1 
Les 
biotechnologies 
végétales 
: 
créa3on 
de 
biodiversité 
dans 
les 
génomes 
végétaux 
et 
améliora3on 
des 
plan...
2 
Les 
biotechnologies 
végétales 
• Introduc3on 
– Enjeux 
sociétaux 
et 
l’amélioraKon 
des 
plantes 
– L’amélioraKon, ...
3 
12 
10 
8 
6 
4 
2 
0 
Un 
contexte 
mondial 
en 
évolu3on 
rapide 
Consommation d’d’énergie (Qbtu / yr) 
1400 
1200 
1...
Comment 
relever 
le 
défi 
d’une 
intensifica3on 
durable? 
4 
Améliora3on 
des 
plantes 
Bonne 
gesKon 
des 
ressources ...
Contribu3on 
possible 
de 
l’améliora3on 
géné3que? 
Séminaire 
Biotechnologies 
-­‐ 
9 
et 
10 
février 
2012 
5 
-­‐ Au ...
6 
Maïs, 
~ 7000 
ans 
Haricot, 
pomme 
de 
terre 
~ 
10,000 
ans 
L’améliora3on 
géné3que 
des 
plantes 
and by genetic, ...
7 
1 
La sélection apparaît avec l’agriculture 
La domestication L’adaptation en Europe L’extension des 
Premiers 
maïs Po...
8 
Clark 
et 
al., 
2006 
La 
domes3ca3on 
concerne 
quelques 
gènes 
majeurs 
Le 
gène 
TB1 
(TEOSINTE 
BRANCHED 
1) 
-­‐...
9 
recessive allele q (center) and wild wheat (left) with the recessive allele 
have slender, fragile spikes. 
(Fourth row...
L’améliora3on 
repose 
sur 
l’u3lisa3on 
de 
la 
biodiversité 
10 
La 
domesKcaKon 
a 
reposé 
essenKellement 
sur 
l’exis...
Les 
principes 
de 
l’améliora3on 
des 
plantes 
Les biotechnologies Les Source: 
GNIS 
11 
Les principes de l’amélioratio...
12 
Les 
méthodes 
de 
sélec3on 
ont 
évolué 
1) Depuis 
la 
domes3ca3on, 
pra3quait 
essen3ellement 
la 
sélec3on 
massal...
13 
Exemple 
de 
résultats 
de 
l’améliora3on, 
le 
blé 
7000 
av 
JC 
Domes3ca3on 
du 
blé 
tendre 
en 
mésopotamie 
1600...
14 
Limites 
des 
techniques 
d’améliora3on 
conven3onnelles 
Les 
limites 
inhérentes 
à 
la 
reproduc3on 
sexuée 
Diffic...
15 
• Introduc3on 
– Enjeux 
sociétaux 
et 
l’amélioraKon 
des 
plantes 
– L’amélioraKon, 
de 
la 
domesKcaKon 
aux 
praKq...
Les biotechnologies 
Les 
Biotechnologies 
dans 
un 
programme 
de 
sélec3on 
16 
dans un programme de sélection 
Les biot...
17 
Méthodes 
de 
micropropaga3on 
in 
vitro 
pousse axillaire Mul8 
Des applications de la Le sauvetage 
d’embryons 
La c...
Bref 
rappel 
historique 
sur 
les 
biotechnologies 
cellulaires 
18 
-­‐ 
Culture 
« 
in 
vitro 
» 
de 
cellules, 
de 
3s...
19 
Exemples 
de 
bouturage 
et 
microbouturage 
Bouturage, 
Technique 
ancestrale 
: 
-­‐1100 
ans, 
néolithique, 
figuie...
Embryogénèse 
Soma3que 
et 
Sauvetage 
d’embryons 
20 
L’embryogenèse 
soma3que 
-­‐ 
Exemple, 
producKon 
de 
plants 
de ...
21 
21 
L’ o b t e n t i o n d e p ro t o p l ast es 
Cellules 
végétales 
débarrassées 
de 
leur 
paroi 
pecto-­‐cellulos...
22 
Applica3ons 
: 
Fusion 
de 
protoplastes 
et 
régénéra3on 
La 
maîtrise 
de 
la 
culture 
et 
de 
la 
fusion 
de 
prot...
Etamines 
Pollen 
23 
Haplo(diplo)ïdisa3on 
L’haploïdisaKon 
est 
l’obtenKon 
d’ 
individus 
provenant 
d’un 
seul 
parent...
Les biotechnologies 
dans un programme de sélection 
24 
La 
génomique 
dans 
l’améliora3on 
Les biotechnologies Les Sémin...
25 
Historique 
de 
l’étude 
des 
génomes 
et 
de 
l’ADN 
1900. 
Mise 
en 
applicaKon 
des 
lois 
de 
Mendel 
sur 
l'héréd...
26 
Les 
génomes 
végétaux 
et 
leur 
séquençage 
> 
20 
Espèces 
végétales 
séquencées 
depuis 
2000 
Arabidopsis 
thalia...
27 
• Inventaire 
Bénéfices 
directes 
du 
séquençage 
des 
génomes: 
des 
gènes 
«puta3fs» 
grâce 
aux 
ouKls 
bioinforma...
28 
Iden3fica3on 
de 
gènes 
par 
comparaison 
des 
génomes 
51 
La cartographie comparée 
Amidon-Waxy 
Hauteur 
des plant...
U3lisa3on 
de 
marqueurs 
moléculaires 
pour 
la 
selec3on 
29 
- Il est beaucoup PRECIS et RAPIDE de suivre un caractère ...
+ 
simples 
et 
faciles 
à 
caractériser, 
changement 
d’un 
nucléoKde 
30 
U3lisa3on 
de 
marqueurs 
moléculaires 
pour 
...
31 
Les 
origines 
des 
muta3ons 
et 
leurs 
u3lisa3ons 
-­‐ 
Les 
mutaKons 
s’accumulent 
en 
permanence 
avec 
les 
géné...
Exemple 
de 
muta3ons 
spontanées 
sources 
de 
diversité 
32 
Chou-fleur 
Romanesco 
Bruxelles 
Chou cultivé 
Chou sauvag...
Acquisi3on 
de 
gènes 
par 
croisements 
interspécifiques 
: 
33 
Exemple 
de 
la 
tomate 
10 
% 
du 
génome 
(3000 
gènes...
34 
Les 
croisements 
interspécifiques 
spontanés, 
le 
blé 
Triticum urartu 
Ae. Section Sitopsis 
Triticum æstivum 
Géno...
Polyploïdisa3on, 
une 
source 
importante 
de 
diversité 
Figure 
1 
-­‐ 
Schema3c 
phylogene3c 
tree 
of 
flowering 
plan...
36 
Les 
transposons 
Liseron 
Sélection vers 1940, insertion d’un helitron, 
from Choi et al., Plant Journal 2007) 
Choux...
37 
PA 
C HIAM 
S ER AUP 
FOR TUNA B ESAR 
15 MAR ONG UNKNOWN 
PA R OC 
B LUE 
ROSE 
B PI 
76 R EX OR O SUPR EME 
KIT C HI...
38 
U3lisa3on 
de 
la 
mutagenèse 
La 
mutagenèse 
ar3ficielle 
est 
très 
u3lisée 
depuis 
le 
milieu 
du 
20ème 
et 
la ...
39 
Conclusions 
• Les 
mutaKons 
sont 
donc 
à 
la 
base 
de 
l’évoluKon, 
de 
l’adaptaKon 
des 
espèces, 
de 
la 
domesK...
40 
Le 
Génie 
Géné3que 
naturel 
d’Agrobacterium 
Elysia 
chloroMca 
0,5 
mm 
LB 
ADN-T 
simple 
brin 
VirD2 
Rumpho 
et ...
