This document discusses the origins of the ancient Celts in Britain. It begins by noting genetic studies that suggest the main ancestors of modern Britons came from northern Spain. It then explores the technology of Celtic leather ships that could have enabled migration across the sea. The document presents archaeological and historical evidence linking Celtic populations in Britain, Brittany, and northern Spain. It examines genetic haplogroups and debates regarding mutation rates used for dating human migration. Overall, the document analyzes evidence supporting the theory that ancient Celtic populations in Britain originated from migrations across the sea from the northern coast of Spain.
Pulmonary drug delivery system M.pharm -2nd sem P'ceutics
The origin of the British - The Celts
1. Author:
Pablo Fernández Sierra
Tel.: +49 159 0219 6516
Email: pablo.fsas@gmail.com
23.8.2014 – 16.09.2015
The origin hypothesis of
The Celtic Britain
2. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
1
The origin of the Celtic Britain
Index:
1. Where are the British Celts, the Albion, from?
2. Starting considerations
2.1 The Celtic Leather Ship
2.2 Antiquity of the haplogroup and genetic mutation rate
2.3 The Basque are only in the Iberian Peninsula
3. Relationship between Britain, Brittany and Asturias-Cantabria (north
Spain)
4. The Roman References of the Albion
5. Archaeological Reference, The Prince of the Albion
6. The Navia Name
7. Celtic city of Coaña
8. Current genetic Mix in the Celtic northern Spain
9. Conclusion
3. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
2
1. Where are the British Celts, the Albion from?
Where are the British from?, where are the Albion from?, according to the genetic
studies of the Oxford University, from the Professor Bryan Sykes, the main part of
the current people of the British Islands are from the north of Spain,… so, how was
this possible?
Years after the Celtic tribes with steel arms were in the north of Spain, they
constructed small ships with wood and leather to cross the sea, fish and commerce.
The Celtic population of Ireland came from the north of Galicia, possibly from A
Coruña, but first where the Celtic population of England, where they came from?
2. Starting considerations
2.1 Ship Technology of the old Celtic people
An important part of every conquering migration per sea are the ships, and the Celtic
ships were a leather ship.
A description of the Celtic leather ship is found in the text from Cesar:
“Bigger units of this ship concept were used too by the Celtic Veneti in current
Bretaña (France) in the battle against Cesar and Rome. The Legio cut the rope of the
sail, and the Venetos fleet suffered a massive disaster, and the Gaul-Veneti were
conquered after the naval battle of the Golf of Quiberon 56 B.C.. (description from
Cesar) “
The naval Battle against the Celtic leather ships of the Veneti of Brittany in France:
Caesar.Bellum Gallico. III.13-14
For their ships were built and equipped after this manner. The keels were
somewhat flatter than those of our ships, whereby they could more easily
encounter the shallows and the ebbing of the tide: the prows were raised very
high, and, in like manner the sterns were adapted to the force of the waves and
storms [which they were formed to sustain]. The ships were built wholly of oak,
and designed to endure any force and violence, whatever; the benches which
were made of planks a foot in breadth, were fastened by iron spikes of the
thickness of a man's thumb; the anchors were secured fast by iron chains
instead of cables, and for sails they used skins and thin dressed leather. These
[were used] either through their want of canvas and their ignorance of its
application, or for this reason, which is more probable, that they thought that
such storms of the ocean, and such violent gales of wind could not be resisted
by sails, nor ships of such great burden be conveniently enough managed by
them. The encounter of our fleet with these ships' was of such a nature that
4. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
3
our fleet excelled in speed alone, and the plying of the oars; other things,
considering the nature of the place [and] the violence of the storms, were more
suitable and better adapted on their side; for neither could our ships injure
theirs with their beaks (so great was their strength), nor on account of their
height was a weapon easily cast up to them; and for the same reason they
were less readily locked in by rocks. To this was added, that whenever a storm
began to rage and they ran before the wind, they both could weather the storm
more easily and have to secure in the shallows, and when left by the tide
feared nothing from rocks and shelves: the risk of all which things was much to
be dreaded by our ships.
