SlideShare une entreprise Scribd logo
1  sur  30
A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations Paul Fisher Dr. Robert Stevens Prof. Andrew Brass
[object Object],Genotype DNA ACTGCACTGACTGTACGTATATCT ACTGCACTG TG TGTACGTATATCT Mutations Genes
[object Object],[object Object],Phenotype vs. Brown White and Brown
Genotype  to  Phenotype
Genotype Phenotype ? Current Methods 200 What processes to investigate?
? 200 Microarray + QTL Genes captured in microarray experiment and present in QTL ( Quantitative Trait Loci  )  region Genotype Phenotype Metabolic pathways Phenotypic response investigated using microarray in form of expressed genes or evidence provided through QTL mapping
CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype
Issues with current approaches
Huge amounts of data 200+ Genes QTL region on chromosome Microarray 1000+ Genes How do I look at ALL the genes systematically?
Hypothesis-Driven Analyses 200 QTL genes Case: African Sleeping sickness - parasitic infection - Known immune response Pick the genes involved in immunological process 40 QTL genes Pick the genes that I am most familiar with 2 QTL genes Biased view ,[object Object],[object Object],[object Object],[object Object]
Manual Methods of data analysis Navigating through hyperlinks No explicit methods Human error Tedious and repetitive
Implicit methods
Issues with current approaches ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
The Two W’s ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Taverna Workflow Workbench http://taverna.sf.net
Hypothesis ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
Replicated original chain of data analysis
Trypanosomiasis in Africa http://www.genomics.liv.ac.uk/tryps/trypsindex.html Andy Brass Steve Kemp + many Others
Preliminary Results ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Shameless Plug! ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Recycling, Reuse, Repurposing ,[object Object],[object Object],[object Object],Here’s the  Science ! Here’s the  e-Science ! ,[object Object],[object Object],[object Object],Workflows now being run over  Colitis/ Inflammatory Bowel Disease in Mice   (without change)
Recycling, Reuse, Repurposing http://www.myexperiment.org/ ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
What next? ,[object Object],[object Object],[object Object],[object Object],[object Object]
Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype DONE MANUALLY
It can’t be that hard, right? ,[object Object],[object Object],[object Object],Computers can help with data gathering and information extraction – that’s their job !!!
Text Mining ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],NOT A REPLACEMENT FOR  DOMAIN EXPERTISE
To Sum Up …. ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Many thanks to: including: Joanne Pennock, EPSRC, OMII, myGrid, and lots more people

Contenu connexe

Tendances (20)

Gene mapping tools
Gene mapping toolsGene mapping tools
Gene mapping tools
 
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCINGNEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCING
 
PRIYA GARKOTI.pptx
PRIYA GARKOTI.pptxPRIYA GARKOTI.pptx
PRIYA GARKOTI.pptx
 
Physical maps and their use in annotations
Physical maps and their use in annotationsPhysical maps and their use in annotations
Physical maps and their use in annotations
 
Microsatellite
MicrosatelliteMicrosatellite
Microsatellite
 
molecular markers
 molecular markers molecular markers
molecular markers
 
QTL
QTLQTL
QTL
 
Mitochondrial dna
Mitochondrial   dnaMitochondrial   dna
Mitochondrial dna
 
RNA-Seq
RNA-SeqRNA-Seq
RNA-Seq
 
Integrative omics approches
Integrative omics approches   Integrative omics approches
Integrative omics approches
 
artificial neural network-gene prediction
artificial neural network-gene predictionartificial neural network-gene prediction
artificial neural network-gene prediction
 
Molecular marker
Molecular markerMolecular marker
Molecular marker
 
Introduction to Proteogenomics
Introduction to Proteogenomics Introduction to Proteogenomics
Introduction to Proteogenomics
 
SNP Genotyping Technologies
SNP Genotyping TechnologiesSNP Genotyping Technologies
SNP Genotyping Technologies
 
Whole genome sequencing of bacteria & analysis
Whole genome sequencing of bacteria & analysisWhole genome sequencing of bacteria & analysis
Whole genome sequencing of bacteria & analysis
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
 
Gene mapping
Gene  mappingGene  mapping
Gene mapping
 
Gene expression profiling
Gene expression profilingGene expression profiling
Gene expression profiling
 