41 
Plan 
• Introduc3on 
– Enjeux 
sociétaux 
et 
amélioraKon 
des 
plantes 
– De 
la 
domesKcaKon 
aux 
praKques 
actuell...
42 
Bases 
théoriques 
de 
la 
transgenèse 
• Universalité du code génétique: 
• Rend possible l’utilisation de la séquenc...
43 
Historique 
de 
l’ingénierie 
géné3que 
végétale 
A. 
rhizogenes 
sur 
Kalanchoe, 
INRA 
1907, 
Agrobacterium 
tumefac...
44 
Les 
étapes 
de 
la 
transgenèse 
27 
Le s é t a p e s d e l a t r a nsg é n è s e 
Id e n t i f i e r 
u n g è n e d ...
www.labomics.com 
Grizot 
et 
al. 
(2010) 
NAR 
45 
Limita3on 
de 
la 
transgénèse 
Le 
site 
d’inserKon 
dans 
le 
génome...
Les domaines d’application de la transgénèse 
L’agronomie 
• La résistance à des insectes 
• La résistance à des maladies ...
47 
ApplicaKons 
agronomiques 
: 
Les 
maladies 
et 
les 
ravageurs 
=> 
+25% 
pertes 
des 
récoltes 
Wheat infected with ...
48 
Jaunisse 
nanisante 
(orge) 
PLRV, 
P 
de 
terre 
Les 
stratégies 
an3virales 
sont 
parmi 
les 
premiers 
exemples 
d...
Autre 
exemple, 
les 
résistances 
aux 
insectes 
Très 
peu 
de 
solu3on 
conven3onnelle 
(ex. 
Résistance 
aux 
pucerons ...
50 
Résistance 
/ 
tolérance 
aux 
stress 
abio3ques 
-­‐ 
Tolérance 
aux 
métaux 
toxiques 
-­‐ 
Stress 
hydrique, 
de 
n...
51 
Améliorera3on 
de 
la 
qualité 
La 
qualité 
industrielle 
ou 
nutri3onnelle 
-­‐ 
AugmentaKon 
de 
la 
teneur 
en 
hu...
Figure 2 Carotenoid enhancement endosperm by transformation and crtI. (a) Schematic used to generate transgenic T-DNA comp...
Research in Cologne. 
In Amflora, the gene encoding the key enzyme for the synthesis of amylose, the granule 
bound starch...
54 
Le 
développement 
du 
“molecular 
farming” 
Nombre 
de 
producKon 
de 
protéines 
pour 
la 
santé 
et 
l’industrie 
L...
55 
Bilan: 
les 
OGM 
dans 
le 
monde 
(2011) 
-­‐ 
160 
millions 
d’hectares 
d’OGM 
culKvées 
(+ 
10% 
surfaces 
culKvée...
56 
11 
plantes 
cul3vées 
en 
2011, 
-­‐ 
4 
principales 
soja 
(75% 
en 
PGM), 
coton 
(82 
%), 
maize 
(32%), 
colza 
(...
57 
Conclusions 
-­‐ 
Les 
espèces 
évoluent 
conKnuellement 
et 
les 
hommes 
ont 
mis 
à 
profit 
cege 
variabilité 
pou...
58 
Remerciements 
• P. Colonna 
• M. Caboche 
• Y. Chupeau 
• M. Jullien 
• G. Pelletier 
• A. Bendahmane 
• B. Chaloub 
...
Prochain SlideShare
Chargement dans…5
×

Biotechnologies végétales

6 044 vues

Publié le

Biotechnologies végétales, amélioration des plantes, domestication, développement durable, biologie végétale

Publié dans : Sciences
0 commentaire
4 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

Aucun téléchargement
Vues
Nombre de vues
6 044
Sur SlideShare
0
Issues des intégrations
0
Intégrations
52
Actions
Partages
0
Téléchargements
276
Commentaires
0
J’aime
4
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

Biotechnologies végétales

  1. 1. 1 Les biotechnologies végétales : créa3on de biodiversité dans les génomes végétaux et améliora3on des plantes Loïc Lepiniec IJPB, INRA-­‐AgroParisTech, Versailles et LabEx SPS Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  2. 2. 2 Les biotechnologies végétales • Introduc3on – Enjeux sociétaux et l’amélioraKon des plantes – L’amélioraKon, de la domesKcaKon aux praKques actuelles • Les apports des biotechnologies – Biologie cellulaire et régénéraKon – Biologie moléculaire et génomique – CréaKon et uKlisaKon de la biodiversité moléculaire • La transgénèse – Bases cellulaires et moléculaires de la transgénèse – Exemples d’uKlisaKons potenKelles – Etat actuel des cultures • Conclusions Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  3. 3. 3 12 10 8 6 4 2 0 Un contexte mondial en évolu3on rapide Consommation d’d’énergie (Qbtu / yr) 1400 1200 1000 800 600 400 200 0 Population mondiale Consommation d’énérgie 2000 2050 2100 Population (Milliards) 1900 1950 Années from Energy Projections IIASA / WEC, Population Projections: United Nations “Long-Range World, Population Projections”. Adapted from R. Beachy • Une demande croissante des produits de l’agriculture : – AugmentaKon de la populaKon (6 à 9 Mds) – ÉvoluKon des habitudes alimentaires – Epuisement du carbone fossile – Nécessite d’augmenter de 70% la producKon (Banque Mondiale, World Dev. Rep. 2008) • Contraintes environnementales – Impact de l’agriculture sur l’environnement, – Changement climaKques – LimitaKon des ressources (terres agricoles, eau, énergie, ferKlisants, biodiversité…) • Conclusion, il faut produire plus et mieux… nécessité d’une intensifica3on durable Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  4. 4. Comment relever le défi d’une intensifica3on durable? 4 Améliora3on des plantes Bonne gesKon des ressources (eau, sols, énergie, biodiversité) PraKques agricoles Intensifica3on Durable PraKques industrielles OrganisaKon socio-­‐économique et poliKque soutenant le développement agricole Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  5. 5. Contribu3on possible de l’améliora3on géné3que? Séminaire Biotechnologies -­‐ 9 et 10 février 2012 5 -­‐ Au cours des 60 dernières années, les rendements des principales cultures ont été mul3pliés par 5 -­‐ L’améliora3on géné3que a contribué pour + de 50% -­‐ Compte tenu du contexte actuel -­‐ augmentaKon des besoins en produits agricoles (+ 70%) -­‐ Crise environnementale, limitaKon intrants, sols, eau -­‐ L’améliora3on géné3que devra faire plus et mieux… -­‐ Comment les biotechnologies ont déjà et peuvent encore y contribuer?
