For example, take hair colour in humans. One of the genes that codes for hair colour occurs as two alleles, brown and blonde. If you throw you mind back to earlier in this talk you’ll remember how Mendel showed that one allele is usually dominant and the other recessive. In the case of hair colour, brown is dominant and blonde is recessive. So if a person gets a brown allele from one parent and a blonde allele from the other parent, they will have brown hair. A person will only have blonde hair where they receive blonde alleles from both parents.
  13. Presenter notes: If a person, or any other organism for that matter, develops a new allele (a mutation), they can spread this around the population by sexual reproduction. However, if the allele exerts a harmful effect on the individual then this will reduce the likelihood of it reproducing and the allele will be removed from the population. Only those mutant alleles that have beneficial effects that increase the likelihood of reproduction will be passed on to offspring. In this way, harmful alleles are removed from a population while favorable alleles accumulate. This is Darwin’s concept of Natural Selection and shows how a population adapts to its environment over time.
  14. Presenter notes: The case of the Peppered Moth is an excellent example of Darwin’s Natural Selection in action put forward by the biologist J.B.S. Haldane in 1924. The gene that controls the colour of the Peppered Moth occurs as two alleles, a mottled allele (pale colour) and a melanic allele (black colour). Early in the 18th century, pale moths were dominant in the countryside around Manchester. However, during the Industrial Revolution the trees on which the moths rested became covered in black soot. Pale mottled moths were poorly camouflaged on the black tree trunks and were preferentially eaten by birds. In contrast, the black melanic moths were better at avoiding predation. Natural Selection acted against the pale moths and in only a few generations, the melanic moths were dominant. However, there was one final twist. As the skies of Manchester became cleaner in the 20th century, the mottled moths made a comeback and displaced the melanic moths again.
  15. Presenter notes: The case of the Peppered Moth shows how natural selection can change the frequency (or relative proportion) of alleles in a population. A more straightforward example of the same phenomenon is the breeding of dogs. Humans have been breeding dogs for thousands of years and trying to develop certain characteristics. This “artificial selection” is exactly the same process as natural selection but controlled by human intention rather than natural forces. Although humans have been successful in changing the frequency of alleles in different dog breeds, they haven’t created new species. The definition of a species is a population that can interbreed and produce fertile offspring. Most dogs can successively interbreed with other dogs, and also with wolves, so in actual fact all dog breeds are just subspecies of the wolf, Canis lupus! Dog breeding is therefore an example of what biologists called Microevolution; the frequency of alleles in the population have changed, but not greatly enough to give rise to a new species.
  16. Presenter notes: To give rise to a new species, Microevolution needs to go on for more much longer than humans have been breeding dogs. For example, if a species was to become divided into two isolated populations for tens of thousands of years, then natural selection would eventually change the frequency of alleles to such an extent that members of the two populations could no longer interbreed. This process would result in the birth of new species or speciation. Where speciation occurs, biologists refer to the process as Macroevolution. An excellent example of Macroevolution is that observed by Charles Darwin during his world tour on HMS Beagle. When visiting the Galapagos Islands in the Pacific Ocean he noticed that each island had its own distinctive species of finch. Darwin argued that the islands had originally been colonized by just one species of finch, but then in isolation, each island population had evolved in response to different environmental conditions.
  17. Presenter notes: An obvious question as we conclude our look at how evolution works is: are there any examples of evolution by natural selection going on today. Obviously, the answer is yes, as all species are undergoing evolution. However, as the rate of change is very slow, examples are very difficult to detect and even harder to prove. One possible example is the case of the ‘London Underground Mosquito’. This mosquito found its way into the Tube system around 1900 when the railway lines were being constructed. It became infamous during the Second World War as it would constantly bite people sheltering from the Blitz. The London Underground Mosquito has been isolated from the surface for over a hundred years and studies indicate that there are already genetic differences between it and its above-ground relatives. The differences are so great that the two populations have difficulty interbreeding. Perhaps here is an example of ongoing speciation today?
  18. Presenter notes: In this third and final part of the talk, we’ll consider the evidence for evolution and reflect on the fact that Biology simply doesn’t make sense if we take Evolution out of the equation. One of the most striking pieces of evidence for evolution is the basic similarity of all living things. First of all, as we’ll already stressed, all living things pass on genetic information from generation to generation using the DNA molecule. However another basic shared characteristic is the use of the ATP molecule to carry energy around the cell. These two fundamental similarities suggest that all living things evolved from a single common ancestor.
