SlideShare a Scribd company logo
1 of 40
Learning Life through Bioinformatics…
What is Bioinformatics?
What is Bio-Bio-1?
Fokhruz Zaman
Founder & Evangelist, Bio-Bio-1
4th
July, 2013; UODA BI Workshop, Dhaka
Learning Life through Bioinformatics…
What is Bioinformatics?
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
2
Learning Life through Bioinformatics…
What is Bioinformatics?
Finding patterns in molecular biological data
Implies:
• managing molecular biological data
• identifying correlations in molecular biological
data
Goals:
• characterise biological patterns & processes
• predict biological properties
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
3
Learning Life through Bioinformatics…
Bioinformatics: neighbour disciplines
• Computational biology
– Broader concept: includes computational ecology,
physiology, neurology etc...
• -omics:
– Genomics
– Transcriptomics
– Proteomics
• Systems biology
– Putting it all together...
– Building models, identify control & regulation
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
4
Learning Life through Bioinformatics…
Bioinformatics: prerequisites
• Bio- side:
– Molecular biology
– Cell biology
– Genetics
– Evolutionary theory
• -informatics side:
– Computer science
– Statistics
– Theoretical physics
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
5
Learning Life through Bioinformatics…
Central Dogma of Molecular Biology
GENOTYPE (i.e. Aa)
PHENOTYPE (pink)
GENE (DNA)
MESSENGER (RNA)
PROTEIN
TRAIT
ATGCAAGTCCACTGTATTCCA
UACGUUCAGGUGACAUAAGGG
transcription reverse tr
translation
replication
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
6
Learning Life through Bioinformatics…
Molecular biology data...
>al pha- D
ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCAC
CCAGACTGTGGAGCCGAGGCCCTGGAGAGGTGCGGGCTGAGCTTGGGGAAACCATGGGCA
AGGGGGGCGACTGGGTGGGAGCCCTACAGGGCTGCTGGGGGTTGTTCGGCTGGGGGTCAG
CACTGACCATCCCGCTCCCGCAGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCC
CCCACTTCGACTTGCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGG
CCGCCTTGGGCAACGCTGTCAAGAGCCTGGGCAACCTCAGCCAAGCCCTGTCTGACCTCA
GCGACCTGCATGCCTACAACCTGCGTGTCGACCCTGTCAACTTCAAGGCAGGCGGGGGAC
GGGGGTCAGGGGCCGGGGAGTTGGGGGCCAGGGACCTGGTTGGGGATCCGGGGCCATGCC
GGCGGTACTGAGCCCTGTTTTGCCTTGCAGCTGCTGGCGCAGTGCTTCCACGTGGTGCTG
GCCACACACCTGGGCAACGACTACACCCCGGAGGCACATGCTGCCTTCGACAAGTTCCTG
TCGGCTGTGTGCACCGTGCTGGCCGAGAAGTACAGATAA
>al pha- A
ATGGTGCTGTCTGCCAACGACAAGAGCAACGTGAAGGCCGTCTTCGGCAAAATCGGCGGC
CAGGCCGGTGACTTGGGTGGTGAAGCCCTGGAGAGGTATGTGGTCATCCGTCATTACCCC
ATCTCTTGTCTGTCTGTGACTCCATCCCATCTGCCCCCATACTCTCCCCATCCATAACTG
TCCCTGTTCTATGTGGCCCTGGCTCTGTCTCATCTGTCCCCAACTGTCCCTGATTGCCTC
TGTCCCCCAGGTTGTTCATCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACC
TGTCACATGGCTCCGCTCAGATCAAGGGGCACGGCAAGAAGGTGGCGGAGGCACTGGTTG
AGGCTGCCAACCACATCGATGACATCGCTGGTGCCCTCTCCAAGCTGAGCGACCTCCACG
CCCAAAAGCTCCGTGTGGACCCCGTCAACTTCAAAGTGAGCATCTGGGAAGGGGTGACCA
GTCTGGCTCCCCTCCTGCACACACCTCTGGCTACCCCCTCACCTCACCCCCTTGCTCACC
ATCTCCTTTTGCCTTTCAGCTGCTGGGTCACTGCTTCCTGGTGGTCGTGGCCGTCCACTT
CCCCTCTCTCCTGACCCCGGAGGTCCATGCTTCCCTGGACAAGTTCGTGTGTGCCGTGGG
CACCGTCCTTACTGCCAAGTACCGTTAA
• DNA sequences
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
7
Learning Life through Bioinformatics…
Molecular biology data...
• Amino acid sequences
• Protein structure:
– X-ray crystallography
– NMR (Nuclear Magnetic
Resonance) Spectroscopy
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
8
Learning Life through Bioinformatics…
Cell biology & proteomics data...
• Subcellular localization
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
9
Learning Life through Bioinformatics…
Cell biology & proteomics data...
protein-protein
interactions
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
10
Learning Life through Bioinformatics…
DNA microarray technology
Transcriptomics: DNA microarray
technology
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
11
Learning Life through Bioinformatics…
Proteomics & transcriptomics data
Proteins encoded by periodically expressed
genes: a functionally diverse protein category
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
12
Learning Life through Bioinformatics…
Phenotype data: human diseases
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
13
Learning Life through Bioinformatics…
Jute Genome Sequencing
• Genome sequencing of jute (mystery of origin of
jute) disclosed by Bangladeshi Scientists, June
2010
• Opening up a new vista in the development of
variety of the world's most biodegradable natural
fibre
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
14
Learning Life through Bioinformatics…
Abiotic Stress tolerance and
Crop Improvement
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
15
National Plant Genome Initiative (2009-2013)
1. Expand genomic resources for every major plant of
economic importance
• Understanding of plant epigenomes
• Mining plant diversity
• Survey sequence resources for thousands of plants
• A new kind of reference genome
• Integrated comparative sequence resources
2. Advance plant systems biology
• Toolkits to enable systems-level analysis of key plant processes
•Regulation of plant structure and composition
3. Translate basic discovery to the field
• High-throughput phenotyping under field conditions
• Breeding for improved local adaptation to biotic and
abiotic stress
• A National Genetic Trait Index
Learning Life through Bioinformatics…
Ref: Shortliffe, 1995
Bioinformatics & Human Health
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
17
Learning Life through Bioinformatics…
Bioinformatics as in-silico biology
- generates testable hypotheses for the biologist
- explores domains that can not be addressed
experimentally
Translational Bioinformatics / Medicine
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
18
Learning Life through Bioinformatics…
Bioinformatics & Human Health
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
19
Learning Life through Bioinformatics…
Would we want to live longer, healthier?
Would we benefit from better crops?
Bioinformatics
Why Bioinformatics?
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
20
Learning Life through Bioinformatics…
Traditional Methods of
Drug Discovery
natural
(plant-derived)
treatment for
illness / ailments
↓
isolation of active
compound
(small, organic)
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
21
Learning Life through Bioinformatics…
synthesis
of compound
↓
manipulation of
structure to get
better drug
(greater efficacy,
fewer side effects)
Aspirin
Traditional Methods of
Drug Discovery
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
22
Learning Life through Bioinformatics…
Modern Methods of Drug
Discovery
What’s different?
• Drug discovery process begins
with a disease (rather than a treatment)
• Use disease model to pinpoint
relevant genetic / biological
components (i.e. possible drug targets)
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
23
Learning Life through Bioinformatics…
Modern Drug Discovery
disease → genetic / biological target
↓
discovery of a “lead” molecule
- design assay to measure function of
target
- use assay to look for modulators of
target’s function
↓
high throughput screen (HTS)
- to identify “hits” (compounds with
binding in low nM to low μM range)
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
24
Learning Life through Bioinformatics…
small molecule hits
↓
manipulate structure to increase potency
i.e. decrease Ki to low nM affinity
↓
*optimization of lead molecule into candidate drug*
fulfillment of required pharmacological properties:
potency, absorption, bioavailability, metabolism, safety
↓
clinical trials
Modern Drug Discovery
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
25
Learning Life through Bioinformatics…
Interesting facts...
• Over 90% of drugs
entering clinical
trials fail to make it
to market
• The average cost
to bring a new
drug to market is
estimated at $770
million
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
26
Learning Life through Bioinformatics…
Drug discovery and
development
• It costs in Billions USD and takes ~ 11 years
• In 2010, to bring a new Drug to Market was USD 1.2
Billion
• 4 out of 5 drugs fails during 1st Phase of Clinical trials
In-silico methods
• save an average of $130 million and 0.8 years per
drug (2003)
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
27
Learning Life through Bioinformatics…
Beowulf Cluster
Computing
Each Computer in the cluster is equipped with:
– Intel Core 2 Duo 6400 Processor(Master: Core 2 Duo
6700)
– 2 Gigabytes of DDR RAM in Dual Channel
– D-Link Gigabyte Network Interface Card(Master: 2x
Cards)
– 60 Gigabyte Hard Drive(Master: 1000 Gigabyte RAID
5)
Sample Cluster Computer
CLUSTER USES: Clusters have a variety of different applications in the
world. They are used in bioinformatics to run DNA string matching algorithms or
to run protein folding applications. Geologists also use clusters to emulate and
predict earthquakes and model the interior of the Earth and sea floor Clusters
are even used to render and manipulate high-resolution graphics in engineering.
Our completed Beowulf cluster will use a computer algorithm known as BLAST,
(Basic Local Alignment Search Tool), to analyze massive sets of DNA sequences