  6. 6. 6 Maïs, ~ 7000 ans Haricot, pomme de terre ~ 10,000 ans L’améliora3on géné3que des plantes and by genetic, linguistic and skeletal human populations. The clearest such insight review articles Blé, orge, pois, ~ 13,000 ans Fertile Crescent West Ethiopia Africa China Centres of origin of food production The most productive agricultural areas of the modern world hgp://arstechnica.com Riz et soja ~ 9000 ans their permanent gardens, orchards and pastures, instead of migrat-ing to follow seasonal shifts in wild food supplies. (Some Eastern US Sahel Mesoamerica New Guinea Andes and Amazonia of plant and homelands of orange-shaded 5.1 of productive areas cereals and yellow-shaded overlap that China the most States United The different which the wild domesticable other areas those Diamond, J. (2002) Nature 418: 700-707, Purugganan and Fuller (2009), Nature 457: 843-848) Riz, haricot ~ 8500 ans L’amélioraKon des plantes débute avec la sédentarisaKon de l’homme, il y a 10000 ans, dans différentes régions (une dizaine). Millet ~ 5000 ans sorgho ~ 4000 ans
  7. 7. 7 1 La sélection apparaît avec l’agriculture La domestication L’adaptation en Europe L’extension des Premiers maïs Populations Hybrides L’ancêtre sauvage Téosinte Apparition au Mexique Présence en Amérique Introduction dans le sud de l’Europe zones de culture Exemple du maïs Création des premiers hybrides en France -7000 ans 1494 1947 Séminaire Biotechnologies -­‐ 9 1 quintaux/hectare et 10 février 2012 90 quintaux/hectare L’exemple du maïs Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 source: GNIS
  8. 8. 8 Clark et al., 2006 La domes3ca3on concerne quelques gènes majeurs Le gène TB1 (TEOSINTE BRANCHED 1) -­‐ code un facteur de transcripKon (TCP) -­‐ contrôle la structure branchée de la plante -­‐ Sa surexpression entraine une dominance apicale accrue et le développement d’une Kge unique et épaisse chez le maïs culKvé Doebley, et al.. (2006) Cell 127: 1309-1321, Le gène TGA1 (TEOSINTE GLUME ARCHITECTURE 1) -­‐ Code un facteur de transcripKon (SBP) -­‐ contrôle le développement des glumes -­‐ sa mutaKon produit des grains nus et fixés à l’épi Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  9. 9. 9 recessive allele q (center) and wild wheat (left) with the recessive allele have slender, fragile spikes. (Fourth row) The massive fruit of cultivated tomato (right) next to the miniscule fruit of its progenitor (left). (Fifth row) A wild sunflower plant (left) has many small heads borne on multiple slender stalks, whereas a cultivated sunflower plant (right) Exemples similaires chez d’autres plantes Quelqhaus ea ssi nggèle nlaergse hseoadn bto rrnees opn oa nthiscak bstalelk.s de -­‐ L’égrainage du panicule de riz sauvage (qSH1 et sh4) gathered from another location. Key to the domestica-tion process would be a subsequent switch from allow-ing -­‐ La structure edible wild compacte species et to naturally solide de resow l’épis themselves de blé (Q) in burned fields, to sowing seed gathered the previous season. Once this practice was established, selection and crop improvement could begin. Although cereals and other field crops were likely to have been domesticated in the context of large fields cleared by burning or by spring floods along rivers, other domesticates may have had their beginnings as weeds near seasonal campgrounds (Anderson, 1969). Hunter-gatherers often follow seasonal migra-tory schedules, visiting the same specific sites at given times every year. The disturbance of the natural vegetation and middens at these sites provided fertile ground for the types of colonizing species that were the progenitors of our crops. Seeds discarded with the “kitchen” trash one year would sprout into a new crop by the time the group returned the following year. If they preferentially collected seeds and fruit from plants with the most desirable traits, then over time the frequency of plants with these favored phenotypes would increase in their garden crop. Eventually, no new wild seeds and fruits would be collected and a switch to deliberate sowing of seeds would occur. The early agricultural practices just described have Doebley et al. (2006), Cell, 127: -­‐ La taille réduite de plusieurs plantes culKvées est contrôlée par des homologues du gène GAI impliqué dans la biosynthèse d’une hormone, chez, le blé (Rht), le maïs (Dwarf 8), ou le colza (Bzh) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  10. 10. L’améliora3on repose sur l’u3lisa3on de la biodiversité 10 La domesKcaKon a reposé essenKellement sur l’existence et la sélecKon de quelques gènes (allèles) à effets forts (qualitaKfs) L’amélioraKon actuelle repose sur l’existence de variabilité d’un plus grand nombre de gènes (d’allèles) à effets souvent plus fins et complexes (quanKtaKfs et interacKfs). Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  11. 11. Les principes de l’améliora3on des plantes Les biotechnologies Les Source: GNIS 11 Les principes de l’amélioration des plantes Exemple de la pomme de terre Diversité existante Croisement • Plus productives • Plus résistantes aux maladies et aux parasites • Mieux adaptées au sol et au climat • Mieux adaptées aux techniques culturales • Régularité des formes • Qualité culinaire • Adaptées aux transformations : frites, chips, pommes de terre surgelées, fécule… entre individus choisis pour leurs caractères intéressants Collections de plus de 3 500 formes sauvages ou cultivées Nouvelle variété Objectifs de sélection des variétés Les biotechnologies dans un programme de sélection Connaître le génome Marqueurs moléculaires Cartes génétiques Sélection assistée par marqueurs Génomique étapes de la sélection Recenser le matériel génétique existant Observer, choisir et croiser le matériel de départ Créer des lignées ou les parents de l’hybride Fixer les caractères Évaluer la valeur agronomique et technologique de la nouvelle variété Inscrire la nouvelle variété Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  12. 12. 12 Les méthodes de sélec3on ont évolué 1) Depuis la domes3ca3on, pra3quait essen3ellement la sélec3on massale -­‐ Choix des meilleures populaKons, (porte) graines sur leurs performances propres -­‐ Permis l’amélioraKon de populaKons de plantes autogames (blé, orge,…) 2) A par3r du milieu du 19ième siècle, mise en place de la sélec3on généalogique -­‐ basée sur la sélecKon d’individus et leurs performances en descendance (de Vilmorin) -­‐ l’amélioraKon d’espèces autogames et allogames (fécondaKon croisée), ex begeraves 3) Au 20 ième s. u3lisa3on des cartes géné3ques puis des marqueurs moléculaires -­‐ Grace à l’uKlisaKon des lois de G. Mendel -­‐ Etablissement des bases de la sélecKon des hybrides de maïs par Shull (1908) -­‐ Culture des premières variétés de maïs hybride aux Etats-­‐Unis (1933) -­‐ Etablissement des premières cartes généKques du maïs par Emerson (1935) -­‐ Débuts de la sélecKon assistée par marqueurs, à parKr de 1980 A. Gallais (2011) Méthodes de créaKon de variétés en AmélioraKon des plantes, Ed Quae D. De Vienne (1998), Les marqueurs moléculaires en généKque et biotechnologies végétales, Ed INRA