Caesar, after taking many of their towns, perceiving that so much labor was
spent in vain and that the flight of the enemy could not be prevented on the
capture of their towns, and that injury could not be done them, he determined
to wait for his fleet. As soon as it came up and was first seen by the enemy,
about 220 of their ships, fully equipped and appointed with every kind of
[naval] implement, sailed forth from the harbor, and drew up opposite to ours;
nor did it appear clear to Brutus, who commanded the fleet, or to the tribunes
of the soldiers and the centurions, to whom the several ships were assigned,
what to do, or what system of tactics to adopt; for they knew that damage
could not be done by their beaks; and that, although turrets were built [on their
decks], yet the height of the stems of the barbarian ships exceeded these; so
that weapons could not be cast up from [our] lower position with sufficient
effect, and those cast by the Gauls fell the more forcibly upon us. One thing
provided by our men was of great service, [viz.] sharp hooks inserted into and
fastened upon poles, of a form not unlike the hooks used in attacking town
walls. When the ropes which fastened the sail-yards to the masts were caught
by them and pulled, and our vessel vigorously impelled with the oars, they [the
ropes] were severed; and when they were cut away, the yards necessarily fell
down; so that as all the hope of the Gallic vessels depended on their sails and
rigging, upon these being cut away, the entire management of the ships was
taken from them at the same time. The rest of the contest depended on
courage; in which our men decidedly had the advantage; and the more so,
because the whole action was carried on in the sight of Caesar and the entire
army; so that no act, a little more valiant than ordinary, could pass unobserved,
for all the hills and higher grounds, from which there was a near prospect of
the sea were occupied by our army.
Celtic river transport. The Golden Boat from Broighter Hord. I century BC
5. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
4
Reconstruction of an ancient Irish currach. Currach made of wicker work and covered
with 3 cow hides. It is capable of carrying 10 people
Currach- boat with a wooden frame, over which animal skins or hides were once
stretched.Currachs could reach the size of larger -- 15 to 20 metres long and cargo
capacity of 5-10 tones and perhaps four to five metres in beam. We know this
because in the winter curraghs were often turned upside-down, placed on a low
stone foundation wall and lashed down tightly with ropes, to form shelters for the
crew. There are many boats-shaped foundations of this size in Britain, especially in
Scotland and the northern isles.
The Breogán, a
reconstruction of a
Celtic leather ship in
Galicia, Spain.
6. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
5
Archaeology Museum of Castillo de San Antón de A Coruña (Spain), reconstruction:
Celtic leather boat of the north of Spain (El Breogán).
Small leather ship in Estaca de Bares Test of a Celtic leather ship in Borna, Spain
Reference: “Naves celtas”. Reflexiones en torno a las primeras embarcaciones
cubiertas con `piel de buey. Logroño, 2008. 72 p. : il. cor ; 21 cm. ISBN
978‐84‐612‐3902‐3
7. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
6
2.2 Antiquity of the haplogroup and genetic mutation rate
The Haplogroup antiquity is in doubt, due to the different mutation rates
(reproductive cycles, diseases and mutagens, different haplogroup mutation
rates,…), resulting sometimes in huge time differences. Therefore, we are going to
leave out the mutation time of the different Haplogroup as an assessment in doubt.
I copy the next references about the Haplogroup antiquity dating conflict:
However debate has swung to and fro over the dating of haplogroups. Geneticists in recent years
have often used Zhivotovsky’s evolutionary effective dating method for Y-DNA, which adjusts the
calculated pedigree (genealogical) mutation rate, since in some populations the latter produced
unexpectedly late dates.17L.A. Zhivotovsky et al., The effective mutation rate at Y chromosome short
tandem repeats, with application to human population-divergence time, American Journal of Human
Genetics, vol. 74 (2004), pp. 50–61; L. A. Zhivotovsky, Difference between evolutionarily effective and
germ line mutation rate due to stochastically varying haplogroup size, Molecular Biology and
Evolution, vol. 23, no. 12 (2006), pp. 2268-2270.
Unfortunately, this ad-hoc adjustment seems generally misapplied, producing dating estimates two or
three times too old. For example Marcin Woźniak and colleagues point out that the pedigree mutation
rate for R1a1a1g [M458] is more consistent with the archaeological record for the Slavs.18M. Woźniak
et al., Similarities and distinctions in a Y Chromosome gene pool of Western Slavs, American Journal
of Physical Anthropology, vol. 142, no. 4 (2010), pp. 540-548.
A study of the Caucasus region found that genealogical estimates gave a good fit with the linguistic
and archaeological dates, while the evolutionary effective rates fell far outside them.19O. Balanovsky
et al., Parallel Evolution of Genes and Languages in the Caucasus Region, Molecular Biology and
Evolution, published online ahead of print 13 May 2011.