for research into Bioinformatics.
Researcher: Ben Case
Researcher: Stephen
Ciesla
Advisor: Ed Harcout
Biology Consultant:
Lorraine Olendzenski
Node Computers
Master Computer
PROJECT: We constructed a parallel processing computer system using the Beowulf
cluster computing design created at NASA in an attempt to build a powerful computer that
could assist in Bioinformatics research and data analysis.
BEOWULF CLUSTERS: A Beowulf Cluster is a computer design that uses
parallel processing across multiple computers to create cheap and powerful
supercomputers. A Beowulf Cluster in practice is usually a collection of generic computers,
either stock systems or wholesale parts purchased independently and assembled,
connected through an internal network.
A cluster has two types of computers, a master computer, and node
computers. When a large problem or set of data is given to a Beowulf cluster, the master
computer first runs a program that breaks the problem into small discrete pieces; it then
sends a piece to each node to compute. As nodes finish their tasks, the master computer
continually sends more pieces to them until the entire problem has been computed.
MPICH2: In order for the master and node computers to communicate, some sort
message passing control structure is required. MPI,(Message Passing Interface) is the
most commonly used such control, and the one that we've incorporated into our project.
MPICH2 is a implementation of MPI that was specifically designed for use with cluster
computing systems and parallel processing. It is an open source set of libraries for various
high level programming languages that give programmers tools to easily control how large
problems are broken apart and distributed to the various computers in a cluster.
OUR CLUSTER: Using funding from the Biology department, the cluster we
constructed contains eight computers with one master and seven node computers. Each
computer in the cluster contains a dual core processor, giving us a total of 16 processors
to utilize. Each runs on the Fedora Core 6 version of Linux and uses the MPICH2 libraries
for message passing. They are all connected on a internal network through a high speed
gigabyte switch.
2 GB
RAM
SATA Hard Drives
D-Link NetworkIntel Core 2
RESULTS: The total processing power of our cluster has yet to be
determined. Once the cluster has been completely streamlined and stabilized,
we will run benchmark tests to calculate its average and peak performances
CLUSTER LAYOUT AND DESIGN:
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
28
Learning Life through Bioinformatics…Expertiselevel
SYS ALGO STAT VERB LUCKBIO
apprentice ~ 2,000 hours
mastery ~ 10,000 hours
critical weakness – below freshman level knowledge
Let’s ALL try to be Bioinformaticians!
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
29
Learning Life through Bioinformatics…
SYS
ALGO
STAT
VERB
LUCK
(Serendipity)
BIO
Let’s ALL try to be Bioinformaticians!
SYStems: ability to identify,
understand, run, troubleshoot
existing bioinformatics tools
and techniques. (near
mastery skill needed ASAP)
ALGOrithms: ability to
create a new algorithm or
to implement these as a
software tool. (near
freshman skill needed to
start)
STATistics: ability to
identify proper statistical
method and to devise a
new statistical approach
to extract knowledge
from data. (above
apprentice skill
needed ASAP)
BIOlogy: ability to interpret
bioinformatics results in the proper
biological context. (well above
apprentice skill needed ASAP)
VERBal: ability to understand the
needs of individuals from diverse
backgrounds and ability to
communicate with them with their
discipline language. (near
mastery skill needed ASAP)
LUCK: ability to be in the right
place at the right time and have
the skill to work on unexpected
tasks. (CHANCE favors ONLY
the Prepared Minds !!!)
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
30
Learning Life through Bioinformatics…
Five websites that all
Bioinformaticians should know
• NCBI (The National Center for Biotechnology Information)
– http://www.ncbi.nlm.nih.gov/
• EBI (The European Bioinformatics Institute)
– http://www.ebi.ac.uk/
• The Canadian Bioinformatics Resource
– http://www.cbr.nrc.ca/
• SwissProt/ExPASy (Swiss Bioinformatics Resource)
– http://expasy.cbr.nrc.ca/sprot/
• PDB (The Protein Databank)
– http://www.rcsb.org/PDB/
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
31
Learning Life through Bioinformatics…
• First:
– Fix your Critical weakness.
• Second:
– Where should you invest next?
• To strengthen your stronger skills? … Or …
• To improve on your weaker skills?
• Answer ???
Continued…….
Let’s ALL try to be Bioinformaticians!
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
32
Learning Life through Bioinformatics…
 Invest into what you are already good at!
 People with complementary skill-sets are
more valuable
 Differentiate yourself
 Pick a paper that interests you and redo
it!
 Compute the same quantities for a different
genome/annotations
Strengthen Your Stronger Skills
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
33
Learning Life through Bioinformatics…
So… what is Bio-Bio-1?
• A TEAM with Passion for Learning Life through
Bioinformatics Knowledge and Skills…
• A TEAM with BIG Dreams to help flourishing the
Bioinformatics discipline in Bangladesh and in the
World…
• A voluntary not-for-profit organization, formed by some
passionate individuals in the late 2008 to learn
Bioinformatics for making some senses from the enigma
of life.
• Aims to spread the R&D excitement by infecting the
young individuals through several programs (weekly
study circles, workshops, etc)
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
34
Learning Life through Bioinformatics…
Bio-Bio-1 Main Objectives
• Learn Bioinformatics from closely interacting multiple
academic and professional disciplines, including:
– Life Sciences, Computing Sciences, Mathematics, Statistics,
Software Engineering, High Performance Computing and Large
Scale Database optimization
• Popularize and spread the need for Bioinformatics
learning among the local students and professionals in
Bangladesh.
• Procure offshore sourcing programming and
development projects in Bioinformatics from abroad.
• Write practical handbooks in Bioinformatics and publish
papers in reputed journals.
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
35
Learning Life through Bioinformatics…
Bio-Bio-1 Current Main Activities
• Organizing regular weekly Bioinformatics Study Circle
– Every Saturday at KAL Gallery, Dept. of Biochemistry and
Molecular Biology, University of Dhaka.
• Organizing Hands-On Bioinformatics Boot Camps &
Workshops.
• Collaboratively working with Microbial Genetics and
Bioinformatics Lab, Dept. of Microbiology, University of
Dhaka for the projects:
– “FMDV vaccine design and development” with Prof. Dr. Anwar
Hossain.
– and with Prof. Dr. Mojammel Hoque, to identify the factors that
increase the productivity and enzyme activity of protease and
keratinase of Bacillus Licheniformis.
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
36
Learning Life through Bioinformatics…
• Zohirul Alam Tiemoon
– Founder and General Manager, Bio-Bio-1
Consultant, BASIS (www.basis.org.bd), Dhaka.
– Leading the Bio-Bio-1 v3.0 with new vigor!
• Saddam Hossain
– Founding Core Member and Chief Researcher, Bio-Bio-1. Head,
Business Intelligence, Airtel Bangladesh
– Re-incarnated Bio-Bio-1 from long hibernation! Leading the R&D
Projects both in Bio-Bio-1 v2.0 and v3.0!
• Farjana Khatun
– Founding Core Member and Coordinator, Bio-Bio-1. Lecturer,
Department of Pharmacy, East West University
– The Pioneer Biology knowledge provider in Bio-Bio-1. Patient
and Persistent Coordinator!
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
37
Bio-Bio-1 Prime Movers (& Shakers) 
Learning Life through Bioinformatics…
Bio-Bio-1 Prime Movers (& Shakers) 
• Mosharraf Hossain
– Core Member and Coordinator, Bio-Bio-1. Head, Operations
Support System & Business Support System, Novo Tel Ltd.
– Passionate Mentor for the Bio-Bio-1 Study Circle Participants!
• Arafat Rahman
– Core Member and Researcher, Bio-Bio-1. Research Student,
Microbial Genetics and Bioinformatics Lab, Dept. of
Microbiology, University of Dhaka.
– Great Analytical Mind with knowledge and interest in diverse
scientific disciplines! Still a great Bio-Bio-1 Anchor!
• Arif Ashraf Opu
– Core Member and Researcher, Bio-Bio-1. Research Student,
Plant Biotechnology Lab, University of Dhaka
– Great Out-of-the-Box Thinker with lucid Presentation Skills!
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
38
Learning Life through Bioinformatics…
Credits / Acknowledgments
• www.cbs.dtu.dk/phdcourse/cookbooks/What_is_bioin
• Prof. Zeba Islam Seraj, Professor, Dept of
Biochemistry and Molecular Biology, Dhaka University
• Prof. Supten Sarbadhikary, India - Chair, HL7 India,
Visiting Professor, Dept of Health
Informatics, Bangladesh University of Health Sciences
• The Bio-Bio-1 CORE TEAM
• The Google & The WWW
4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka
39
Learning Life through Bioinformatics…
Thank You very much
for all your time and patience 
Hope You will enjoy this 2-days workshop in
UODA!

