Mémoire de dea

937 vues

Publié le

Publié dans : Santé & Médecine
0 commentaire
0 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Vues
Nombre de vues
937
Sur SlideShare
0
Issues des intégrations
0
Intégrations
12
Actions
Partages
0
Téléchargements
9
Commentaires
0
J’aime
0
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

Mémoire de dea

  1. 1. SommaireRésuméIntroductionMatériels et méthodes 1 – Matériels a – Types cellulaires b – Amorces et sondes de RT-PCR quantitative en temps réel 2 – Méthodes a – Conditions générales de culture b – Extraction des ARN messagers c – Comparaison de la sensibilité au NGF des diverses lignées épithéliales desein humain d – Test de l’effet de l’inhibition de contact e – Effet de substances agissant sur la croissance et/ou l’apoptose f – RT-PCR quantitative en temps réel g – Immunoprécipitation et analyse en Western blot h – Test d’apoptose en Hoescht
  2. 2. Résultats 1 – Expression du NGF et de ses récepteurs (TrkA et p75) dans les lignéesde cancer du sein et sur les cellules normales a – Expression du gène p75 b – Expression du gène TrkA c – Expression du gène du NGF 2 – Variation de l’expression du NGF et de ses récepteurs (TrkA et p75)en fonction de l’inhibition de contact 3 – Variation de l’expression du NGF et de ses récepteurs (TrkA et p75)en fonction de substances agissant sur la croissance et/ou l’apoptoseDiscution et conclusionBibliographieRemerciments
  3. 3. Sébastien DUPRAT, DEA biologie santé 1999-2000. REGULATION DE L’EXPRESSION DU NGF ET DE SES RECEPTEURS (TRKA ET P75) DANS LES CELLULES DE CANCER DU SEIN.RESUME : Le cancer du sein touche près d’une femme sur dix. La meilleure compréhension decette maladie est un des défis prioritaires de la santé publique à l’heure actuelle. Il a préalablement été prouvé dans le laboratoire que le Nerve growth factor (NGF)stimule la croissance et la survie des cellules de cancer du sein par l’intermédiaire de deuxrécepteurs : TrkA et p75 (Descamps et al. 1998). Dans cette recherche il a également étédémontré que les cellules épithéliales mammaires normales ne sont pas stimulées à proliférerpar ce facteur de croissance. L’objectif de mon travail de DEA est de définir la régulation duNGF et de ses récepteurs dans les lignées de cancer du sein en culture. Différentes lignées de cancer du sein ainsi que des cellules épithéliales mammairesnormales ont été cultivées en présence de facteurs modifiant la prolifération et la surviecellulaire. Les résultats ont alors été analysés en RT-PCR quantitative en temps réel ou enwestern blot.
  4. 4. INTRODUCTION : préalablement à mon arrivée dans mon laboratoire d’accueil, cet effet a été démontré sur les cellules épithéliales mammaires cancéreuses (Descamps et al. La recherche en biologie cellulaire 1998). Une particularité est intéressantesur les cancers hormonaux dépendants dans ce modèle : le NGF stimule les cellulesrepose principalement sur l’étude de la cancéreuses du sein à proliférer mais resteprolifération, de la différentiation et de sans effets mesurables sur les cellulesl’apoptose. Ces phénomènes sont normales.conditionnés par l’environnement cellulaire, Le NGF agit par l’intermédiaire denotamment par les molécules de deux récepteurs membranaires : TrkA etsignalisation. On trouve dans cette p75. Le proto-oncogène TrkA (p140trk) estcatégorie les facteurs de croissance, petits un récepteur à activité tyrosine kinase, c’estpolypeptides de faible poids cellulaire qui le récepteur à haute affinité du NGF. P75agissent par l’intermédiaire de récepteurs est un récepteur accessoire, de bassemembranaires. affinité, et sans activité tyrosine kinase. Ce Le NGF est le premier facteur de dernier semble pourtant posséder une voiecroissance à avoir été caractérisé. Ce travail de transduction propre liée aux fonctionsa valu le prix Nobel de médecine en 1986 à de survie cellulaire.Rita-Levi Montalcini. C’est l’archétype des L’étude du rôle du NGF dans lefacteurs de croissance neurotrophique. Il a cancer du sein en est à ses débuts. Dans leété très largement étudié pour son rôle cadre de ce stage de DEA, nous nousd’induction de la croissance et de la survie somme intéressé aux mécanismes régulantdes neurones sympathiques. Plus la sensibilité des cellules épithélialesrécemment, une activité mitogène lui a été mammaires humaines pour ce facteur deattribuée sur certaines lignées de cellules croissance. Notre approche nous aépithéliales. Dans un travail effectué
  5. 5. renseigné sur l’évolution de cette sensibilité au NGF induite par des molécule agissant sur la croissance et/ou l’apoptose.