  13. 13. 13 Exemple de résultats de l’améliora3on, le blé 7000 av JC Domes3ca3on du blé tendre en mésopotamie 1600: arrive probablement à 5 Qx/ha 1800 fer3lisa3on/principe de res3tu3on, 10 Qx/ha 1900 « Révolu3on » agronomique, intrants, machinisme, géné3que 1960 « Révolu3on Verte » dans les pays en voie développement 1980: 65 Qx/ha 2000: 80 Qx/ha (France) plant breeder and Nobel Laureate Norman Borlaug 1914-2009 Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  14. 14. 14 Limites des techniques d’améliora3on conven3onnelles Les limites inhérentes à la reproduc3on sexuée Difficultés de réaliser des croisements entre espèces Risques d’introducKon de caractères indésirables dans la nouvelle variété Délais pour créer une nouvelle variété liés aux cycles de végétaKon Et au nombre de généraKons nécessaires Les avantages des biotechnologies Créer et mieux exploiter la diversité faciliter les croisements interspécifiques Connaître le génome et maîtriser l’apport de nouveaux caractères Diminuer la durée de créa3on variétale Adapté du GNIS Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  15. 15. 15 • Introduc3on – Enjeux sociétaux et l’amélioraKon des plantes – L’amélioraKon, de la domesKcaKon aux praKques actuelles • Les apports des biotechnologies – Biologie cellulaire et régénéraKon – Biologie moléculaire et génomique – CréaKon et uKlisaKon de la biodiversité moléculaire • La transgénèse – Bases cellulaires et moléculaires de la transgénèse – Exemples d’uKlisaKons potenKelles – Etat actuel des cultures • Conclusions Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  16. 16. Les biotechnologies Les Biotechnologies dans un programme de sélec3on 16 dans un programme de sélection Les biotechnologies Les biotechnologies Séminaire Biotechnologies -­‐ 9 et 10 février 2012 Connaître le génome Marqueurs moléculaires Cartes génétiques Sélection assistée par marqueurs Génomique Exploiter la diversité Sauvetage d’embryons interspécifiques Fusion de protoplastes Transgénèse Diminuer la durée de création Haplodiploïdisation Culture d’embryons immatures Les étapes de la sélection Recenser le matériel génétique existant Observer, choisir et croiser le matériel de départ Créer des lignées ou les parents de l’hybride Fixer les caractères Évaluer la valeur agronomique et technologique de la nouvelle variété Inscrire la nouvelle variété Biologie moléculaire Biologie Cellulaire Source : GNIS Transgénèse Connaître le génome Exploiter la diversité Accélérer la créaKon
  17. 17. 17 Méthodes de micropropaga3on in vitro pousse axillaire Mul8 Des applications de la Le sauvetage d’embryons La culture de méristèmes La multiplication conforme embryon méristème noeud 3plica3on in vitro de 3ssus végéta3fs -­‐ Sauvetage d’embryons ; tomate, tournesol, courgege, laitue,… -­‐ Culture de méristèmes: pomme de terre, arKchaut, dahlia, vigne, ail, fraisier,… -­‐ Microbouturage : figuier, séquoia, pins, eucalyptus, peuplier, merisier, framboise, vigne… -­‐ ApplicaKons -­‐ PropagaKon clonale (végétaKve) -­‐ MulKplicaKon rapide, gains de temps importants -­‐ ÉliminaKon de viroses (méristème et thermothérapie) -­‐ Autres techniques -­‐ Embryogenèse somaKque -­‐ ObtenKon et fusion de protoplastes et régénéraKon -­‐ HaploïdisaKon Source : GNIS Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  18. 18. Bref rappel historique sur les biotechnologies cellulaires 18 -­‐ Culture « in vitro » de cellules, de 3ssus et régénéra3on 1902 Découverte de la to3potence des cellules végétales, Haberland. 1930 Culture de Kssus végétaux 1939 culture indéfinie de cambium, Gautheret 1950 culture in vitro, développée par Morel et MarKn, sur la pomme de terre. 1952 assainissement par culture de méristème de dahlia, Morel et Mar3n 1957 rôle équilibre auxine/cytokinine dans le contrôle de la formaKon d’organes 1958, obten3on des premiers embryons soma3ques de caroie Reinert et Stewart 1960 première mulKplicaKon végétaKve in vitro de l’orchidée, Morel 1964 cultures de cellules sexuelles mâles chez le Datura par Guha et Maheshwari. 1965 culture de cellules végétales 1967 plantes haploïdes, Bourgin 1971 protoplastes de tabac 1978 premières fusions de protoplastes, par Melchers. Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  19. 19. 19 Exemples de bouturage et microbouturage Bouturage, Technique ancestrale : -­‐1100 ans, néolithique, figuier parthenocarpique,… Geranium, Rosiers, Groseillers…. Développement Industriel pour des plantes variées: Rosiers, Orchidées, FruiKers… Adapté de Y. Chupeau microbouturage et culture de méristème apical : Guérison de Dalhia ageints d’une maladie à virus Morel et MarKn, 1952. Extension à la pomme de terre, puis à de nombreuses plantes… Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  20. 20. Embryogénèse Soma3que et Sauvetage d’embryons 20 L’embryogenèse soma3que -­‐ Exemple, producKon de plants de conifères Lelu et Thomson 2000 / M. jullien Sauvetage d'embryons -­‐ Sauvetage par culture in vitro d’embryons non viables. -­‐ Exemple, embryons obtenus par croisements entre tournesols culKvés et sauvages. -­‐ Les espèces sauvages de tournesol = réservoir de résistances aux pathogènes (résistant au mildiou et au ScleroKnia) x Adapté de F. Nogué Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  21. 21. 21 21 L’ o b t e n t i o n d e p ro t o p l ast es Cellules végétales débarrassées de leur paroi pecto-­‐cellulosiques (cf H. H.) Pa r e nch yme d e j e u n es f e u ill es Di g est i o n e n z yma t i q u e d e l a p a ro i E n z y mes d e l yse d e l a p a ro i p ect oce ll u l osi q u e A j o u ts d ’ é l éme n ts st a b ilisa n ts sucres, sels minéraux Susp e nsi o n d e p ro t o p l ast es Fusion, transforma3on, régénéra3on Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  22. 22. 22 Applica3ons : Fusion de protoplastes et régénéra3on La maîtrise de la culture et de la fusion de protoplastes (A) et de la régénéra3on de colza (B) ont permis la régénéra3on de CYBRIDES (CY), hybrides cytoplasmiques. Cege approche a permis par exemple de transferer la stérilité mâle Ogura portée par l’ADN mitochondrial (O) au colza normal (N). Disposer d’une stérilité mâle chez le colza facilite la créaKon des hybrides F1. G. PelleMer, INRA Versailles Adapté de M. Jullien A B C O CY N Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  23. 23. Etamines Pollen 23 Haplo(diplo)ïdisa3on L’haploïdisaKon est l’obtenKon d’ individus provenant d’un seul parent (sans fécondaKon). Après un doublement (spontanée ou induit ou «diploïdisaKon») du nombre de chromosomes cela conduit à des lignées parfaitement homozygotes 2n (« pures »). Elle permet donc des gains de temps et d’efficacité considérables pour la fixa3on de caractères par rapport à des cycles classiques de croisements. From Y. Chupeau Haploïdisa<on spontanée polyembryonie (ex: asperge), androgenèse in situ (ex: tabac) et gynogenèse in situ (ex: maïs, colza). Androgenèse, à par<r des gamètes mâles (plus de 150 espèces) • formaKon d’embryons à parKr d’étamine de Datura (1966, Guha et Maheswari) • ObtenKon de plantes haploïdes à parKr de grains de pollen de tabac (1967 Nitsch et Bourgin) • Datura, Tabac, Riz, Colza, Orge, Blé, Pomme de terre, Maïs,... Gynogenèse -­‐ Culture d’ovaires/ovules (1976) : Orge, Blé, Tabac, Riz, Gerbera, Maïs, Begerave,… -­‐ Croisements interspécifiques (1964) : Pomme de terre, Orge, Melon, Blé, Luzerne,... -­‐ UKlisaKon de pollen irradié (1983) : Orge, Blé, Pétunia, Melon, Caroge, Concombre, Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  24. 