More Related Content

What's hot

Publicly available tools and open resources in Bioinformatics
Publicly available  tools and open resources in BioinformaticsPublicly available  tools and open resources in Bioinformatics
Publicly available tools and open resources in BioinformaticsArindam Ghosh
 
Recent trends in bioinformatics
Recent trends in bioinformaticsRecent trends in bioinformatics
Recent trends in bioinformaticsZeeshan Hanjra
 
Bioinformatics
BioinformaticsBioinformatics
BioinformaticsJTADrexel
 
introduction of Bioinformatics
introduction of Bioinformaticsintroduction of Bioinformatics
introduction of BioinformaticsVinaKhan1
 
Introduction of bioinformatics
Introduction of bioinformaticsIntroduction of bioinformatics
Introduction of bioinformaticsDr NEETHU ASOKAN
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformaticsbiinoida
 
Nucleic Acid Sequence databases
Nucleic Acid Sequence databasesNucleic Acid Sequence databases
Nucleic Acid Sequence databasesPranavathiyani G
 
Major resources of bioinformatics 2
Major resources of bioinformatics 2Major resources of bioinformatics 2
Major resources of bioinformatics 2Mohd Affan
 
Bioinformatics-General_Intro
Bioinformatics-General_IntroBioinformatics-General_Intro
Bioinformatics-General_IntroAbhiroop Ghatak
 
Careers in bioinformatics
Careers in bioinformaticsCareers in bioinformatics
Careers in bioinformaticsentranzz123
 
Application of bioinformatics
Application of bioinformaticsApplication of bioinformatics
Application of bioinformaticsKamlesh Patade
 

What's hot (20)

Data mining ppt
Data mining pptData mining ppt
Data mining ppt
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Publicly available tools and open resources in Bioinformatics
Publicly available  tools and open resources in BioinformaticsPublicly available  tools and open resources in Bioinformatics
Publicly available tools and open resources in Bioinformatics
 
Recent trends in bioinformatics
Recent trends in bioinformaticsRecent trends in bioinformatics
Recent trends in bioinformatics
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
BTIS
BTISBTIS
BTIS
 
introduction of Bioinformatics
introduction of Bioinformaticsintroduction of Bioinformatics
introduction of Bioinformatics
 
Intro bioinfo
Intro bioinfoIntro bioinfo
Intro bioinfo
 
Bioinformatics introduction
Bioinformatics introductionBioinformatics introduction
Bioinformatics introduction
 
Introduction of bioinformatics
Introduction of bioinformaticsIntroduction of bioinformatics
Introduction of bioinformatics
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Nucleic Acid Sequence databases
Nucleic Acid Sequence databasesNucleic Acid Sequence databases
Nucleic Acid Sequence databases
 
Major resources of bioinformatics 2
Major resources of bioinformatics 2Major resources of bioinformatics 2
Major resources of bioinformatics 2
 
Bioinformatics Software
Bioinformatics SoftwareBioinformatics Software
Bioinformatics Software
 
Bioinformatics-General_Intro
Bioinformatics-General_IntroBioinformatics-General_Intro
Bioinformatics-General_Intro
 
Bioinformatics ppt
Bioinformatics pptBioinformatics ppt
Bioinformatics ppt
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Careers in bioinformatics
Careers in bioinformaticsCareers in bioinformatics
Careers in bioinformatics
 
Application of bioinformatics
Application of bioinformaticsApplication of bioinformatics
Application of bioinformatics
 

Viewers also liked

Bioinformaticians to the resque
Bioinformaticians to the resqueBioinformaticians to the resque
Bioinformaticians to the resqueElena Sügis
 
Using Genetic Sequencing to Unravel the Dynamics of Your Superorganism Body
Using Genetic Sequencing to Unravel the Dynamics of Your Superorganism BodyUsing Genetic Sequencing to Unravel the Dynamics of Your Superorganism Body
Using Genetic Sequencing to Unravel the Dynamics of Your Superorganism BodyLarry Smarr
 
Dna sequencing
Dna sequencingDna sequencing
Dna sequencingsikojp
 
Chapter 11 Introduction to Genetics
Chapter 11 Introduction to GeneticsChapter 11 Introduction to Genetics
Chapter 11 Introduction to GeneticsKyle McAlister
 
SCI 9 Lesson 1 Mar 15 - Introduction to Genetics
SCI 9 Lesson 1 Mar 15 - Introduction to GeneticsSCI 9 Lesson 1 Mar 15 - Introduction to Genetics
SCI 9 Lesson 1 Mar 15 - Introduction to Geneticsmsoonscience
 
04 DNA Sequencing and Genetic Fingerprinting
04 DNA Sequencing and Genetic Fingerprinting04 DNA Sequencing and Genetic Fingerprinting
04 DNA Sequencing and Genetic FingerprintingJaya Kumar
 
Introduction to Bioinformatics
Introduction to BioinformaticsIntroduction to Bioinformatics
Introduction to BioinformaticsLeighton Pritchard
 