  6. 6. MATERIEL & METHODES : proto-oncogène ras1 - Matériel (dénomination : MCF-7 ras). Ces dernières se comportent en permanence comme stimulées a) Types cellulaires par des facteurs de croissance, Un certain nombre de types même en milieu de sevrage (sanscellulaires ont été utilisés. Ce sont des sérum de veau fœtal).lignées cancéreuses ou des cellules - Les lignées T47D et SK-Br-3normales, mais toutes sont d’origine sont également hormono-épithéliales mammaires humaines. dépendantes et peu invasives. - la lignée MCF-7 est hormono- Elle sont issues dépendante. Elle a été établie à d’adénocarcinomes. SK-Br-3 partir d’effusions pleurales d’un surexprime le récepteur erb-B2, adénocarcinome. Cette lignée a et T47D possède des récepteurs conservé de nombreuses à certains stéroïdes. caractéristiques d’un épithélium - La lignée BT20 semble être mammaire (particulièrement hormono-dépendante, mais ceci pour la présence des récepteurs est controversé dans la à haute affinité des œstrogènes littérature. Elle est issue de et progesterone). En plus de la cellules échapées d’une tumeur lignée MCF-7 commune, nous en culture primaire. Elle a la avons également utilisé des particularité de ne pas posséder MCF-7 transfectées par le de récepteurs aux œstrogènes.
  7. 7. - Nous avons également étudié 3 Dr.Pellerin) et mises en culture lignées de MDA. Elles sont primaire au laboratoire. toutes trois hormono- indépendantes. Ce sont les b) Amorces et sondes de RT- lignées MDA-MB-231 (issues PCR quantitative en temps d’effusions pleurales réél. d’adénocarcinomes, fortement Les séquences des amorces sens et invasive. Ces cellules antisens ainsi que des sondes sont les n’expriment pas de récepteurs suivantes : aux œstrogènes et à la progestérone), MDA-MB-453 TrkA : (possédant de nombreux Sens : CATCGTGAAGAGTGGTCTCCG récepteurs aux androgènes et Antisens : GAGAGAGACTCCAGAGCGTTGAA très invasive. Elle surexprime Sonde : également erb-B2) et MDA- AGGAGTGAAATGGAAGGCATCTGGC MB-468 (possède de nombreux G récepteurs à l’EGF et P75 : surexprime le FGF-2). Sens :- Enfin, nous avons utilisé des CCTACGGCTACTACCAGGATGAG Antisens : TGGCCTCGTCGGAATACG cellules épithéliales mammaires Sonde : humaines normales CTCGGGCCTCGTGTTCTCCTGC (dénomination : CEMN). Ces NGF : cellules sont issues de réduction Sens : mammaires non pathologiques Antisens : (venant du département de Sonde : chirurgie plastique, CHU Lille,