24. Les biotechnologies dans un programme de sélection 24 La génomique dans l’améliora3on Les biotechnologies Les Séminaire Biotechnologies -­‐ 9 et 10 février 2012 Biologie Cellulaire Connaître le génome Marqueurs moléculaires Cartes génétiques Sélection assistée par marqueurs Génomique étapes de la sélection Recenser le matériel génétique existant Observer, choisir et croiser le matériel de départ Créer des lignées ou les parents de l’hybride Fixer les caractères Évaluer la valeur agronomique et technologique de la nouvelle variété Inscrire la nouvelle variété ObjecKfs : Localiser et séquencer les gènes Etudier leur foncKon Les uKliser pour créer de la variabilité et comme marqueurs pour la sélecKon Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  25. 25. 25 Historique de l’étude des génomes et de l’ADN 1900. Mise en applicaKon des lois de Mendel sur l'hérédité 1911. NoKon de liaison généKque, Morgan, (Nobel 1933) 1953. DescripKon de la structure en double hélice de l'ADN Watson, Wilkins, et Crick (Nobel 1962) 1960. Découverte du code généKque Crick, Nirenberg, Mathaeri et Ochoa (Nobel, 1968) 1965. Découverte des enzymes de restricKon Aber, Smith et Nathans (Nobel 1978) 1973. ADN recombinant, Berg (Nobel 1980) 1977. Séquençage de l’ADN, Gilbert et Sanger (Nobel 1980) 1983. Clonage par amplificaKon in vitro (PCR), Mullis (Nobel, 1993) 1990 Co-­‐suppression, silencing et miRNA, (Mello, Fire, Nobel 2006) 49 La c a r t o g r a p h i e d e s ma rq u e u rs m Exemple de cart e géné tique de marqueurs RFLP che z la pomme Pr i nci p e d e d é t e rmi n a t i o n d e l a d ist a nc e g é n é t i q u e e n t r e d e u x l ocus A Parents homozygot es éloignés géné tiquement GP39 PSC CP49 CP65(a) GP85(a) GP1(b) GP17 Descendance F2 La distance génétique entre les deux locus exprimée en centiMorgan, PAL(d) A }est fonction du pourcentage - A B - a b Type parent al A B de recombinés a b - A b - aB }Type recombiné d Chromosome I CP100 Chromosome II Chromosome III Chromosome IV Chromosome V Chromosome VI Chromosome VII GP93 CP65(b) GP22 CP43(d) PAT(a) CP16 CP94(a) GP36(b) GP92 GP36(a) GP74(GP74(c) GP40(a) CP14 WX GP87(d) GP33(b) GP91(b) GP35(e) PAL(f) GP91(a) pI471 CP20(a) PAL(b) GP97 PAL(c) GP85(GP74(PAL(a) CP53 GP87(c) Actin GP78 GP31 GP21 GP35(d) GP28(b) GP35(b) GP87(a) CP72 PAL(e) GP35(a) GP85(c) CP59 CP47 CP51(b) CP51(a) rbcS-1 CP15(a) GP1(a) GP25 GP80 CP6 4CL(a) CP32(d) GP1(c) GP74(a) GP74(d) GP23 GP35(c) CP70(c) rbcS-c CP48(a) CP15(b) GP86 GP33(a) GP98 GP26 rbcS-2 PC116 PAT(b) GP1(d) GP90 CP64(a) CP64(b) CP11 CP69(a) GP33(d) CP69(b) GP33(c) CP19 GP88 GP28(a) CP62 CP13 GS -­‐ L’ADN est le support moléculaire de l’informaKon généKque -­‐ C’ est une chaine (2 brins) de quatre molécules (A,T, G, C) -­‐ Il a une structure idenKque chez tous les organismes vivants -­‐ Sa réplicaKon et sa transmission induisent des variaKons -­‐ Une évoluKon permanente des génomes Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  26. 26. 26 Les génomes végétaux et leur séquençage > 20 Espèces végétales séquencées depuis 2000 Arabidopsis thaliana. -­‐ La taille des génomes végétaux varie de façon considérable Arabidopsis 140 Mb, Blé 16 000 Mb (malgré un nombre de gènes équivalent par génome ; ~ 30 000 gènes) -­‐ Une fracKon importante de certains génomes est consKtuée de séquences dites non codantes et/ou répétées (e.g. transposons). Cassava Sorghum Potato Tomato Maize Sugarcane Papaya Medicago Genome size of all published crop genomes (shown in green) and the five most important producKon crops with unpublished genome sequences (shown in blue).. Morell et al. (2012) Nature Review GeneKcs, 13:85-­‐96 Nature Reviews | Genetics 18,000 16,000 14,000 12,000 10,000 8,000 6,000 4,000 2,000 0 Genome size (Mb) No published sequence Published sequence Average angiosperm Cucumber Peach Strawberry Foxtail millet Cacao Rice Grape Pigeonpea Soybean Sugar beet Barley Bread wheat Orange Figure 1 | Crop genome size. Genome Lepiniec size of L. all Séminaire published Biotechnologies crop genomes -­‐ 9 et 10 (shown février 2012 in green) and the five most important production crops with unpublished genome sequences (shown in blue). The average angiosperm genome
  27. 27. 27 • Inventaire Bénéfices directes du séquençage des génomes: des gènes «puta3fs» grâce aux ouKls bioinformaKques • Etude de leur polymorphisme (génotypage), caractérisaKon des allèles • Etude de l’expression de ces gènes (puces à ADN, ESTs etc…) • SimplificaKon du lien entre phénotype et gène impliqué (marqueur) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 From M. Caboche
  28. 28. 28 Iden3fica3on de gènes par comparaison des génomes 51 La cartographie comparée Amidon-Waxy Hauteur des plantes Grain rouge Absence de ligule Génome de l’espèce : Blé 1 Maïs Date de Riz floraison Numéro 6 5 du chromosome Zone de présence d’un caractère : Source : Devos et Gale, 1997 X Basée sur la conservaKon de la co-­‐localisaKon / de l’ordre des loci homologues le long des chromosomes (synténie) due à la parentée évoluKve des génomes Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  29. 29. U3lisa3on de marqueurs moléculaires pour la selec3on 29 - Il est beaucoup PRECIS et RAPIDE de suivre un caractère avec un marqueur moléculaire qu’à partir du phénotype (mesure indirecte et relative du caractère) - Exemple de l’introgression du gène Bt d’une lignée donneuse dans une lignée cultivée Phenotype: résulte de l’expression d’un caractère et de son interacKon avec l’environnement Photo credit LemnaTec; Anderson, L.K.et al.. (2006). La sélection assistée par marqueurs Exemple de l’introgression du gène Bt Chromosome I CG100 CG161 CG259 CG363 CG320 Bt CG415 CG263 CG378 CG264 CG489 CG324 CG312 CG267 CG143 CG246 Back-cross 1 Chromosome I CG100 CG161 CG259 CG363 CG320 CG415 CG263 CG378 CG264 CG489 CG324 CG312 CG267 CG143 CG246 Bt Back-cross 2 Chromosome I CG100 CG161 CG259 CG363 CG320 CG415 CG263 CG378 CG264 CG489 CG324 CG312 CG267 CG143 CG246 Back-cross Lignée élite Source : GNIS Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  30. 30. + simples et faciles à caractériser, changement d’un nucléoKde 30 U3lisa3on de marqueurs moléculaires pour la caractérisa3on de loci d’intérêt Deux grandes approches pour établir le lien entre un phénotype et un génotype (des allèles) Le principe est toujours d’étudier la co-­‐ségréga3on Etude de liaison, en descendance de 2 parents connus entre un phénotype et des marqueurs ADN Géné3que d’associa3on En uKlisant la diversité généKque naturelle QTL (QuanKtaKve Trait Loci) LD (Linkage Desequilibrium) -­‐ Deux types d’évolu3ons importantes concernent -­‐ Développement de marqueurs (SNP), l’uKlisaKon de puces de génotypage très denses et/ou le débit du “re-­‐séquençage”. Voir Morell et al. (2012) Crop genomics : advances and applicaKons, Nature Review GeneKcs -­‐ la généra3on d’un nouveau type de popula3ons “intermédiaires” qui combinent celles présentées (croisements de parents mulKples) -­‐ Ouvrent la voie à des approches plus globales de sélec3on génomique (combinaisons d’allèles) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  31. 