B.sc biochem i bobi u-1 introduction to bioinformatics
B.sc biochem i bobi u-1 introduction to bioinformaticsB.sc biochem i bobi u-1 introduction to bioinformatics
B.sc biochem i bobi u-1 introduction to bioinformaticsRai University
 
Introduction to genetics for beginners
Introduction to genetics for beginnersIntroduction to genetics for beginners
Introduction to genetics for beginnersmeducationdotnet
 
2015 bioinformatics personal_genomics_wim_vancriekinge
2015 bioinformatics personal_genomics_wim_vancriekinge2015 bioinformatics personal_genomics_wim_vancriekinge
2015 bioinformatics personal_genomics_wim_vancriekingeProf. Wim Van Criekinge
 
Bioinformatics and BioPerl
Bioinformatics and BioPerlBioinformatics and BioPerl
Bioinformatics and BioPerlJason Stajich
 
Bioinformatics Project Training for 2,4,6 month
Bioinformatics Project Training for 2,4,6 monthBioinformatics Project Training for 2,4,6 month
Bioinformatics Project Training for 2,4,6 monthbiinoida
 
Molecular genetics ppt
Molecular genetics pptMolecular genetics ppt
Molecular genetics pptFrancine Diaz
 
Biotechnology in agriculture and BioInformatics in Agriculture
Biotechnology in agriculture and BioInformatics in AgricultureBiotechnology in agriculture and BioInformatics in Agriculture
Biotechnology in agriculture and BioInformatics in AgricultureAbubaker Shekhani
 
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...VHIR Vall d’Hebron Institut de Recerca
 
Introduction to bioinformatics
Introduction to bioinformaticsIntroduction to bioinformatics
Introduction to bioinformaticsHamid Ur-Rahman
 
Sequence Alignment In Bioinformatics
Sequence Alignment In BioinformaticsSequence Alignment In Bioinformatics
Sequence Alignment In BioinformaticsNikesh Narayanan
 

Viewers also liked (20)

Bioinformaticians to the resque
Bioinformaticians to the resqueBioinformaticians to the resque
Bioinformaticians to the resque
 
Using Genetic Sequencing to Unravel the Dynamics of Your Superorganism Body
Using Genetic Sequencing to Unravel the Dynamics of Your Superorganism BodyUsing Genetic Sequencing to Unravel the Dynamics of Your Superorganism Body
Using Genetic Sequencing to Unravel the Dynamics of Your Superorganism Body
 
Dna sequencing
Dna sequencingDna sequencing
Dna sequencing
 
Chapter 11 Introduction to Genetics
Chapter 11 Introduction to GeneticsChapter 11 Introduction to Genetics
Chapter 11 Introduction to Genetics
 
SCI 9 Lesson 1 Mar 15 - Introduction to Genetics
SCI 9 Lesson 1 Mar 15 - Introduction to GeneticsSCI 9 Lesson 1 Mar 15 - Introduction to Genetics
SCI 9 Lesson 1 Mar 15 - Introduction to Genetics
 
04 DNA Sequencing and Genetic Fingerprinting
04 DNA Sequencing and Genetic Fingerprinting04 DNA Sequencing and Genetic Fingerprinting
04 DNA Sequencing and Genetic Fingerprinting
 
Introduction to Bioinformatics
Introduction to BioinformaticsIntroduction to Bioinformatics
Introduction to Bioinformatics
 
B.sc biochem i bobi u-1 introduction to bioinformatics
B.sc biochem i bobi u-1 introduction to bioinformaticsB.sc biochem i bobi u-1 introduction to bioinformatics
B.sc biochem i bobi u-1 introduction to bioinformatics
 
Introduction to genetics for beginners
Introduction to genetics for beginnersIntroduction to genetics for beginners
Introduction to genetics for beginners
 
2015 bioinformatics personal_genomics_wim_vancriekinge
2015 bioinformatics personal_genomics_wim_vancriekinge2015 bioinformatics personal_genomics_wim_vancriekinge
2015 bioinformatics personal_genomics_wim_vancriekinge
 
Introduction to DNA and Genetics
Introduction to DNA and GeneticsIntroduction to DNA and Genetics
Introduction to DNA and Genetics
 
Bioinformatics and BioPerl
Bioinformatics and BioPerlBioinformatics and BioPerl
Bioinformatics and BioPerl
 
Bioinformatics Project Training for 2,4,6 month
Bioinformatics Project Training for 2,4,6 monthBioinformatics Project Training for 2,4,6 month
Bioinformatics Project Training for 2,4,6 month
 
Bioinformatics Analysis of Nucleotide Sequences
Bioinformatics Analysis of Nucleotide SequencesBioinformatics Analysis of Nucleotide Sequences
Bioinformatics Analysis of Nucleotide Sequences
 
Molecular genetics ppt
Molecular genetics pptMolecular genetics ppt
Molecular genetics ppt
 
Biotechnology in agriculture and BioInformatics in Agriculture
Biotechnology in agriculture and BioInformatics in AgricultureBiotechnology in agriculture and BioInformatics in Agriculture
Biotechnology in agriculture and BioInformatics in Agriculture
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
Introduction to RNA-seq and RNA-seq Data Analysis (UEB-UAT Bioinformatics Cou...
 
Introduction to bioinformatics
Introduction to bioinformaticsIntroduction to bioinformatics
Introduction to bioinformatics
 
Sequence Alignment In Bioinformatics
Sequence Alignment In BioinformaticsSequence Alignment In Bioinformatics
Sequence Alignment In Bioinformatics
 

Similar to Bioinformatics n bio-bio-1_uoda_workshop_4_july_2013_v1.0

Metadata challenges research and re-usable data - BioSharing, ISA and STATO
Metadata challenges research and re-usable data - BioSharing, ISA and STATOMetadata challenges research and re-usable data - BioSharing, ISA and STATO
Metadata challenges research and re-usable data - BioSharing, ISA and STATOAlejandra Gonzalez-Beltran
 
BIOINFORMATICS AND ITS APPLICATIONS IN ENVIRONMENTAL SCIENCE AND HEALTH AND I...
BIOINFORMATICS AND ITS APPLICATIONS IN ENVIRONMENTAL SCIENCE AND HEALTH AND I...BIOINFORMATICS AND ITS APPLICATIONS IN ENVIRONMENTAL SCIENCE AND HEALTH AND I...
BIOINFORMATICS AND ITS APPLICATIONS IN ENVIRONMENTAL SCIENCE AND HEALTH AND I...Dr Varruchi Sharma
 
Bioinformatics issues and challanges presentation at s p college
Bioinformatics  issues and challanges  presentation at s p collegeBioinformatics  issues and challanges  presentation at s p college
Bioinformatics issues and challanges presentation at s p collegeSKUASTKashmir
 
Open science in RIKEN-KI doctorial course on March 20, 2019
Open science in RIKEN-KI doctorial course on March 20, 2019Open science in RIKEN-KI doctorial course on March 20, 2019
Open science in RIKEN-KI doctorial course on March 20, 2019Takeya Kasukawa
 
Semantics for Bioinformatics: What, Why and How of Search, Integration and An...
Semantics for Bioinformatics: What, Why and How of Search, Integration and An...Semantics for Bioinformatics: What, Why and How of Search, Integration and An...
Semantics for Bioinformatics: What, Why and How of Search, Integration and An...Amit Sheth
 
Scott Edmunds: GigaScience - a journal or a database? Lessons learned from th...
Scott Edmunds: GigaScience - a journal or a database? Lessons learned from th...Scott Edmunds: GigaScience - a journal or a database? Lessons learned from th...
Scott Edmunds: GigaScience - a journal or a database? Lessons learned from th...GigaScience, BGI Hong Kong
 
introduction to bioinfromatics.pptx
introduction to bioinfromatics.pptxintroduction to bioinfromatics.pptx
introduction to bioinfromatics.pptxAbelPhilipJoseph
 