  8. 8. trypsine est inhibée par 5 ml de MEM SVF2 – méthodes (décrit ci-dessus). Les cellules en culture sont régulièrement observées au microscope a) Conditions générales de inversé à contraste de phase. Cela permetculture de suivre l’évolution de la confluance et de s’assurer du maintient de la morphologie En routine, les cellules sont épithéliale.maintenues en MEM (Milieu essentiel Avant un traitement de facteurs deminimum, avec des sels de Eagle) (Gibco croissance, les cellules sont sevrées dans duBRL) supplémenté avec 5% de sérum de MEM supplémenté comme pour le MEM –veau fœtal (SVF) (Eurobio ? ? ? ?), 1% SVF d’acides aminés non essentiels, de L-d’acides aminés essentiels (Eurobio), 2 mM glutamine, de pénistreptomycine, dede glutamine (Eurobio), 5 µl/ml d’insuline gentamycine, de bicarbonate de sodium, et(Organon), et des antibiotiques (Penicilline- d’HEPES. A ceci, nous ajoutons 2 µg/mlStreptomycine : 100 U/ml et Gentamycine : de fibronectine et 30 µg/ml de transférine.50 µl/ml) (Eurobio). Les cellules sontencemencées dans des flasques de plastiquede 75 cm2 (Falcon) et incubées dans un b) Extraction des ARNatmosphère humide, à 37°C en présence de5% de CO2. Le milieu est changé tous les 2 messagersjours. Les cellules sont régulièrementdécolées, avant la confluance dans une Les ARN totaux ont été extraitssolution de trypsine (0,1%) – EDTA avec le kit Quiagen selon le protocole(0,25%) (eurobio), à 37°C pendant 5 à 10 décrit par Quiagen. Ensuite, on évalue laminutes (en fonction du type cellulaire). La quantité d’ARN en spectrophotométrie à
  9. 9. 260 nm de longueur d’onde. On vérifie Ensuite, les cellules sont trypsinisées. Laaussi la pureté du résultat en s’assurant que quantité de cellules comprise dans chaquele ratio λ260/λ280 est compris entre 1,7 et échantillon est déterminée par comptage sur lame de Malassez. Ensuite, on2. Les ARN sont dilués à 10µg /ml puis les centrifuge 10 minutes à 1200 tour parsolutions mères et dilués sont stockées à – minutes. Les culots sont conservés à –80°C80°C. en attendant d’en extraire les ARN messagers. Les ARN seront analysés en c) Comparaison de la RT-PCR quantitative en temps réel.sensibilité au NGF des diverseslignées épithéliales de sein humain d) Test de l’effet de Pour évaluer le niveau d’expression l’inhibition de contactdu NGF et de ses récepteurs, les cellulesont été ensemencées dans des boites de Les cellules MCF-7 ont étépetri 100mm (………), à 10000 cellules ensemencées à 10000 cellules par cm2 dans 2par cm , puis cultivées dans deux des boites de Petri de 100mm de diamètreconditions standard : puis cultivées en MEM – SVF. Le milieu - 48 heures en MEM – SVF : est régulièrement changé. Chaque jours, condition de sérum. trois boites sont récoltées par une solution - 48 heures en MEM – SVF puis de trypsine, le nombre de cellules est 48 heures en MEM sevrage : déterminé par un compteur de cellules condition de sevrage. automatique. A partir de ces cellules, on(Remarque : dans cette partie, le milieu MEM de extrait les ARN messager que l’on analysesevrage ne contient pas de rouge de phénol. Cen’est pas le cas dans le reste de l’étude.) en RT-PCR quantitative en temps réel.