Another approach is directly genealogical. Bothsurnames and Y-DNA haplogroups are passed down in
the male line. A group of men with a surname of the same origin should have a common ancestor at
the time of surname development. One study found that they mainly did, using a mutation rate similar
to the genealogical rather than the evolutionary.20T.E. King and M.A. Jobling, Founders, drift, and
infidelity: the relationship between Y chromosome diversity and patrilineal surnames, Molecular
Biology and Evolution, vol. 26, no. 5 (May 2009), pp.1093-1102.
However, problems with the pedigree rate remain. Dating estimates will vary according to which
microsatellite loci are used, since some mutate faster than others. New approaches take this factor
into account, but are only very recently reaching publication.21G. B. J. Busby and C. Capelli,
Microsatellite choice and Y chromosome variation: attempting to select the best STRs to date human Y
chromosome lineages, paper read at the European Human Genetics Conference at Amsterdam May 28
– 31 2011; G. B. J. Busby et. al., The peopling of Europe and the cautionary tale of Y chromosome
lineage R-M269, Proceedings of the Royal Society B: Biological Sciences, published online before print,
August 24, 2011; C. Burgarella and M. Navascués, Mutation rate estimates for 110 Y-chromosome
STRs combining population and father–son pair data,European Journal of Human Genetics, vol. 19
(2011), pp. 70–75; W. Shi et al., A worldwide survey of human male demographic history based on Y-
SNP and Y-STR data from the HGDP-CEPH populations, Molecular Biology and Evolution, vol. 27, no. 2
(2010), pp. 385-393. Attempts to calibrate the human mtDNA clock are no less controversial.22B. M.
Henn et al., Characterizing the time dependency of human mitochondrial DNA mutation rate
estimates, Molecular Biology and Evolution, vol. 26 (2009), no. 1, pp. 217-230; Endicott et al.,
Evaluating the mitochondrial timescale of human evolution, Trends in Ecology and Evolution vol. 24,
no. 9 (2009), pp. 515-521; S. Rosset et al., Maximum-likelihood estimation of site-specific mutation
rates in human mitochondrial DNA from partial phylogenetic classification, Genetics, vol. 180
(November 2008), pp. 1511–1524; M.P. Cox,
8. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
7
Accuracy of molecular dating with the rho statistic: deviations from coalescent expectations under a
range of demographic models, Human Biology, vol. 80, no 4 (2008), pp.335-357; C.D. Millar et al.,
Mutation and evolutionary rates in Adélie Penguins from the Antarctic, PLoS Genetics vol. 4, no. 10
(October 2008).
To cap the confusion, a recent study found substantial variance in sex-specific mutation rates between
families,23D.F. Conrad et al., Variation in genome-wide mutation rates within and between human
families, Nature Genetics, Published online 12 June 2011 ahead of print.throwing a cloud of doubt
over all dating estimates.
Summary, man mutation is variable and very affected by “colonization events”,
women-mitochondrial mutation rate is higher and more stable, as its expansion:
Zhivotovsky LA, Underhill PA, Feldman MW.
Within a Y chromosome haplogroup defined by unique event mutations, variation in microsatellites
can accumulate due to their rapid mutation. Estimates based on pedigrees for the Y chromosome
microsatellite mutation rate are 3 or more times greater than the same estimates from evolutionary
considerations. We show by simulation that the haplogroups that survive the stochastic processes of
drift and extinction accumulate microsatellite variation at a lower rate than predicted from
corresponding pedigree estimates; in particular, under constant the total population size, the
accumulated variance is on average 3-to-4 times smaller.
The current El R1b1b2 is supposed now to appear between 3000-6000 B.C.
2.3 The R1b in Europe
The first groups of R1b were found in the 2000-3000 b.C. with the bronze expansion
from the East with the bulk of the R1a group. These individuals were isolated
individuals in every group found.
The R1b, dominant haplogroup in Western Europe can be separated in main groups:
• R1b German (R1b1a2a1a1 (M405/S21/U106) (S21 German, especially in northern
Germany, and no S28 is in north Germany)),
• The Celtic/Atlantique Europe (including north Spain) (R1b1a2a1a2f (L21/S145),). A
descendent is the R1b1a2a1a2f2 (M222 in Ireland)
• R1b1a2a1a2d (S28/U152) Celtic Italy/France/South Germany Celts
• DF 27 Basque and Iberian-Mediterranean
• the R1b Basque (R1b1c4 (old R1b1a2a2c) (M153) only Basque Land in Spain and
France and R1b1c6 (R1b1a2a2d) 19% of Basque land) and
As father of this lanes are:
• The R1b1b2 is probably from Western Turkey.