2021-01-27--biodiversity-informatics-gbif-(52slides)
2021-01-27--biodiversity-informatics-gbif-(52slides)2021-01-27--biodiversity-informatics-gbif-(52slides)
2021-01-27--biodiversity-informatics-gbif-(52slides)Dag Endresen
 
Open Data in a Global Ecosystem
Open Data in a Global EcosystemOpen Data in a Global Ecosystem
Open Data in a Global EcosystemPhilip Bourne
 
bioinformatics algorithms and its basics
bioinformatics algorithms and its basicsbioinformatics algorithms and its basics
bioinformatics algorithms and its basicssofav88068
 
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in PharmacyVedika Narvekar
 
Ontology for the Financial Services Industry
Ontology for the Financial Services IndustryOntology for the Financial Services Industry
Ontology for the Financial Services IndustryBarry Smith
 
Bioinformatics, its application main
Bioinformatics, its application mainBioinformatics, its application main
Bioinformatics, its application mainKAUSHAL SAHU
 
Data-driven drug discovery for rare diseases - Tales from the trenches (CINF ...
Data-driven drug discovery for rare diseases - Tales from the trenches (CINF ...Data-driven drug discovery for rare diseases - Tales from the trenches (CINF ...
Data-driven drug discovery for rare diseases - Tales from the trenches (CINF ...Frederik van den Broek
 

Similar to Bioinformatics n bio-bio-1_uoda_workshop_4_july_2013_v1.0 (20)

Metadata challenges research and re-usable data - BioSharing, ISA and STATO
Metadata challenges research and re-usable data - BioSharing, ISA and STATOMetadata challenges research and re-usable data - BioSharing, ISA and STATO
Metadata challenges research and re-usable data - BioSharing, ISA and STATO
 
BIOINFORMATICS AND ITS APPLICATIONS IN ENVIRONMENTAL SCIENCE AND HEALTH AND I...
BIOINFORMATICS AND ITS APPLICATIONS IN ENVIRONMENTAL SCIENCE AND HEALTH AND I...BIOINFORMATICS AND ITS APPLICATIONS IN ENVIRONMENTAL SCIENCE AND HEALTH AND I...
BIOINFORMATICS AND ITS APPLICATIONS IN ENVIRONMENTAL SCIENCE AND HEALTH AND I...
 
Bioinformatics issues and challanges presentation at s p college
Bioinformatics  issues and challanges  presentation at s p collegeBioinformatics  issues and challanges  presentation at s p college
Bioinformatics issues and challanges presentation at s p college
 
Open science in RIKEN-KI doctorial course on March 20, 2019
Open science in RIKEN-KI doctorial course on March 20, 2019Open science in RIKEN-KI doctorial course on March 20, 2019
Open science in RIKEN-KI doctorial course on March 20, 2019
 
What are Databases?
What are Databases?What are Databases?
What are Databases?
 
Semantics for Bioinformatics: What, Why and How of Search, Integration and An...
Semantics for Bioinformatics: What, Why and How of Search, Integration and An...Semantics for Bioinformatics: What, Why and How of Search, Integration and An...
Semantics for Bioinformatics: What, Why and How of Search, Integration and An...
 
Basic of bioinformatics
Basic of bioinformaticsBasic of bioinformatics
Basic of bioinformatics
 
Scott Edmunds: GigaScience - a journal or a database? Lessons learned from th...
Scott Edmunds: GigaScience - a journal or a database? Lessons learned from th...Scott Edmunds: GigaScience - a journal or a database? Lessons learned from th...
Scott Edmunds: GigaScience - a journal or a database? Lessons learned from th...
 
introduction to bioinfromatics.pptx
introduction to bioinfromatics.pptxintroduction to bioinfromatics.pptx
introduction to bioinfromatics.pptx
 
2021-01-27--biodiversity-informatics-gbif-(52slides)
2021-01-27--biodiversity-informatics-gbif-(52slides)2021-01-27--biodiversity-informatics-gbif-(52slides)
2021-01-27--biodiversity-informatics-gbif-(52slides)
 
Open Data in a Global Ecosystem
Open Data in a Global EcosystemOpen Data in a Global Ecosystem
Open Data in a Global Ecosystem
 
bioinformatics algorithms and its basics
bioinformatics algorithms and its basicsbioinformatics algorithms and its basics
bioinformatics algorithms and its basics
 
eScience-School-Oct2012-Campinas-Brazil
eScience-School-Oct2012-Campinas-BrazileScience-School-Oct2012-Campinas-Brazil
eScience-School-Oct2012-Campinas-Brazil
 
MST CV 2015A
MST CV 2015AMST CV 2015A
MST CV 2015A
 
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy
5. BIOINFORMATICS.pptx B.Pharm sem 2 Computer Applications in Pharmacy
 
Ontology for the Financial Services Industry
Ontology for the Financial Services IndustryOntology for the Financial Services Industry
Ontology for the Financial Services Industry
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Bioinformatics, its application main
Bioinformatics, its application mainBioinformatics, its application main
Bioinformatics, its application main
 
The Value of Bioinformatics Software
The Value of Bioinformatics SoftwareThe Value of Bioinformatics Software
The Value of Bioinformatics Software
 
Data-driven drug discovery for rare diseases - Tales from the trenches (CINF ...
Data-driven drug discovery for rare diseases - Tales from the trenches (CINF ...Data-driven drug discovery for rare diseases - Tales from the trenches (CINF ...
Data-driven drug discovery for rare diseases - Tales from the trenches (CINF ...
 

More from Fokhruz Zaman

BD-NEA-BASIS-SoftExpo-2011-pres-v1.2
BD-NEA-BASIS-SoftExpo-2011-pres-v1.2BD-NEA-BASIS-SoftExpo-2011-pres-v1.2
BD-NEA-BASIS-SoftExpo-2011-pres-v1.2Fokhruz Zaman
 
Bd ites strategy_paper_final_draft_2008
Bd ites strategy_paper_final_draft_2008Bd ites strategy_paper_final_draft_2008
Bd ites strategy_paper_final_draft_2008Fokhruz Zaman
 
Bd ict research_desk_study_project_tracker_5
Bd ict research_desk_study_project_tracker_5Bd ict research_desk_study_project_tracker_5
Bd ict research_desk_study_project_tracker_5Fokhruz Zaman
 
Bd ict research_desk_study_report_6
Bd ict research_desk_study_report_6Bd ict research_desk_study_report_6
Bd ict research_desk_study_report_6Fokhruz Zaman
 
Addition to desk_study_report
Addition to desk_study_reportAddition to desk_study_report
Addition to desk_study_reportFokhruz Zaman
 
Bd ict research_desk_study_report_presentation_7
Bd ict research_desk_study_report_presentation_7Bd ict research_desk_study_report_presentation_7
Bd ict research_desk_study_report_presentation_7Fokhruz Zaman
 
Hrd in ict_for_db_industry_20.mar.2009_v1.5
Hrd in ict_for_db_industry_20.mar.2009_v1.5Hrd in ict_for_db_industry_20.mar.2009_v1.5
Hrd in ict_for_db_industry_20.mar.2009_v1.5Fokhruz Zaman
 
Ipsaep biz concept_3
Ipsaep biz concept_3Ipsaep biz concept_3
Ipsaep biz concept_3Fokhruz Zaman
 
Idea to innovation_fz_sic_v1.0_30_aug_2013
Idea to innovation_fz_sic_v1.0_30_aug_2013Idea to innovation_fz_sic_v1.0_30_aug_2013
Idea to innovation_fz_sic_v1.0_30_aug_2013Fokhruz Zaman
 