31. 31 Les origines des muta3ons et leurs u3lisa3ons -­‐ Les mutaKons s’accumulent en permanence avec les généraKons (erreurs de réplicaKon et/ou de réparaKon de l’ADN) -­‐ Cege accumulaKon peut-­‐être sKmulée par la présence d’agents mutagènes -­‐ biologiques (inserKon de retrovirus, transposons), -­‐ physiques (rayonnements), ou chimiques et -­‐ Et l’échange de matériel géné3que avec d’autres espèces -­‐ Les mutaKons sont de nature diverse • AAATGCATAAAA TGCTAGGTCCGCCGATATATAACCC Séquence ancestrale • AAATGCATAATA TTCTAGGTCCGCCGATATATAACCC Ponctuellle • AAATGCATAAAA TGCTAGGT-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐ATATATAACCC DéléKon • AAATGCATAAAA TGCTAGGTCCGCCGGGCGGCCCATATATAACCC InserKon • Elles consKtuent la base de la sélecKon Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  32. 32. Exemple de muta3ons spontanées sources de diversité 32 Chou-fleur Romanesco Bruxelles Chou cultivé Chou sauvage Broccoli Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  33. 33. Acquisi3on de gènes par croisements interspécifiques : 33 Exemple de la tomate 10 % du génome (3000 gènes) des tomates culKvées proviennent de croisements avec d’autres espèces L. esculentum L. pimpinellifolium* L. cheesmanii* L. parviflorum L. chmielewskii L. chilense L. hirsutum* L. pennellii* L. peruvianum* From www.eu-­‐sol.net Lycopersicon ancestral Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  34. 34. 34 Les croisements interspécifiques spontanés, le blé Triticum urartu Ae. Section Sitopsis Triticum æstivum Génome A Génome B Génome D Blé dur Blé tendre Espèces créées par croisements interspécifiques spontanés : blé, hexapolyploïdes cotonnier, colza, moutarde brune, fraisier, tabac, peuplier, pêcher-­‐amandier,… Adapté de G. PelleKer Triticum aestivum Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  35. 35. Polyploïdisa3on, une source importante de diversité Figure 1 -­‐ Schema3c phylogene3c tree of flowering plants. BR1 – monocots+eudicots duplicaKon; BR2 – Eudicot-­‐wide duplicaKon; BR3 – Core eudicot-­‐wide duplicaKon; BR4 – Rosid-­‐wide duplicaKon. Y Jiao et al. (2012) A genome triplicaKon associated with early diversificaKon of the core eudicots 35 Genome Biology 2012, 13:R3 C’ est une duplica3on du génome Peut être naturelle Caféier arabica (4X=44), Dactyle (4X=28), Luzerne (4X=32)… • Des plantes aujourd’hui considérées comme diploïdes sont d’anciens tétraploïdes. Ex Maïs, vigne, Peuplier, fraisier • Mise sen évidence d’au moins 3 duplicaKons successives chez les dicotylédones Peut être induite induite: 1937, Blakeslee découvre l’acKon de la colchicine Est à l’origine de très nombreuses muta3ons -­‐ Remaniements chromosomiques -­‐ InserKons et déléKons -­‐ AcKvaKon de transposons -­‐ Dérive rapide / néofoncKonalisaKon (baisse de la pression de sélecKon -­‐ RégulaKons épigénéKques Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  36. 36. 36 Les transposons Liseron Sélection vers 1940, insertion d’un helitron, from Choi et al., Plant Journal 2007) Choux fleur Sélection vers 1975, insertion d’un retrotransposon (Lu et al., Plant Cell 2006) Photo: www.acenologia.com insertion d’un retrotransposon (Kobayashi et al., Science 2004) -­‐ Ce sont des éléments généKques mobiles responsables de nombreuses mutaKons sélecKonnées en amélioraKon Adapté de F. Nogué Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  37. 37. 37 PA C HIAM S ER AUP FOR TUNA B ESAR 15 MAR ONG UNKNOWN PA R OC B LUE ROSE B PI 76 R EX OR O SUPR EME KIT C HILI S AMB A original rice genome S INAWPA GH UNKNOWN Mutations C INA LA T IS A IL TEX AS R SB R GEB 24 PA TNA B LUE B ONNET PETA DGWG C P231 S LO 17 B ENONG IR 86 C P SLO 17 S IGA DIS IR 95 Inversions IR 127 IR 8 C HOW S UNG IR 262 IR 1103 TADUKAN V E LLA IKA R IR 400 T S A I Y UA N C HUNG IR 1006 MUDGO TETEP IR 1163 IR 238 TN1 IR 1416 IR 1641 IR 1402 IR 22 TKM6 IR 746A IR 1704 O. nivara IR 1870 IR 1614 IR 2006 IR 579 IR 747 IR 24/ IR 661 IR 1721 IR 773 A B PI 121 GAM PAI IR 1915 B IR 1833 GAM PA I 15 IR 1561 IR 1737 IR 1916 IR 833 IR 2040 IR 2146 IR 2055 IR 2061 IR 5236 IR 5338 Ultimate Landraces GAM PAI TSAI YUAN CHUNG IR 5657 DEE GEO WOO GEN BENONG CINA Unknow n IR 18348 LATISAIL CHOW SUNG TADUKAN MUDGO IR 64 KITCHILI SAMBA TETEP PA CHIAM SINAWPAGH SERAUPBESAR 15 UNKNOWN (JAPANESE) NAHNG MON S 4 O. nivara (IRGC 101508) VELLAIKAR MARONG PAROC C O 18 NA HNG MON S 4 NMS 4 IR 64 è Recombinations Translocation s Deletions è Accumula3on de ces muta3ons pour créer un riz cultivé Slide courtesy of Ingo Potrykus Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  38. 38. 38 U3lisa3on de la mutagenèse La mutagenèse ar3ficielle est très u3lisée depuis le milieu du 20ème et la démonstraKon de l’héritabilité des altéraKons (mutaKons) provoquées par les radiaKons (1927), puis la diversificaKon des agents mutagènes, physique (rayons, γ, UV, X), chimiques -­‐ En 2000, + de 2200 variétés recensées par la FAO sont issues de mutagenèses ar3ficielles 1948, Begerave mutaKon monogerme (démariage inuKle) 1986 Pois proteagineux mutaKon « afila » facilitant la récolte 1930 Rose Couleur orangée ajoutée à la palege de couleurs 1984 Pamplemousse Aspermie, Couleur rouge de la pulpe 1985 Cerisier AutoferKlité 1970 Riz Qualité du grain 1976 Tournesol richesse en acide oléique 1985 Forsythia Port compact + Orge à brasserie semi-­‐nanisme (plus de 150 variétés) + Colza richesse en acide oléique. / RéducKon acide linolénique, glucosinolates -­‐ Une nouvelle méthode, le TILLING (Targeted Induced Local Lesion IN Genome) permet de faire de la « généKque réverse », c’est à dire d’idenKfier des mutants affectés dans un gène donné (dont on connaît la foncKon) et pour lequel on cherche de nouveaux allèles Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  39. 39. 39 Conclusions • Les mutaKons sont donc à la base de l’évoluKon, de l’adaptaKon des espèces, de la domesKcaKon ou de la sélecKon. • Les données génomiques montrent que le monde vivant consKtue un pool de gènes qui évolue en permanence • La quasi unicité du code généKque permet des transferts « horizontaux » nombreux et variés -­‐ Cas des α-­‐protobactéries ⇒ Mitochondries …⇒Champignons, Animaux -­‐ Cas des cyanobactéries (photosynthéKques) ⇒ Chloroplastes ⇒ Plantes Archaea J.R. Brown (2003) Nature Reviews GeneKcs Euryarchaeota Animals Plants Slime moulds Korarchaeota Crenarchaeota Low G+C gram positives a b Thermotogales Eukaryotes Fungi Microsporidia Entamoeba Apicomplexa (such as Plasmodium) Euglena c 'Cenancestor' Kinetoplasta (such as Trypanosoma) Parabasalia (such as Trichomonas) Metamonda (such as Giardia) Mitochondrial loss Séminaire Biotechnologies -­‐ 9 et 10 février 2012 R E V I E W S Box 1 | The universal tree of life High G+C gram positives Bacteria δ/ε purples α purples γ/β purples Spirochaetes Fusobacteria Flexibacter/Bacteriodes Cyanobacteria Thermus Aquifex Putative origins of organelles Chloroplasts Mitochondria Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 In the late 1970s,Woese,Fox and co-workers15,16 pioneered the molecular systematics of prokaryotes. DENDOGRAMSbased