Single nucleotide polymorphism
Single nucleotide polymorphismSingle nucleotide polymorphism
Single nucleotide polymorphism
 
SNP Detection Methods and applications
SNP Detection Methods and applications SNP Detection Methods and applications
SNP Detection Methods and applications
 

En vedette

Genotypes and phenotypes
Genotypes and phenotypesGenotypes and phenotypes
Genotypes and phenotypesRosio DeLeon
 
Intro to genetics ppt
Intro to genetics pptIntro to genetics ppt
Intro to genetics pptmrimbiology
 
Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...Human Variome Project
 
Genetic Basis of Inheritance
Genetic Basis of InheritanceGenetic Basis of Inheritance
Genetic Basis of InheritanceKISHOR SAWAIKAR
 
Jay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in TransplantationJay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in TransplantationVall d'Hebron Institute of Research (VHIR)
 
Functions of nucleus
Functions of nucleusFunctions of nucleus
Functions of nucleusMohsin Shad
 
Formal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural GenomesFormal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural Genomesmadalladam
 
UTB - Project Perigee Presentation
UTB - Project Perigee PresentationUTB - Project Perigee Presentation
UTB - Project Perigee Presentationtommygober
 
L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_MUBOSScz
 
Wireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commerceWireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commercedesma abi
 
Incomplete and codominance
Incomplete and codominanceIncomplete and codominance
Incomplete and codominanceRosio DeLeon
 
Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis S'eclairer
 
Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)vanessawhitehawk
 

En vedette (20)

Genotypes and phenotypes
Genotypes and phenotypesGenotypes and phenotypes
Genotypes and phenotypes
 
Intro to genetics ppt
Intro to genetics pptIntro to genetics ppt
Intro to genetics ppt
 
Genotype
GenotypeGenotype
Genotype
 
Genotype and phenotype
Genotype and phenotypeGenotype and phenotype
Genotype and phenotype
 
Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...
 
Genetic Basis of Inheritance
Genetic Basis of InheritanceGenetic Basis of Inheritance
Genetic Basis of Inheritance
 
11 u mutations
11 u mutations11 u mutations
11 u mutations
 
B10vrv4133
B10vrv4133B10vrv4133
B10vrv4133
 
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
 
Jay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in TransplantationJay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in Transplantation
 
Phyto-oils
Phyto-oilsPhyto-oils
Phyto-oils
 
Functions of nucleus
Functions of nucleusFunctions of nucleus
Functions of nucleus
 
Formal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural GenomesFormal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural Genomes
 
Inclination
InclinationInclination
Inclination
 
UTB - Project Perigee Presentation
UTB - Project Perigee PresentationUTB - Project Perigee Presentation
UTB - Project Perigee Presentation
 
L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_
 
Wireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commerceWireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commerce
 
Incomplete and codominance
Incomplete and codominanceIncomplete and codominance
Incomplete and codominance
 
Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis
 
Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)
 

Similaire à A systematic approach to Genotype-Phenotype correlations

How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationJoaquin Dopazo
 
STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...Lars Juhl Jensen
 
PadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptxPadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptxDESMONDEZIEKE1
 
INBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision
 
Gene hunting strategies
Gene hunting strategiesGene hunting strategies
Gene hunting strategiesAshfaq Ahmad
 
BIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesBIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesAmos Watentena
 
Genome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleGenome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleLaurence Dawkins-Hall
 
OKC Grand Rounds 2009
OKC Grand Rounds 2009OKC Grand Rounds 2009
OKC Grand Rounds 2009Sean Davis
 
Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Joaquin Dopazo
 
Introducción a la bioinformatica
Introducción a la bioinformaticaIntroducción a la bioinformatica
Introducción a la bioinformaticaMartín Arrieta
 
Bioinformatics
BioinformaticsBioinformatics
BioinformaticsAmna Jalil
 
bioinformatics simple
bioinformatics simple bioinformatics simple
bioinformatics simple nadeem akhter
 
Transgenic animal models & their
Transgenic animal models & theirTransgenic animal models & their
Transgenic animal models & theirkalpanatiwari17
 
From reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingFrom reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingJoaquin Dopazo
 
A New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicA New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicJoaquin Dopazo
 
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...Seattle DAML meetup
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation SequencingAamir Wahab
 
provenance of microarray experiments
provenance of microarray experimentsprovenance of microarray experiments
provenance of microarray experimentsHelena Deus
 

Similaire à A systematic approach to Genotype-Phenotype correlations (20)

How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical information
 
STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...
 
PadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptxPadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptx
 
INBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria López
 
Gene hunting strategies
Gene hunting strategiesGene hunting strategies
Gene hunting strategies
 
BIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesBIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And Challenges
 
Genome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleGenome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattle
 
OKC Grand Rounds 2009
OKC Grand Rounds 2009OKC Grand Rounds 2009
OKC Grand Rounds 2009
 
Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...
 
Introducción a la bioinformatica
Introducción a la bioinformaticaIntroducción a la bioinformatica
Introducción a la bioinformatica
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
bioinformatics simple
bioinformatics simple bioinformatics simple
bioinformatics simple
 
Transgenic animal models & their
Transgenic animal models & theirTransgenic animal models & their
Transgenic animal models & their
 
From reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingFrom reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene finding
 
rheumatoid arthritis
rheumatoid arthritisrheumatoid arthritis
rheumatoid arthritis
 
A New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicA New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The Clinic
 
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
 
provenance of microarray experiments
provenance of microarray experimentsprovenance of microarray experiments
provenance of microarray experiments
 
ASHG_2014_AP
ASHG_2014_APASHG_2014_AP
ASHG_2014_AP
 

Dernier

Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processorsdebabhi2
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonetsnaman860154
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 
Real Time Object Detection Using Open CV
Real Time Object Detection Using Open CVReal Time Object Detection Using Open CV
Real Time Object Detection Using Open CVKhem
 
🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘RTylerCroy
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationRadu Cotescu
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdfhans926745
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreternaman860154
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Enterprise Knowledge
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUK Journal
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slidespraypatel2
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfsudhanshuwaghmare1
 
Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slidevu2urc
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024The Digital Insurer
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Igalia
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsJoaquim Jorge
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxMalak Abu Hammad
 
What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?Antenna Manufacturer Coco
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEarley Information Science
 

Dernier (20)

Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonets
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
Real Time Object Detection Using Open CV
Real Time Object Detection Using Open CVReal Time Object Detection Using Open CV
Real Time Object Detection Using Open CV
 
🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreter
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slides
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
 
Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slide
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and Myths
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptx
 
What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?What Are The Drone Anti-jamming Systems Technology?
What Are The Drone Anti-jamming Systems Technology?
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
 

A systematic approach to Genotype-Phenotype correlations

  • 1. A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations Paul Fisher Dr. Robert Stevens Prof. Andrew Brass
  • 2.
  • 3.
  • 4. Genotype to Phenotype
  • 5. Genotype Phenotype ? Current Methods 200 What processes to investigate?
  • 6. ? 200 Microarray + QTL Genes captured in microarray experiment and present in QTL ( Quantitative Trait Loci ) region Genotype Phenotype Metabolic pathways Phenotypic response investigated using microarray in form of expressed genes or evidence provided through QTL mapping
  • 7. CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype
  • 8. Issues with current approaches
  • 9. Huge amounts of data 200+ Genes QTL region on chromosome Microarray 1000+ Genes How do I look at ALL the genes systematically?
  • 10.
  • 11. Manual Methods of data analysis Navigating through hyperlinks No explicit methods Human error Tedious and repetitive
  • 13.
  • 14.
  • 15. Taverna Workflow Workbench http://taverna.sf.net
  • 16.
  • 17. Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
  • 18. Replicated original chain of data analysis
  • 19. Trypanosomiasis in Africa http://www.genomics.liv.ac.uk/tryps/trypsindex.html Andy Brass Steve Kemp + many Others
  • 20.
  • 21.
  • 22.
  • 23.
  • 24.
  • 25. Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
  • 26. CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype DONE MANUALLY
  • 27.
  • 28.
  • 29.
  • 30. Many thanks to: including: Joanne Pennock, EPSRC, OMII, myGrid, and lots more people

Notes de l'éditeur

  1. Title slide A Systematic approach to large-scale analysis Genotype-Phenotype correlations