  10. 10. MEM – SVF a été renouvelé e) Effet de substances agissant 24h puis les cellules ont été traitées 48h dans du MEM –sur la croissance et/ou l’apoptose SVF supplémenté de 1mM de Les cellules (MCF7 et BT-20) ont NaB ou 10µM de C2.été ensemencées à 5000 cellules par cm2dans des boites de petri de 100mm dediamètre. Les cellules ont été laissées 48h f) RT-PCR quantitative enen MEM – SVF dans un incubateur (37°C, temps réel.5% de CO2). A partir de cette étape, il fautdifférencier deux cas : La réaction est faite en une seule - Pour le test du FGF-2, ainsi que étape. Le mélange de réaction se compose le test conjoint du butyrate de dans chaque tube de : 50ng d’ADN total sodium (NaB) et du C2 avec le d’échantillon, MgCl2 : 6mM pour TrkA ; NGF, les cellules ont été lavées 3mM pour p75 ; 4mM pour NGF, 5 µl de 2 fois avec du PBS stérile (15 tampon TaqMan 10X (500mM KCl, 0,1 minutes puis 2 heures) et mises mM EDTA, 100 mM tris HCl, pH 8.3, 600 24h en MEM sevrage. Enfin, nM ROX qui est un dérivé de la rhodamine elles ont été traitées 48h dans du utilisé comme référence interne passive MEM sevrage supplémenté de pour normaliser la fluorescence), 20 U 1ng/ml de FGF-2, 0.5mM de d’ADN polymérase AmpliTaq Gold, 300 NaB, 2µM de C2, et/ou 200 µM de dATP, dCTP, dGTP, dUTP, 200 ng/ml de NGF. nM d’amorces sens et antisens et 200 nM - Concernant les test avec le C2 de sonde. ou le butyrate de sodium (NaB) en présence de sérum, le milieu
  11. 11. La transcription inverse se fait Les cellules sont décolées par 200pendant 30 min à 48°C. On active ensuite µl (pour une boite de pétri 100mm) depar chauffage l’AmpliTaq Gold 10 min à tampon de lyse (0.3% SDS, 1% β-95°C. Puis on effectue 40 cycles dans les mercaptoéthanol, 0.5% Triton X100). Lesconditions suivantes : 15 sec à 95°C cellules ainsi récupérées sont laissées 5 min(dénaturation) puis 90 sec à 60°C dans la glace, puis les protéines sont(hybridation + élongation). dissociées par ultrasons. On centrifuge 3 Les données recueillies sont min à 10000 tr/min, on dose le surnageantcomparées à une courbe étalon amplifiée en spectrophotométrie (longueur d’onde :simultanément aux échantillons à partir 595nm), puis on stocke la solution ded’une quantité connue des ARN standard protéines à –20°C.respectifs. Une courbe d’amplification est Pour augmenter l’efficacité duréalisée par informatique (logiciel Abi- western, on réalise unePrism 7700) en rapportant l’intensité du immunoprécipitation au préalable avec lessignal fluorescent au nombre de cycles de anticorps spécifiques de TrkA, p75 et NGF.PCR. La courbe étalon est basée sur unerelation linéaire entre le logarithme de laquantité d’ARN standard de départ et le h) Test d’apoptose en Hoeschtseuil significatif d’augmentation de lafluorescence ( = cycle de sortie). Nous avons réalisé les test d’apoptose dans des boites de pétri de 35mm de diamètre, dans lesquels sont g) Immunoprécipitation et déposées 3 lamelles de microscopie cottéesanalyse en Western blot au collagène. Les cellules y sont encemencées et traitées dans les mêmes conditions que décrites précédemment.