  40. 40. 40 Le Génie Géné3que naturel d’Agrobacterium Elysia chloroMca 0,5 mm LB ADN-T simple brin VirD2 Rumpho et al, 2008, PNAS,105(46) 17867 Agrobacterium tumefaciens AttR L’arrimage de la bactérie à la cellule végétale est contrôlé par les produits de quelques gènes du chromosome bactérien Chv CelA VirG+PO 4 Gènes vir Plasmide Ti ADN-T RB Vir B VirD2 VirE2 ADN-T VirA Oses, acides organiques, phénols... Paroi végétale Cellule végétale blessée VirE2 Opine Auxine Cytokinine Cellule végétale viable et activée Membrane nucléaire Chromosome végétal ADN-T double brin Noyau végétal Chloroplaste Y. Chupeau (2001) M&S Figure 3. Un processus naturel de transfert d’ADN. Les agrobactéries ont développé la capacité d’exciser une portion d’un plasmide particulier (Ti), puis de l’exporter en l’adressant efficacement aux noyaux de cellules végé-tales. Après l’ancrage, par les produits de gènes chromosomiques, d’une agrobactérie sur la paroi d’une cellule A. rhizogenes sur Kalanchoe, INRA A. tumefaciens sur Tabac, Y. Chupeau (2001) M&S Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  41. 41. 41 Plan • Introduc3on – Enjeux sociétaux et amélioraKon des plantes – De la domesKcaKon aux praKques actuelles • Les apports des biotechnologies – Biologie cellulaire et régénéraKon – Biologie moléculaire et Génomique – CréaKon et uKlisaKon de la biodiversité moléculaire • La transgénèse – Bases cellulaires et moléculaires de la transgénèse – Exemples d’uKlisaKons potenKelles – Etat actuel des cultures • Conclusions Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  42. 42. 42 Bases théoriques de la transgenèse • Universalité du code génétique: • Rend possible l’utilisation de la séquence d’un gène quelle que soit son origine: plante, bactérie, animal • Existent des vecteurs de transfert de gènes • Font pénétrer un fragment d’ADN dans la cellule et le génome végétal • Biologique (agrobacteries, virus) • Physiques (biolistique, injection, électroportation), • Chimiques (PEG, liposomes) • Totipotence cellulaire : • Rend possible la régénération de plantes entières à partir d’une cellule (pas forcément nécessaires avec certains vecteurs biologiques) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 adapaté de C. PanneKer
  43. 43. 43 Historique de l’ingénierie géné3que végétale A. rhizogenes sur Kalanchoe, INRA 1907, Agrobacterium tumefaciens agent de la galle du collet 1968, Transfère d’informaKon et producKon d’une opine (G. Morel) 1975, Plasmide Ti porteur du principe tumoral (Schell, Van Montagu) 1977, Transfert d’ADN du plasmide Ti dans la cellule végétale (Chilton, Nester) 1982, Plantes transformées par exploitaKon d’A. rhizogenes (Chilton, Tempé) 1983, Tabacs transgéniques résistants à un anKbioKque (Van Montagu et Schell / Bevan, Flavell and Chilton) 1984, transfert direct de gènes dans des protoplastes et régénéraKon, (Paskowski, Caboche) 1985, Premiers essais en champ de plantes transgéniques aux USA 1986, Premières plantes résistantes à un herbicide 1987/1993 TransformaKon «in planta» d’Arabidopsis (Feldman, PelleKer) 1994, 1er PGM mis sur le marché (Tomate FlavSav) Calgene 1995, Mise sur le marché de soja, maïs et coton transgénique aux USA. 1998, AutorisaKon de vente de 3 variétés de maïs en France, qui devient le premier pays européen à culKver des PGMs Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  44. 44. 44 Les étapes de la transgenèse 27 Le s é t a p e s d e l a t r a nsg é n è s e Id e n t i f i e r u n g è n e d ’ i n t é r ê t su r u n o r g a n isme d o n n e u r bact érie, plant e… Tr a nsf é r e r l e g è n e Ré g é n é r e r E v a l u e r l ’ e x p r e ssi o n d u g è n e Inco r p o r e r p a r d e s cro is eme n ts d a ns u n e v a r i é t é co m me rci a l e Tr a nsf o rma t i o n b i o l o g i q u e Tr a nsf e r t d i r e ct Iso l e r l e g è n e d ’ i n t é r ê t In t é g r e r l e g è n e d ’ i n t é r ê t d a ns u n e co nst r uct i o n g é n é t i q u e Mu l t i p l i e r l a co nst r uct i o n g é n é t i q u e microparticules Agrobact erium enrobé es d’ADN Sé l e ct i o n d e s c e l l u l e s t r a nsf o rmé e s Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 Source : GNIS
  45. 45. www.labomics.com Grizot et al. (2010) NAR 45 Limita3on de la transgénèse Le site d’inserKon dans le génome reste aléatoire (effet de posiKon sur l’expression du transgène ou créaKon de mutaKons). Les évènements de transformaKon sont donc parfois similaires à des mutaKons «classiques». Il serait uKle de pouvoir cibler les modificaKons Des technologies d’ingénierie moléculaires sont en cours de développement Les Nucléases à domaine en doigt de Zn (ZFNs) Les Méganucléases Les protéines TALEs (TranscripKon AcKvator-­‐Like Effectors) M. Mahfouz and L. Li (2012) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 Figure 1. Representation of TALEs structural features and the possible functional domains to generate
  46. 46. Les domaines d’application de la transgénèse L’agronomie • La résistance à des insectes • La résistance à des maladies • La résistance à des herbicides L’alimentation • Les qualités nutritionnelles • La maturation des fruits • La transformation agro-alimentaire L’industrie Les applications de la transgénèse • Les pâtes à papier • Les huiles industrielles • Les colorants La santé • Les produits sanguins • Les vaccins • Les protéines humaines Cf Ho‡e H. 36 Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012 46
  47. 47. 47 ApplicaKons agronomiques : Les maladies et les ravageurs => +25% pertes des récoltes Wheat infected with wheat stem rust Puccinia graminis And from G. PelleKer Fusarium sur blé Oomycetes Bacteria Insects Wheat infected with root Fungi knot nematode Epi de maïs Infecté Larve de Pyrale par Fusarium Tige de maïs Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  48. 48. 48 Jaunisse nanisante (orge) PLRV, P de terre Les stratégies an3virales sont parmi les premiers exemples de plantes transgéniques (1986) Une stratégie générale consiste à acKver les mécanismes de contrôle des virus en faisant produire à la plante transgénique des porKons du génome du virus, comme le gène codant l’enveloppe de ce virus Premier essai en champs, 1987, résistance à un virus de la Tomate From G. PelleKer Coat Protein Mediated Resistance 1986, From R. Beachy Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  49. 49. Autre exemple, les résistances aux insectes Très peu de solu3on conven3onnelle (ex. Résistance aux pucerons chez le melon. Limité à 49 cege espèce) Solu3ons transgéniques existent -­‐ ProducKon par la plante d’une protéine de B. thuringiensis toxique pour les larves de lépidoptères. From G. PelleKer and R. Beachy Pyrale du maïs Rem ProtecKon simultanée contre les mycotoxines de fusarium (surinfecKon) Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  50. 