• The R1b1a1 is to the east, the Hazara of Pakistan 32% (mixture with Mongol and
Turk during Ghengis Khan invasion) (Askenazi) (Jazar is Hun-Arian origin) (Hun-
o/Hün-nü in Yue, until 93 d.C. attack of China; black Hun due to the mix with
Chinese) (The Mongol-C haplogroup occupied the place mixing with the remaining
Arian women) (current Kazakhstan is C-haplogroup, the Mongol expansion under
Genghis Khan). The last Arian Empire norther of China was the Yua-Yuan/JU-JU/Juan
Juan/RuanRuan (now called Rouran) destroyed by Qi and Zhou China in 552 a.C.,
and allow the expansion of a small subjugated tribe, the Göktürks (Q haplogroup)
(Turk origin).
• The R1b1a2a* is in Iran 10%, the Asirian 29%,…
• The R1b1a2a1a2 (P312) is the common father of the Atlantic, Ibero, Italo. The
German S21 and the P312 are “son” of the R1b1a2a1a. According to Myres et
al(2010) R-P312* is found highest in Iberia and Southern France.
9. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
8
• R1b1a2a1a2b (M153) origin of the “Basque” haplogroup and from the Mediterranean
of the Iberian Peninsula.
• R1b1a2a1a (L11/S127, L52, L151, P310/S129, P311/S128) Common father of the
German and Celtic R1 haplogroup in Europe.
2.3 The Basque are only in the Iberian Peninsula
In opposition to the hypothesis of Oppenheimer, the Basque genomic group, which
includes the
“M153 T->A 427 ttactgataatgccatattgttttg ttctcagacaccaatggtcct” (R1b1c4 aka
M153)
is only found in the Iberian Peninsula and Basque land, and mainly in the Basque
population. The absence of this Basque genetic mark in the British Islands is proof of
the Basque remaining only in the Iberian Peninsula and Basque land in France.
As a reference, I copy the next extract:
R1b1c4 aka M153
John McEwan
3rd June 2006 (typo revision 23 October 2006)
Background
M153 is a SNP that defines subclade R1b1c4 in the ISOGG 2006
http://isogg.org/tree/ISOGG_HapgrpR.html
Technical details
The SNP was described by Underhill et al (2000) as
M153 T->A 427 ttactgataatgccatattgttttg ttctcagacaccaatggtcct
Using May 2006 Golden Path and in silico PCR the following sequence was obtained
from Yq11.222. Attempts to retrieve it from DbSNP were unsuccessful and it most
likely does not have a dbSNP accession. The mutation was manually annotated below.
The T allele is ancestral.
>chrY:20165716-20166174 459bp TTACTGATAATGCCATATTGTTTTG
TTCTCAGACACCAATGGTCCT
TTACTGATAATGCCATATTGTTTTGgcttaatatcaggctaagtaaccac
agtattctgatttaaaaaaaaacatactagagagcaagtttattgacaaa
tctttaggaacttcaggtacagcatatgatttctgaactatgtgtgtaaa
taaggttttgtttattcaaatttaacacagggtagtctgtgtatgccttc
cgatttgatagctctaataaaacactttaatagtaccatatcaaataaat
tttatcatcatcgattttcttcttaatatgaaataacacatatttgtgat
ttttctaagagtcaaaatctcaaaaatcattttaggtataaaatataccc
cgaaagttttattttattccattttataattaatctgacttggaaagggg
aaaaaagctcaaagggtatgtgaaca[t/a]ttcattaagatAGGACCATTGGT
GTCTGAGAA
Occurrence
It was first described by Underhill et al (2000) where it was found in 7 people all
Basques. Bosch et al. (2001) described a further derived individual, Flores et al.
10. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
9
(2004) 6 individuals, Paracchini et al. (2003) 5 “Latino” individuals, Vallone and Butler
(2004) 1 “Caucasian” and Alonso et al. (2005) 18 individuals. In total 38 people have
been identified as derived for this SNP to date. Further details are shown in a summary
page of R1b SNP papers. Alonso et al. (2005) also tested 5 STR markers and Bosch et
al. (2001) 8 STR markers. Unfortunately Alonso et al. (2005) does not provide the
haplogroup for individual STR results, but Bosch et al (2001) did, and the modal values
they reported are shown below. No difference from the R1b modal was observed.
In summary M153 positive or derived individuals have been described in at least 6
studies. It has only been reported in the Iberian Peninsula or in people whose origin
was almost certainly descendants from that region. Its STR modal is the same as R1b.