  12. 12. A l’issue du traitement, on aspire le puis montées sur lames microscopiquesmillieu, les cellules sont fixées au méthanol avec du glycérol.à –20°C puis rincées 2 fois au PBS . On On lit les lames en microscopie àplace ensuite les lamelles dans une solution fluorescence. L’observation de lade Hoescht, 15 min, à température morphologie des noyaux permet deambiante et à l’abris de la lumière. Les déterminer la proportion de cellules enlamelles sont enfin rincées 2 fois au PBS apoptose. ________________________________________________________
  13. 13. RESULTATS : de phénol, nous avons décidé d’utiliser en Les résultats obtenus se composent sevrage du MEM sans rouge de phénol.en 3 parties, chacune concernant Ceci nous donne 2 conditions standardl’expression du NGF et des ses récepteurs : extrêmes de culture : en condition favorable• dans différents types cellulaires de sein et en condition limitante. humain. L’objectif a été de collecter les• et leur évolution en fonction de la informations necessaires au choix d’un densité cellulaire. modèle expérimental pour la suite du travail.• sur des cellules traitées par des facteurs agissant sur la prolifération ou l’apoptose. a) Expression du gène p75. La fig. 1A présente le résultat en1) Expression du NGF et de ses RT-PCR quantitative du niveau d’expression des ARN messagers de p75.récepteurs (TrkA et p75) dans les Les types cellulaires sont classées de lalignées de cancer du sein et sur les façon suivante : d’abord les cellulescellules normales. normales, puis les lignées cancéreuses par ordre décroissant d’hormonodépendance. Cette étude regroupe toutes les On observe pour la majorité deslignées décrites dans « matériel et types cellulaires une expression de p75méthodes ». Les cellules ont été cultivées significativement plus importante sans SVF.dans des conditions d’étude standard : en Il y a une exception néanmoins : la lignéeMEM – SVF ou en MEM sevrage. Comptetenu de l’activité oestrogénique du rouge
  14. 14. MCF-7 exprime de façon égale ce gène MDA-MB-231, MDA-MB-453 et MDA-dans les conditions de sérum et de sevrage. MB-468. Dans le cas des lignées BT-20 et Ce sont dans les lignées MCF-7, T47-D, TrkA est largement plus expriméT47-D et BT-20 que l’expression du gène dans les cultures avec du sérum.p75 est la plus importante. Elle est par L’expression de TrkA est la pluscontre particulièrement faible dans les faible dans les cellules normales, les MCF-cellules normales, ainsi que dans les lignées 7, les MDA-MB-231 et les MDA-MB-453.SKBr3, MDA-MB-453 et MDA-MB-468. c) Expression du gène du b) Expression du gène TrkA. NGF. Les résultats sont présentés dans la Les résultats ne sont pas présentésfig. 1B. car l’expression est nulle ou suffisamment On observe dans la plupart des faible pour ne pas être détectable en PCR,types cellulaires une expression équivalente même après 40 cycles, et ce, dans chacunede TrkA dans les conditions de sérum et de des conditions précédentes et pour chaquesevrage. Cela concerne les cellules type cellulaire testé.normales, ainsi que les MCF-7, SKBr3,
  15. 15. Fig. 1A :Fig. 1B :
  16. 16. représente le début de la phase plateau avec2) Variation de l’expression du 270000 cellules. Ce travail présente l’expression desNGF et de ses récepteurs (TrkA et ARN messagers des étudiés.p75) en fonction de l’inhibition decontact. Le résultat de cette étude est présenté dans la fig. 2A pour p75 et fig. 2B pour TrkA. Comme dans l’étude Cette étude a été réalisée sur la précédente, l’expression du NGF a été testélignée cancéreuse MCF-7. et il n’est pas exprimé de façon mesurable.L’encemencement s’est fait à 50000 On observe une expressioncellules par boites. Le jour 1 correspond à relativement forte des 2 récepteurs du NGFla phase « lag » avec 71600 cellules par lors de la phase d’adhérence. Par la suite,boites. Les jours 2 et 3 composent la phase cette expression diminue progressivement« log » avec respectivement 104000 et jusqu’à la phase de plateau.181000 cellules par boites. Enfin, le jour 4
  17. 17. Fig. 2A :Fig. 2B :