  19. Presenter notes: If life was generated through evolution then we might also predict that closely related organisms will be more similar to one another than more distantly related organisms. This is borne out by comparison of the human genetic code with that of other organisms. These studies show that chimpanzees, our closest relations, are nearly genetically identical (their genes differ by only 1.2%) whereas the more distantly related mouse differs by some 15%.
  20. Presenter notes: Very similar comparisons can be made based on anatomical evidence. For example the skeleton of humans is very similar to that of the gorilla, our close relative, but both are very different from the exoskeleton of the woodlouse. Yet even primates and woodlice share some basic anatomical characteristics such as bilateral symmetry suggesting that they are all related in the Tree of Life, albeit distantly. Here again is clear evidence for the inter-relatedness of all living things.
  21. Presenter notes: Another piece of evidence that supports evolution is the concept that biologists have called homology. Homology refers to an anatomical feature possessed by an ancestor that has subsequently been modified by its descendents for a specific function. Take, for example, the pentadactyl (or five fingered) limb. This is found in all vertebrates from fish to amphibians to reptiles to mammals to birds. This structure is easily recognizable in all these diverse groups of organisms but has been adapted to suit particular purposes in each. So we find it adapted as wings for flight in birds, as fins for swimming in fish, as scrapers for digging amongst moles and so on. As all these diverse organisms have the same anatomical blueprint, this strongly suggests they are inter-related.
  22. Presenter notes: Whilst ancestral anatomical features can be adapted to new purposes (as we’ve just seen), they can also find themselves redundant altogether. Features that get sidelined by evolution in this way are called Vestigial Structures. One example is the human coccyx or tail bone which is a much reduced version of a bony tail possessed by our ancestors. Formerly adapted to aid balance and climbing, a tail has little function in human behaviour so has been selected against. It probably has been retained in a vestigial form because it has some use as a point for muscle attachment in the bottom. Another example of a vestigial human organ is the appendix.
  23. Presenter notes: All the pieces of evidence that we have discussed so far point to the inter-relatedness of all living things and their evolution from a single common ancestor. However, perhaps the most compelling piece of evidence in support of evolution is the fossil record itself. The fossil record shows a sequence from simple bacteria in the oldest rocks through to more complicated organisms like dinosaurs and humans in much younger rocks. It shows that different species arose at different times and, as we see in the next slide, in many cases there are clear transitions from one species, or group, to another. Background note: A companion talk on the History of Life can be downloaded from the Your Planet Earth website: http://www.earth4567.com/talks/life.html
  24. Presenter notes: One of the most famous examples of a species that is transitional between two major groups, is the 150 million year old Archaeopteryx. Archaeopteryx has several characteristic features seen in certain dinosaurs including teeth and a bony tail. However, it has more features that are characteristic of modern birds such as a wishbone, wings with flight feathers, and a partially reversed first toe. Although geologists classify Archaeopteryx as an early fossil bird they recognize that it is more closely related to the dinosaurs than any birds living today. Archaeopteryx therefore provides good evidence of the evolutionary transition from dinosaurs to birds.
  25. Presenter notes: A rather different source of evidence in support of evolution comes from the geographic distribution of species today. If we take for example the case of marsupials, we see that this primitive group of mammals is found in the Americas and Australasia. Marsupials are not renowned as strong swimmers so this raises the questions as to how two populations came to be separated by the Pacific Ocean if they evolved from a common ancestor. However, this problem is resolved if we remember that the Earth’s continents have not remained stationary over time but have drifted around the surface of the Earth. During the Jurassic Period, 160 million years ago, all the Southern Hemisphere landmasses were joined together and you could have walked from Australia to South America across what is present day Antarctica. Fossil evidence shows that marsupials evolved in the Jurassic but after the continents started to break-up, the marsupials must have got separated into two populations, one in the Americas and the other in Australasia. In fact fossil marsupials have even been found in Antarctica and South Africa as well, providing evidence that that these continents acted as a land bridge connecting the two populations for a time.
  26. Presenter notes: A final and perhaps especially convincing piece of evidence for evolution is the familiar way that bacteria may become resistant to antibiotics. Bacteria have a fast life cycle and can produce a new generation every 4 hours. As natural selection acts on each generation this means bacteria can rapidly respond to environmental pressures. In effect the antibiotics act to weed out those bacteria with low resistance in each generation. Only bacteria with high resistance survive and pass their alleles to the next generation. Consequently, in just a short time, natural selection increases the resistance level of the bacteria population. This is an example of evolution in action amongst the simplest organisms on our planet – and then having an impact on the most complex organisms!