Why big data_for_bd_sid_strategy_workshop_7_sep_2013_fz_v1.5
Why big data_for_bd_sid_strategy_workshop_7_sep_2013_fz_v1.5Why big data_for_bd_sid_strategy_workshop_7_sep_2013_fz_v1.5
Why big data_for_bd_sid_strategy_workshop_7_sep_2013_fz_v1.5Fokhruz Zaman
 
Soft.skills.for.sw.engineers
Soft.skills.for.sw.engineersSoft.skills.for.sw.engineers
Soft.skills.for.sw.engineersFokhruz Zaman
 
Building effective industry_linkage_for_ict_education_fz_v0.5_feb_23_2012
Building effective industry_linkage_for_ict_education_fz_v0.5_feb_23_2012Building effective industry_linkage_for_ict_education_fz_v0.5_feb_23_2012
Building effective industry_linkage_for_ict_education_fz_v0.5_feb_23_2012Fokhruz Zaman
 
Mms datta-isd-prez-v1.7
Mms datta-isd-prez-v1.7Mms datta-isd-prez-v1.7
Mms datta-isd-prez-v1.7Fokhruz Zaman
 

More from Fokhruz Zaman (13)

BD-NEA-BASIS-SoftExpo-2011-pres-v1.2
BD-NEA-BASIS-SoftExpo-2011-pres-v1.2BD-NEA-BASIS-SoftExpo-2011-pres-v1.2
BD-NEA-BASIS-SoftExpo-2011-pres-v1.2
 
Bd ites strategy_paper_final_draft_2008
Bd ites strategy_paper_final_draft_2008Bd ites strategy_paper_final_draft_2008
Bd ites strategy_paper_final_draft_2008
 
Bd ict research_desk_study_project_tracker_5
Bd ict research_desk_study_project_tracker_5Bd ict research_desk_study_project_tracker_5
Bd ict research_desk_study_project_tracker_5
 
Bd ict research_desk_study_report_6
Bd ict research_desk_study_report_6Bd ict research_desk_study_report_6
Bd ict research_desk_study_report_6
 
Addition to desk_study_report
Addition to desk_study_reportAddition to desk_study_report
Addition to desk_study_report
 
Bd ict research_desk_study_report_presentation_7
Bd ict research_desk_study_report_presentation_7Bd ict research_desk_study_report_presentation_7
Bd ict research_desk_study_report_presentation_7
 
Hrd in ict_for_db_industry_20.mar.2009_v1.5
Hrd in ict_for_db_industry_20.mar.2009_v1.5Hrd in ict_for_db_industry_20.mar.2009_v1.5
Hrd in ict_for_db_industry_20.mar.2009_v1.5
 
Ipsaep biz concept_3
Ipsaep biz concept_3Ipsaep biz concept_3
Ipsaep biz concept_3
 
Idea to innovation_fz_sic_v1.0_30_aug_2013
Idea to innovation_fz_sic_v1.0_30_aug_2013Idea to innovation_fz_sic_v1.0_30_aug_2013
Idea to innovation_fz_sic_v1.0_30_aug_2013
 
Why big data_for_bd_sid_strategy_workshop_7_sep_2013_fz_v1.5
Why big data_for_bd_sid_strategy_workshop_7_sep_2013_fz_v1.5Why big data_for_bd_sid_strategy_workshop_7_sep_2013_fz_v1.5
Why big data_for_bd_sid_strategy_workshop_7_sep_2013_fz_v1.5
 
Soft.skills.for.sw.engineers
Soft.skills.for.sw.engineersSoft.skills.for.sw.engineers
Soft.skills.for.sw.engineers
 
Building effective industry_linkage_for_ict_education_fz_v0.5_feb_23_2012
Building effective industry_linkage_for_ict_education_fz_v0.5_feb_23_2012Building effective industry_linkage_for_ict_education_fz_v0.5_feb_23_2012
Building effective industry_linkage_for_ict_education_fz_v0.5_feb_23_2012
 
Mms datta-isd-prez-v1.7
Mms datta-isd-prez-v1.7Mms datta-isd-prez-v1.7
Mms datta-isd-prez-v1.7
 

Recently uploaded

EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEarley Information Science
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘RTylerCroy
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024The Digital Insurer
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking MenDelhi Call girls
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024Results
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationMichael W. Hawkins
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxMalak Abu Hammad
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUK Journal
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreternaman860154
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
Advantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessAdvantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessPixlogix Infotech
 
Real Time Object Detection Using Open CV
Real Time Object Detection Using Open CVReal Time Object Detection Using Open CV
Real Time Object Detection Using Open CVKhem
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Enterprise Knowledge
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsEnterprise Knowledge
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?Igalia
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonetsnaman860154
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...apidays
 

Recently uploaded (20)

EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day Presentation
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptx
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreter
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
Advantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessAdvantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your Business
 
Real Time Object Detection Using Open CV
Real Time Object Detection Using Open CVReal Time Object Detection Using Open CV
Real Time Object Detection Using Open CV
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI Solutions
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonets
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
 