Table 1. Modal values of R1b and R1b1c4 (M153) in FTDNA order and convention
haplogroup N DYS393 DYS390 DYS19 DYS391 DYS388 DYS389i DYS392 DYS389ii
R1b 13 24 14 11 12 13 13 29
R1b1c4 6 13 24 14 11 12 13 13 29
Another extract:
…to state the irish, welsh, and basque are closely or especially related is not true, as
two have their own group-specific SNP, and certain historical regions within wales have
unusually high frequency of E3b Hg.. and are not at all related, while the welsh R
population does NOT share the basque / irish SNP's..
Basque= R / SNP M153/H102
Ireland(and irish-invaded western scotland) = R SNP M222
Wales = no M153, little M222, pockets of lots of E3b
(with conflicting ancestral SNP's it is totally inaccurate.. WRONG... to claim they are
more closely related than other R populations..although this claim they are closer
genetically to one another would SEEM logical, the current SNP information disproves
the claim)
"Data obtained by "A Y Chromosome Census of The British Isles" show that the highest
levels of E3b were found
in areas with a known history of Roman settlement. In addition to Southwell, these
include Uttoxeter in the midlands,
Dorchester and Faversham in southern England, and towns in Wales, like Llangefni and
Llanidloes, where the Romans
established forts and mined for gold and lead."…
2.4 How was it possible?, the expansion force
A main drive in the expansion over other human groups are the technological-military
supremacy (iron was better, was abundant and cheaper). In this proposal the R1b
expansion is recent and due to the Iron use, and the Celtic expansion of the “P312”
was due to the improved Iron production technique, the “Celts” (Atlantic/Gaul) used
a “mining” system cooking the mud of the marsh of that colder age, and that method
was learnt from the Celtic by the German and Rome, and that was a Celtic expansion
limit to the south, and the reason behind the lost of the Iron-rich Basque Land.
This R1b Expansion was the European equivalent to the Bantu expansion in Africa.
11. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
10
3. Relationship between Britain, Brittany and Asturias-Cantabria
(northern Spain)
Due to the support of the celt from Gaul and Britain the Celtic Asturias and Cantabria
resists the Roman pressure until 19 b.B., and there was a close contact until the
Middle Age (even an hypothesis of the origin of the initial Hero Pelayo-Pelagius
starter of the Spanish “Reconquista is in Britain, other are from Asturias or Visigoth”.
After the Galia-France conquer, Cesar and Augusto conquered the remaining Celtic
from north of Spain (Asturias and Cantabria), owners of two (Cangas de Narcea and
Las Medulas) of the 4 gold mines in Rome Empire between 29 and 19 b..C.
As an example of the roman efforts to conquer Asturias and Cantabria:
“Sub occasu pacata erat fere omnis Hispania, nisi quam Pyrenaei desinentis
scopulis inhaerentem citerior adluebat Oceanus. Hic duae validissimae gentes,
Cantabri et Astures, inmunes imperii agitabant” (Lucio Anneo Floro)
Augusto conquered Asturias and Cantabria with 80.000 soldiers: against
Cantabria: the Legio IV Macedonica, the Legio I Augusta, the Legio II Augusta,
the Legio IX Hispana, the Legio XX Valeria Vitrix (by sea, embarked), and the
support of the Ala Augusta, Ala Parthorum, Cohors IV Thracum equitana and
Ala II Thracum ciuium Romanorum; against Asturias: Legio VI Vitrix, Legio X
Gemina, Legio V Alaudae, Ala II Gallorum and Cohors IV Gallorum.
(For comparison: Only 60.000 soldiers were sent to conquer Germania)
4. The Roman and classical references of the Albion in Asturias
The roman Gaius Plinius Secundus (Pliny the Elder) name the Albion Celtic tribe in
west Asturias (in Asturias: Albiones, cibarcos and egobarros), around Navia river
,Coaña, Pendía,…. In the Albion territory were the cities of Cariaca and Castro de
Chao de Samartin too.
http://www.parquehistorico.org/historia.php
The Greek Ptolomey called in the “Geographic tables” the Navia River as the Albion
river. Ptolomey used the Albion name for the British Islands too, and it is the oldest
name for the British Islands.