50. 50 Résistance / tolérance aux stress abio3ques -­‐ Tolérance aux métaux toxiques -­‐ Stress hydrique, de nombreux gènes candidats testés Tomates résistantes au sel (200 mM NaCl) Surexpression d’un anKport Na+ Concentre le Na+ dans la vacuole Zhang& Blumwald -­‐ Nature Biotech, 2001 transgéniques WT Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  51. 51. 51 Améliorera3on de la qualité La qualité industrielle ou nutri3onnelle -­‐ AugmentaKon de la teneur en huile de la graine (+40%) de colza, par sur-­‐expression d’une glycérol 3P deshydrogénase de levure, Vigeolas et al. 2007, Plant Biotech J.) -­‐ Doublement de la teneur en sucre de la canne à sucre par expression d’une isomérase bactérienne qui transforme le saccharose en iso-­‐ maltulose qui se trouve séquestré, Shiromani et al., 2011, Plant Biotech J.) -­‐ L’adaptaKon de la biomasse lignocellulosique à ses usages (cf. H. H.) -­‐ La modificaKon de la structure de l’amidon (cf. S. B.) -­‐ Autres -­‐ ModificaKon de la nature et de quanKté d’acides gras… -­‐ producKon de flavonoïdes chez le riz -­‐ inhibiKon des allergènes de tomate -­‐ riz riche en provitamine A (riz doré) -­‐ Maïs enrichi en lysine et tryptophane (par sélecKon ou transgénèse) … Wild-type (top) and antioxidant-enriched tomatoes β-carotene makes the rice look golden Iron-enriched rice Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  52. 52. Figure 2 Carotenoid enhancement endosperm by transformation and crtI. (a) Schematic used to generate transgenic T-DNA comprised the rice (Glu) and the first intron gene from castor bean functionally fused to the chloroplast transit peptide phytoene synthase from species (psy), with a nos selectable marker cassette maize polyubiquitin (Ubi1) Lepiniec hygromycin resistance 52 (b) Photograph of polished Enrichissement du riz en provitamine A : le riz doré Expression de 2 gènes, Psy de maïs et crt1 d’Erwinia (Paine et al. 2005) -­‐ Introgression en cours dans des variétés culKvées et première dérégulaKon agendue aux Philippines en 2012/2013. LB SSUcrtI nos Glu Psy nos nos I Ubi1 hpt Adapté de E. Guiderdoni Wild Type Np Psy/crtI Zm Psy/crtI L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  53. 53. Research in Cologne. In Amflora, the gene encoding the key enzyme for the synthesis of amylose, the granule bound starch synthase (GBSS), was switched off using the so-called antisense method through which a mirrored copy of the GBSS gene was reinserted into the genome of the potato. Starch Potato 20% > 98% Amylose 2010-03-30 page 5 of Apart from the intended change in the composition of its starch, Amflora maintains all the 53 Autre exemple d’applica3on industrielle Pomme de Terre produisant Uniquement de l’amylopecKne (AmfloraTM, BASF, InacKvaKon de la Granule Bound Starch Synthase) Ø Iitérêts industrielles : Ø Epaississant (amidon de haut poids moléculaire, de faibles teneurs en lipide et protéines), transparent,, bonne solubilité, characteristics of its mother variety, the starch potato variety Prevalent. Ø Papier, adhésifs, texKles, construcKon, cosméKques Amflora Starch potato Potato starch Content 100% Amylopec3n 80% Amylopectin Amylopectin Switched off gene for key enzyme of amylose synthesis Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  54. 54. 54 Le développement du “molecular farming” Nombre de producKon de protéines pour la santé et l’industrie Lo ̈ıc Faye and Veronique Gomord (2010) Plant Biotechnology Journal Volume 8, Issue 5, pages 525-­‐528, Publishing activity in molecular farming classified per product (original papers). *From January to August 2009. Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  55. 55. 55 Bilan: les OGM dans le monde (2011) -­‐ 160 millions d’hectares d’OGM culKvées (+ 10% surfaces culKvées mondiales, + 8% /2010), -­‐ 29 Pays au total, 50% dans les PED . USA (69 millions ha), Brésil (30), ArgenKne (24), Inde (11), Canada (10), Chine (4), Paraguay (3), Pakistan (3) Afrique du Sud (2 millions) -­‐ La Chine invesKt 2,4 milliards d’euros sur 12 ans dans un programme massif «OGM» C. James ISAAA 2012 Source ISAAA 2011 Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  56. 56. 56 11 plantes cul3vées en 2011, -­‐ 4 principales soja (75% en PGM), coton (82 %), maize (32%), colza (26%), -­‐ mais aussi la begerave sucrière, luzerne, Papaye, courge, peuplier, poivron doux, tomate, pomme de terre, + riz en cours et 26 espèces avec des évènements approuvés Global Area of Biotech Crops, 1996 to 2011: Crop (Million Hectares, Million Acres) Global Area of Biotech Crops, 1996 to 2011: By Crop (Million Hectares, Million Acres) Séminaire Biotechnologies -­‐ 9 et 10 février 2012 Surfaces culKvées en Millions hectares I S A A A 80 70 198 173 60 148 50 124 40 99 30 74 20 49 10 25 0 Soybean Maize Cotton Canola I S A A A 80 70 60 50 40 30 20 10 2009 2010 2011 Soybean Maize Cotton Canola 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 Acres Source: Clive James, 2012 I S A A A 0 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 M Acres 0 Source: Clive James, 2012
  57. 57. 57 Conclusions -­‐ Les espèces évoluent conKnuellement et les hommes ont mis à profit cege variabilité pour adapter les végétaux culKvés à leurs besoins. Il sera toujours nécessaire d’améliorer les plantes pour répondre à l’évoluKon des contraintes bioKques par exemple (maladies, prédateurs) et assurer des rendements minimum. De nouveaux objec3fs de qualité et de durabilité s’y ajoutent. -­‐ Les méthodes classiques de sélec3on restent nécessaires, en parKculier pour les caractères quanKtaKfs et mulKgéniques. Le développement de la génomique facilite et augmente la puissance de ces approches et ouvre de nouvelles perspec3ves de sélec3on « génomique ». -­‐ Les biotechnologies permegent d’élargir la base géné3que u3lisable (ex gènes bactériens ou de levures) et, en faisant progresser les connaissances, d’envisager une véritable ingénierie géné3que. Elles permegent également de réduire considérablement le temps d’introgression des caractères d’intérêt dans de nombreuses variétés localement adaptées . -­‐ Les biotechnologies ne modifient pas les contraintes classiques qui s’imposent à l’amélioraKon des plantes et à l’agriculture (mainKen de la biodiversité, appariKons de résistances aux herbicides, maladies, prédateurs ou d’effets non agendus). Mais elles offrent des ouKls supplémentaires pour y répondre. -­‐ Que cela soit pour l’amélioraKon convenKonnelle ou reposant sur les biotechnologies, la disponibilité/diffusion des ressources géné3ques reste un facteur clef et stratégique. Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012
  58. 58. 58 Remerciements • P. Colonna • M. Caboche • Y. Chupeau • M. Jullien • G. Pelletier • A. Bendahmane • B. Chaloub • B. Dubreucq • E. Guiderdoni • F. Nogué • C. Pannetier • M. Tepfer • collègues du laboratoire • INRA • J. Tempé • M.D. Chilton • M. Van Montagu • J. Schell • R. Beachy • GNIS (J. Greffier) • The Plant Cell • www.wikimedia.org Lepiniec L. Séminaire Biotechnologies -­‐ 9 et 10 février 2012

×