Bioinformatics n bio-bio-1_uoda_workshop_4_july_2013_v1.0

  • 1. Learning Life through Bioinformatics… What is Bioinformatics? What is Bio-Bio-1? Fokhruz Zaman Founder & Evangelist, Bio-Bio-1 4th July, 2013; UODA BI Workshop, Dhaka
  • 2. Learning Life through Bioinformatics… What is Bioinformatics? 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 2
  • 3. Learning Life through Bioinformatics… What is Bioinformatics? Finding patterns in molecular biological data Implies: • managing molecular biological data • identifying correlations in molecular biological data Goals: • characterise biological patterns & processes • predict biological properties 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 3
  • 4. Learning Life through Bioinformatics… Bioinformatics: neighbour disciplines • Computational biology – Broader concept: includes computational ecology, physiology, neurology etc... • -omics: – Genomics – Transcriptomics – Proteomics • Systems biology – Putting it all together... – Building models, identify control & regulation 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 4
  • 5. Learning Life through Bioinformatics… Bioinformatics: prerequisites • Bio- side: – Molecular biology – Cell biology – Genetics – Evolutionary theory • -informatics side: – Computer science – Statistics – Theoretical physics 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 5
  • 6. Learning Life through Bioinformatics… Central Dogma of Molecular Biology GENOTYPE (i.e. Aa) PHENOTYPE (pink) GENE (DNA) MESSENGER (RNA) PROTEIN TRAIT ATGCAAGTCCACTGTATTCCA UACGUUCAGGUGACAUAAGGG transcription reverse tr translation replication 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 6
  • 7. Learning Life through Bioinformatics… Molecular biology data... >al pha- D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCAC CCAGACTGTGGAGCCGAGGCCCTGGAGAGGTGCGGGCTGAGCTTGGGGAAACCATGGGCA AGGGGGGCGACTGGGTGGGAGCCCTACAGGGCTGCTGGGGGTTGTTCGGCTGGGGGTCAG CACTGACCATCCCGCTCCCGCAGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCC CCCACTTCGACTTGCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGG CCGCCTTGGGCAACGCTGTCAAGAGCCTGGGCAACCTCAGCCAAGCCCTGTCTGACCTCA GCGACCTGCATGCCTACAACCTGCGTGTCGACCCTGTCAACTTCAAGGCAGGCGGGGGAC GGGGGTCAGGGGCCGGGGAGTTGGGGGCCAGGGACCTGGTTGGGGATCCGGGGCCATGCC GGCGGTACTGAGCCCTGTTTTGCCTTGCAGCTGCTGGCGCAGTGCTTCCACGTGGTGCTG GCCACACACCTGGGCAACGACTACACCCCGGAGGCACATGCTGCCTTCGACAAGTTCCTG TCGGCTGTGTGCACCGTGCTGGCCGAGAAGTACAGATAA >al pha- A ATGGTGCTGTCTGCCAACGACAAGAGCAACGTGAAGGCCGTCTTCGGCAAAATCGGCGGC CAGGCCGGTGACTTGGGTGGTGAAGCCCTGGAGAGGTATGTGGTCATCCGTCATTACCCC ATCTCTTGTCTGTCTGTGACTCCATCCCATCTGCCCCCATACTCTCCCCATCCATAACTG TCCCTGTTCTATGTGGCCCTGGCTCTGTCTCATCTGTCCCCAACTGTCCCTGATTGCCTC TGTCCCCCAGGTTGTTCATCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACC TGTCACATGGCTCCGCTCAGATCAAGGGGCACGGCAAGAAGGTGGCGGAGGCACTGGTTG AGGCTGCCAACCACATCGATGACATCGCTGGTGCCCTCTCCAAGCTGAGCGACCTCCACG CCCAAAAGCTCCGTGTGGACCCCGTCAACTTCAAAGTGAGCATCTGGGAAGGGGTGACCA GTCTGGCTCCCCTCCTGCACACACCTCTGGCTACCCCCTCACCTCACCCCCTTGCTCACC ATCTCCTTTTGCCTTTCAGCTGCTGGGTCACTGCTTCCTGGTGGTCGTGGCCGTCCACTT CCCCTCTCTCCTGACCCCGGAGGTCCATGCTTCCCTGGACAAGTTCGTGTGTGCCGTGGG CACCGTCCTTACTGCCAAGTACCGTTAA • DNA sequences 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 7
  • 8. Learning Life through Bioinformatics… Molecular biology data... • Amino acid sequences • Protein structure: – X-ray crystallography – NMR (Nuclear Magnetic Resonance) Spectroscopy 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 8
  • 9. Learning Life through Bioinformatics… Cell biology & proteomics data... • Subcellular localization 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 9
  • 10. Learning Life through Bioinformatics… Cell biology & proteomics data... protein-protein interactions 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 10
  • 11. Learning Life through Bioinformatics… DNA microarray technology Transcriptomics: DNA microarray technology 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 11
  • 12. Learning Life through Bioinformatics… Proteomics & transcriptomics data Proteins encoded by periodically expressed genes: a functionally diverse protein category 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 12
  • 13. Learning Life through Bioinformatics… Phenotype data: human diseases 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 13
  • 14. Learning Life through Bioinformatics… Jute Genome Sequencing • Genome sequencing of jute (mystery of origin of jute) disclosed by Bangladeshi Scientists, June 2010 • Opening up a new vista in the development of variety of the world's most biodegradable natural fibre 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 14
  • 15. Learning Life through Bioinformatics… Abiotic Stress tolerance and Crop Improvement 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 15
  • 16. National Plant Genome Initiative (2009-2013) 1. Expand genomic resources for every major plant of economic importance • Understanding of plant epigenomes • Mining plant diversity • Survey sequence resources for thousands of plants • A new kind of reference genome • Integrated comparative sequence resources 2. Advance plant systems biology • Toolkits to enable systems-level analysis of key plant processes •Regulation of plant structure and composition 3. Translate basic discovery to the field • High-throughput phenotyping under field conditions • Breeding for improved local adaptation to biotic and abiotic stress • A National Genetic Trait Index
  • 17. Learning Life through Bioinformatics… Ref: Shortliffe, 1995 Bioinformatics & Human Health 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 17
  • 18. Learning Life through Bioinformatics… Bioinformatics as in-silico biology - generates testable hypotheses for the biologist - explores domains that can not be addressed experimentally Translational Bioinformatics / Medicine 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 18
  • 19. Learning Life through Bioinformatics… Bioinformatics & Human Health 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 19
  • 20. Learning Life through Bioinformatics… Would we want to live longer, healthier? Would we benefit from better crops? Bioinformatics Why Bioinformatics? 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 20
  • 21. Learning Life through Bioinformatics… Traditional Methods of Drug Discovery natural (plant-derived) treatment for illness / ailments ↓ isolation of active compound (small, organic) 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 21
  • 22. Learning Life through Bioinformatics… synthesis of compound ↓ manipulation of structure to get better drug (greater efficacy, fewer side effects) Aspirin Traditional Methods of Drug Discovery 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 22
  • 23. Learning Life through Bioinformatics… Modern Methods of Drug Discovery What’s different? • Drug discovery process begins with a disease (rather than a treatment) • Use disease model to pinpoint relevant genetic / biological components (i.e. possible drug targets) 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 23
  • 24. Learning Life through Bioinformatics… Modern Drug Discovery disease → genetic / biological target ↓ discovery of a “lead” molecule - design assay to measure function of target - use assay to look for modulators of target’s function ↓ high throughput screen (HTS) - to identify “hits” (compounds with binding in low nM to low μM range) 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 24
  • 25. Learning Life through Bioinformatics… small molecule hits ↓ manipulate structure to increase potency i.e. decrease Ki to low nM affinity ↓ *optimization of lead molecule into candidate drug* fulfillment of required pharmacological properties: potency, absorption, bioavailability, metabolism, safety ↓ clinical trials Modern Drug Discovery 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 25
  • 26. Learning Life through Bioinformatics… Interesting facts... • Over 90% of drugs entering clinical trials fail to make it to market • The average cost to bring a new drug to market is estimated at $770 million 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 26
  • 27. Learning Life through Bioinformatics… Drug discovery and development • It costs in Billions USD and takes ~ 11 years • In 2010, to bring a new Drug to Market was USD 1.2 Billion • 4 out of 5 drugs fails during 1st Phase of Clinical trials In-silico methods • save an average of $130 million and 0.8 years per drug (2003) 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 27