  18. 18. 3) Variation de l’expression du MEM – SVF, ou après un traitement par le FGF-2 en condition de sevrage. Suite auxNGF et de ses récepteurs (TrkA et résultats de cette étude qui montre unep75) en fonction de substances réponse parfaitement identique dans les 2agissant sur la croissance et/ou lignées, nous avons continué le travail surl’apoptose. la seule lignée MCF-7. Nous avons ensuite étudié en détail l’effet conjoint du NaB ou du C2 avec le Cette étude a été commencé sur NGF.deux lignées cellulaires (MCF-7 et BT-20) Cette 3ème partie comprend des testschoisies comme modèle d’étude au vue des d’apoptose en Hoescht, des tests de RT-résultats précédents. Nous avons défini PCR quantitative sur les gènes TrkA et p75l’expression de TrkA et p75 (NGF n’étant qui sont confirmés par Western blot.pas exprimé, comme précédemment) aprèsun traitement par le C2 ou le NaB en milieu
  19. 19. DISCUSSION ET CONCLUSION: Les résultats de cette étude montrent comment évolue la sensibilité des cellulesépithéliales mammaires humaines pour le NGF. Il a fallu tout d’abord choisir le modèle expérimental de l’étude. Nous avons pour celacomparé le niveau d’expression du NGF et de ses récepteurs (TrkA et p75) dans les différentescellules usuelles d’étude du cancer du sein. Le profil obtenu, tant pour p75 que pour TrkA, amontré des divergences de comportement entre les différents types cellulaires. Nous avonsdonc choisi deux lignées : MCF7 qui est typiquement la lignée prototype des études sur lecancer du sein ; et BT-20 dont le comportement semble (au vu de cette étude préalable)différent de MCF7 et qui a l’avantage d’avoir un niveau d’expression assez élevé pour lesgènes de notre étude. Par la suite, en constatant que la réponse de ces deux lignées auxtraitements, aussi bien sur la plan de la croissance que de l’expression des gènes, étaitidentique, nous avons fini l’étude sur la seule lignée MCF-7. Tout d’abord, les cellules épithéliales mammaires humaines (aussi bien les cellulesnormales que les cellules cancéreuses) ne produisent pas le NGF. L’hypothèse de la voie derégulation autocrine s’avère donc non fondée. Nous avons largement observé l’expression des deux récepteurs du NGF (TrkA et p75)en conditions routinière ainsi que son évolution suite à un traitement par des moléculesagissant sur la prolifération ou/et sur l’apoptose. Grâce à la technique de RT-PCR quantitative,nous n’avons pas constaté de différence d’expression des récepteurs TrkA et p75 suite à untraitement de 48h avec du FGF-2 ou du C2. Nous avons par contre observé une expression dep75 de l’ordre de trois fois celle du contrôle en cas de traitement 48h avec du NaB. Avec ce
  20. 20. même traitement, TrkA ……… Ceci a pu être vérifié dans deux lignées différentes (MCF-7 etBT-20), avec un profil de réponse au traitement parfaitement identique.
  21. 21. BIBLIOGRAPHIE :Descamps et al. (1998) J. Biol. Chem. 273 : 16659-62.
  22. 22. REMERCIMENTS : Je remercie chaleureusement le Professeur H. Hondermarck et le Docteur J.P. Peyrat pourm’avoir laissé beaucoup de liberté dans l’organisation de mon travail tout en me faisant bénéficier d’unencadrement régulier et de qualité. Un grand merci au Professeur B. Boilly pour l’interret constant qu’il a porté à mon travail etpour m’avoir généreusement fait profiter de son expérience. Je remercie tout particulièrement Simon Descamps pour sa patience et sa disponibilité à monégard. Merci aux Docteurs X. Dong-Lebouhris et Y. El Yazidi pour leur bonne humeur et leurgentillesse. Je me dois aussi de ne pas oublier tous ceux sans qui mon travail n’aurait pas pu être aussienrichissant : Pr Victor Nurcombe, Dr Patrice Richard, Dr. Louis Hornez, Dr. Françoise Révillon,Valérie C., Valérie P., Anne-Sophie, Rachel, Sylviane, Isabelle, Marie-Michelle, Laurent, Robert-Alain,David V., David L., Johan, Alain, Arnaud,… Une pensée émue enfin, avec l’espoir sincère d’une rapide guérison, pour Anthony, je tesouhaite tous mes vœux pour une longue carrière dans la recherche quand ta maladie sera passée.

×