Albion is Albain in Irish
Albion is Alban in Welsh
Albion is Alba in Scottisch Gaelic for Scotland
12. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
11
5. Archaeological Reference, The Prince of the Albion
During the Roman times it was wrote a text in stone, recently found near Vegadeo in
Asturias (near Coaña and Navia river):
«XP NICER CLUTOSI Ɔ CARIACA PRINCIPIS ALBIONUM AN LXXV
HIC S EST»,
Nicer, (son) of Clutoso (of the castro/fortified city) of Cariaca,
(of the House) Prince of the Albion, of 75 years old, lies here.
(Another photo: http://www.nicer.es/bitacora/curiosidades/el-nombre-de-nicer/
The Stone is in the http://www.museoarqueologicodeasturias.com/ )
6. The Navia Name
Navia is a Celtic word, the same as Navy, and it is related to a navigable river or it is
related to a fleet, a Navy.
Navigable rivers were common on the coast of Portugal, Spain and France, and the
name Navy-Navia was not used to those rivers and places. Navia is navigable 6 km
(like Nalón, Miño, Bidasoa, Nervión, río Pas, Deva, Besaya, Eo (cerca de
Navia),Eume, Masma, río Grande do Porto, Mandeo, Tambre, Ulla, Verdugo, Lérez,…
in north Spain) . Navia has an old Shipbuilding tradition.
In the opposite a big fleet, a Navy, can be a good reason to remember a special
place with that name. The conquering feet, the conquering Navy of the Albion, with
Celtic soldiers from all the north of Spain (Galicia, Asturias and Cantabria) were
joined in Navia river around the 500 b.C./VI century B.C., near the important Celtic
city of Coaña in the Albion territory in Asturias.
13. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
12
7. Celtic city of Coaña
The important Celtic city of Coaña (Castro de Coaña) near Navia.
Coaña, a city of the Albion in Asturias. Near Coaña is the “playa del barco”
. (beach of the ship)
History of Coaña
http://www.parquehistorico.org/historia.php
http://www.spain.info/es/que-
quieres/arte/monumentos/asturias/castro_de_coana_parque_historico_del_navia.html
http://www.spain.info/es/reportajes/parque_historico_del_navia_ha_escogido_ya_su_historia.html
The research of Coaña as a pre-Roman Castro-City before century IV b.C., with
coincidence with the iron arrival to the British Islands, and before the “Broch”
construction (200-390 b.C.).
Reference:
http://www.solociencia.com/noticias/0801/23135903.htm
Using C14 the construction of the Celtic hot spring building is dated in the IV
century before Christ, therefore the Castro (Celtic city) is of an earlier time.
C14 detection was realized in the Beta Analytics Lab in Florida, USA. The
archaeologist Ángel Villa and Alfonso Menendez Granda lead the field works.
14. Author: Pablo Fernández Sierra Teléfono +49 159 0219 6516 Email: pablofers@hotmail.com
13
8. Current genetic Mix in the Celtic northern Spain
Since the Celtic age in the Celtic north Spain (Galicia, Asturias and Cantabria), there
was a considerable genetic mix.
There was the Roman Conquer, the Suebi in Galicia and the Conquest of the
Visigoths (Asturias and Cantabria in 588 a.C.), the short conquer of Galicia per the
Muslims, the “Reconquista” beginning in Asturias and Cantabria, the “high population
density politic” and “integration” of the Asturias Kingdom. For example, Alfonso II,
the first pilgrim to Santiago de Compostela, rescued Christians from the Muslim
slavery, increasing the Asturias population, he rescued people from different parts of
the Muslim territory, from the Gothic Fields (main Goth population area in Spain in
the Visigoth time, in the current “Ribera del Duero”), and even the captured Vikings
during the raids to northern Spain were integrated into the Asturias population.
The normal genetic mix between regions of a country was already in the XIX century
reinforced with an intensive immigration to Asturias from other provinces of Spain as
one of the old industrial provinces of Spain (Asturias, Basque Land, Catalonia and
Madrid).
9. Conclusion
The British has their main origin in the north Celtic Spain (Galicia, Asturias and
Cantabria), the oldest tribe name in England is “the Albion”, a name recorded in
Roman times to the Celtic tribes around the Navia river. The name Navia to a river
has the only meaning of a reference to a big fleet (as a lot of other rivers in the area
are navigable too), and then the Navia river is a probable starting point for a big
conquering fleet from the north Spain to the British Islands. And even there is
geological evidence of the British and Asturian “Albion” tribe name around the Navia
and around the important Celtic fortified city of Coaña.
I leave again the text found on Stone in Asturias (Spain), near Coaña and Navia:
Nicer, (son) of Clutoso (of the fortified city) of Cariaca,
Prince of the Albion, of 75 years old, lies here.