  • 28. Learning Life through Bioinformatics… Beowulf Cluster Computing Each Computer in the cluster is equipped with: – Intel Core 2 Duo 6400 Processor(Master: Core 2 Duo 6700) – 2 Gigabytes of DDR RAM in Dual Channel – D-Link Gigabyte Network Interface Card(Master: 2x Cards) – 60 Gigabyte Hard Drive(Master: 1000 Gigabyte RAID 5) Sample Cluster Computer CLUSTER USES: Clusters have a variety of different applications in the world. They are used in bioinformatics to run DNA string matching algorithms or to run protein folding applications. Geologists also use clusters to emulate and predict earthquakes and model the interior of the Earth and sea floor Clusters are even used to render and manipulate high-resolution graphics in engineering. Our completed Beowulf cluster will use a computer algorithm known as BLAST, (Basic Local Alignment Search Tool), to analyze massive sets of DNA sequences for research into Bioinformatics. Researcher: Ben Case Researcher: Stephen Ciesla Advisor: Ed Harcout Biology Consultant: Lorraine Olendzenski Node Computers Master Computer PROJECT: We constructed a parallel processing computer system using the Beowulf cluster computing design created at NASA in an attempt to build a powerful computer that could assist in Bioinformatics research and data analysis. BEOWULF CLUSTERS: A Beowulf Cluster is a computer design that uses parallel processing across multiple computers to create cheap and powerful supercomputers. A Beowulf Cluster in practice is usually a collection of generic computers, either stock systems or wholesale parts purchased independently and assembled, connected through an internal network. A cluster has two types of computers, a master computer, and node computers. When a large problem or set of data is given to a Beowulf cluster, the master computer first runs a program that breaks the problem into small discrete pieces; it then sends a piece to each node to compute. As nodes finish their tasks, the master computer continually sends more pieces to them until the entire problem has been computed. MPICH2: In order for the master and node computers to communicate, some sort message passing control structure is required. MPI,(Message Passing Interface) is the most commonly used such control, and the one that we've incorporated into our project. MPICH2 is a implementation of MPI that was specifically designed for use with cluster computing systems and parallel processing. It is an open source set of libraries for various high level programming languages that give programmers tools to easily control how large problems are broken apart and distributed to the various computers in a cluster. OUR CLUSTER: Using funding from the Biology department, the cluster we constructed contains eight computers with one master and seven node computers. Each computer in the cluster contains a dual core processor, giving us a total of 16 processors to utilize. Each runs on the Fedora Core 6 version of Linux and uses the MPICH2 libraries for message passing. They are all connected on a internal network through a high speed gigabyte switch. 2 GB RAM SATA Hard Drives D-Link NetworkIntel Core 2 RESULTS: The total processing power of our cluster has yet to be determined. Once the cluster has been completely streamlined and stabilized, we will run benchmark tests to calculate its average and peak performances CLUSTER LAYOUT AND DESIGN: 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 28
  • 29. Learning Life through Bioinformatics…Expertiselevel SYS ALGO STAT VERB LUCKBIO apprentice ~ 2,000 hours mastery ~ 10,000 hours critical weakness – below freshman level knowledge Let’s ALL try to be Bioinformaticians! 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 29
  • 30. Learning Life through Bioinformatics… SYS ALGO STAT VERB LUCK (Serendipity) BIO Let’s ALL try to be Bioinformaticians! SYStems: ability to identify, understand, run, troubleshoot existing bioinformatics tools and techniques. (near mastery skill needed ASAP) ALGOrithms: ability to create a new algorithm or to implement these as a software tool. (near freshman skill needed to start) STATistics: ability to identify proper statistical method and to devise a new statistical approach to extract knowledge from data. (above apprentice skill needed ASAP) BIOlogy: ability to interpret bioinformatics results in the proper biological context. (well above apprentice skill needed ASAP) VERBal: ability to understand the needs of individuals from diverse backgrounds and ability to communicate with them with their discipline language. (near mastery skill needed ASAP) LUCK: ability to be in the right place at the right time and have the skill to work on unexpected tasks. (CHANCE favors ONLY the Prepared Minds !!!) 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 30
  • 31. Learning Life through Bioinformatics… Five websites that all Bioinformaticians should know • NCBI (The National Center for Biotechnology Information) – http://www.ncbi.nlm.nih.gov/ • EBI (The European Bioinformatics Institute) – http://www.ebi.ac.uk/ • The Canadian Bioinformatics Resource – http://www.cbr.nrc.ca/ • SwissProt/ExPASy (Swiss Bioinformatics Resource) – http://expasy.cbr.nrc.ca/sprot/ • PDB (The Protein Databank) – http://www.rcsb.org/PDB/ 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 31
  • 32. Learning Life through Bioinformatics… • First: – Fix your Critical weakness. • Second: – Where should you invest next? • To strengthen your stronger skills? … Or … • To improve on your weaker skills? • Answer ??? Continued……. Let’s ALL try to be Bioinformaticians! 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 32
  • 33. Learning Life through Bioinformatics…  Invest into what you are already good at!  People with complementary skill-sets are more valuable  Differentiate yourself  Pick a paper that interests you and redo it!  Compute the same quantities for a different genome/annotations Strengthen Your Stronger Skills 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 33
  • 34. Learning Life through Bioinformatics… So… what is Bio-Bio-1? • A TEAM with Passion for Learning Life through Bioinformatics Knowledge and Skills… • A TEAM with BIG Dreams to help flourishing the Bioinformatics discipline in Bangladesh and in the World… • A voluntary not-for-profit organization, formed by some passionate individuals in the late 2008 to learn Bioinformatics for making some senses from the enigma of life. • Aims to spread the R&D excitement by infecting the young individuals through several programs (weekly study circles, workshops, etc) 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 34
  • 35. Learning Life through Bioinformatics… Bio-Bio-1 Main Objectives • Learn Bioinformatics from closely interacting multiple academic and professional disciplines, including: – Life Sciences, Computing Sciences, Mathematics, Statistics, Software Engineering, High Performance Computing and Large Scale Database optimization • Popularize and spread the need for Bioinformatics learning among the local students and professionals in Bangladesh. • Procure offshore sourcing programming and development projects in Bioinformatics from abroad. • Write practical handbooks in Bioinformatics and publish papers in reputed journals. 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 35
  • 36. Learning Life through Bioinformatics… Bio-Bio-1 Current Main Activities • Organizing regular weekly Bioinformatics Study Circle – Every Saturday at KAL Gallery, Dept. of Biochemistry and Molecular Biology, University of Dhaka. • Organizing Hands-On Bioinformatics Boot Camps & Workshops. • Collaboratively working with Microbial Genetics and Bioinformatics Lab, Dept. of Microbiology, University of Dhaka for the projects: – “FMDV vaccine design and development” with Prof. Dr. Anwar Hossain. – and with Prof. Dr. Mojammel Hoque, to identify the factors that increase the productivity and enzyme activity of protease and keratinase of Bacillus Licheniformis. 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 36
  • 37. Learning Life through Bioinformatics… • Zohirul Alam Tiemoon – Founder and General Manager, Bio-Bio-1 Consultant, BASIS (www.basis.org.bd), Dhaka. – Leading the Bio-Bio-1 v3.0 with new vigor! • Saddam Hossain – Founding Core Member and Chief Researcher, Bio-Bio-1. Head, Business Intelligence, Airtel Bangladesh – Re-incarnated Bio-Bio-1 from long hibernation! Leading the R&D Projects both in Bio-Bio-1 v2.0 and v3.0! • Farjana Khatun – Founding Core Member and Coordinator, Bio-Bio-1. Lecturer, Department of Pharmacy, East West University – The Pioneer Biology knowledge provider in Bio-Bio-1. Patient and Persistent Coordinator! 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 37 Bio-Bio-1 Prime Movers (& Shakers) 
  • 38. Learning Life through Bioinformatics… Bio-Bio-1 Prime Movers (& Shakers)  • Mosharraf Hossain – Core Member and Coordinator, Bio-Bio-1. Head, Operations Support System & Business Support System, Novo Tel Ltd. – Passionate Mentor for the Bio-Bio-1 Study Circle Participants! • Arafat Rahman – Core Member and Researcher, Bio-Bio-1. Research Student, Microbial Genetics and Bioinformatics Lab, Dept. of Microbiology, University of Dhaka. – Great Analytical Mind with knowledge and interest in diverse scientific disciplines! Still a great Bio-Bio-1 Anchor! • Arif Ashraf Opu – Core Member and Researcher, Bio-Bio-1. Research Student, Plant Biotechnology Lab, University of Dhaka – Great Out-of-the-Box Thinker with lucid Presentation Skills! 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 38
  • 39. Learning Life through Bioinformatics… Credits / Acknowledgments • www.cbs.dtu.dk/phdcourse/cookbooks/What_is_bioin • Prof. Zeba Islam Seraj, Professor, Dept of Biochemistry and Molecular Biology, Dhaka University • Prof. Supten Sarbadhikary, India - Chair, HL7 India, Visiting Professor, Dept of Health Informatics, Bangladesh University of Health Sciences • The Bio-Bio-1 CORE TEAM • The Google & The WWW 4th July, 2013 Bioinformatics Workshop @ UODA, Dhaka 39
  • 40. Learning Life through Bioinformatics… Thank You very much for all your time and patience  Hope You will enjoy this 2-days workshop in UODA!

Editor's Notes

  1. Bio-Bio-1 is a voluntary not-for-profit organization, formed by some passionate individuals in late 2008 to learn Bioinformatics for making some senses from the enigma of life. It also aims to spread the excitement of Research and Development by infecting the like-minded individuals (especially the young ones) through several programs (i.e.: weekly study circles).