I tried to integrate basic and important concepts of evolution from different ppt that can be downloaded here in slideshare to have a consolidated theme about evolution.

1. Prepared by: Ms. IRISH M. SEQUIHOD

2. Essential Questions
• Be able to describe how the earth is “just
right” for life
• What are the evidences of evolution?
• What is evolution? How has evolution lead to
the current diversity of organisms?
• What is an ecological niche? How does it
relate to adaptation to changing
environmental conditions?
• How do extinction of species and formation of
new species affect biodiversity?

3. A Theory or a Fact?

4. Evolution as Theory and Fact
• Confusion sometimes arises as to
• whether Evolution is a theory or a fact.
• Actually it is both!
• The theory of Evolution deals with how
• Evolution happens. Our understanding
• of this process is always changing.
• Evolution is also a fact as there is a
• huge amount of indisputable evidence
• for its occurrence.

5. The Earth: The PERFECT PLANET
• Temperature
– Distance from Sun
– Geothermal energy from core
– Temperature fluctuated only 10-20oC over 3.7
billion years despite 30-40% increase in solar
output
• Water exists in 3 phases
• Right size (=gravitational mass to keep atmosphere)
• Resilient and adaptive
• Each species here today represents a long chain of
evolution and each plays a role in its respective
ecosystem

6. Summary of Evolution of Life
Chemical Evolution
(1 billion years)
Formation Small Large First
of the organic organic protocells
earth’s molecules molecules form in
early form in (biopolymers) the seas
crust and the seas form in
atmosphere the seas
Biological Evolution
(3.7 billion years)
Single-cell Single-cell Variety of
prokaryotes eukaryotes multicellular
form in form in organisms
the seas the seas form, first
in the seas
and later
on land

7. Biological Evolution
Modern humans (Homo sapiens)
appear about 2 seconds before
midnight
Age of Recorded human history begins
Age of mammals 1/4 second before midnight
reptiles
Insects and Origin of life (3.6–3.8 billion years ago)
amphibians
invade the
land
Plants
invade
the land
Fossils
become
abundant
Fossils
present Evolution and
but rare expansion of life

8. Evidence (1): Biochemistry
• The basic similarity of all living things suggests
• that they evolved from a single common
ancestor.
• As we have already seen, all living things pass
• on information from generation to generation
• using the DNA molecule.
• All living things also use a molecule
• called ATP to carry
DNA for • energy around the ATP for
Information
Transfer • organism. Energy
Transfer

9. Evidence (2): Similar Genes
HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
Genetic code of chimps and gorillas is almost identical to humans
• If evolution is true then we might also expect that closely
related organisms will be more similar to one another than
more
distantly related organisms.
• Comparison of the human genetic code with that of other
organisms show that chimpanzees are nearly genetically
identical
(differ by less than 1.2%) whereas the mouse differs by ≈15%.

10. Evidence (3): Comparative Anatomy
• Similar comparisons can be made
based on anatomical evidence.
• The skeleton of humans and
gorillas are very similar suggesting
they shared a recent common
ancestor, but very different from the
more distantly related
woodlouse…
yet all have a common
Human and Gorilla shared characteristic:
bilateral symmetry Woodlouse

11. Evidence (4): Homology
The pentadactyl limb
is ancestral to all
vertebrates…
but modified for different uses

12. Evidence (5): Vestigial Structures
• As evolution progresses, some
structures get side-lined as they
are not longer of use. These
are known as vestigial structures.
• The coccyx is a much reduced
version of an ancestral tail, which
was formerly adapted to aid
balance and climbing.
The coccyx is a vestigial tail • Another vestigial structure in
humans is the appendix.

13. Evidence (6): Fossil Record
The fossil record shows a sequence from simple bacteria to
more complicated organisms through time and provides the most
compelling evidence for evolution.

14. Fossil formation
There are many ways in which an organism can be fossilised
One of these ways is shown in the next sequence of slides
In principle, a fossil is formed when an organism dies, its body is
enclosed in mud, or sand. The soft parts decay but some of
the hard parts (skeleton, shells, seeds) are preserved
The mud or sand eventually becomes rock and the hard parts of the
organism are mineralised.
When the rock is exposed as a result of earth movements or erosion,
the fossil remains can be dug out and studied.

15. 4
The sediment eventually becomes rock
Fish B becomes a fossil much later than fish A
The deeper the rock layer, the older the fossil
Living fish B
Dies
Enclosed in sediment
Hard parts fossilised
Living fish A
Dies
Enclosed in sediment
Hard parts fossilised

17. 6
more recent sediment collects
older sediment
becomes rock fish skeleton fossilised

18. 7
land raised above
water level
recent rock
older rock

19. 8
fossilised skeleton exposed
earth movements
fracture rock

20. Evidence (7): Transitional fossils
• Many fossils show a clear
transition from one species,
or group, to another.
• Archaeopteryx was found
in Germany in 1861. It
share many characteristics
with both dinosaurs and
birds.
Archaeopteryx • It provides good evidence
that birds arose from
dinosaur ancestors

21. Evidence (8): Geography
• Geographic spread of
organisms also tells of
their past evolution.
• Marsupials occur in
two populations today
in the Americas and
Australia.
• This shows the group
evolved before the
continents drifted apart

22. Evidence (9): Antibiotic resistance
Staphylococcus
• We are all familiar with
the way that certain
bacteria can become
resistant to antibiotics
• This is an example of natural selection in
action. The antibiotic acts as an
environmental pressure. It weeds out
those bacteria with low resistance and
only those with high resistance survive
to reproduce.

23. Charles Darwin
• Evolution, or change over
time, is the process by
which modern organisms
have descended from
ancient organisms.
• A scientific theory is a well-
supported testable
explanation of phenomena
that have occurred in the
natural world.

24. Voyage of the Beagle

25. Voyage of the Beagle
• Dates: February 12th, 1831
• Captain: Charles Darwin
• Ship: H.M.S. Beagle
• Destination: Voyage around the world.
• Findings: evidence to propose a revolutionary
hypothesis about how life changes over time

26. Voyage of the Beagle

27. Patterns of Diversity
• Darwin visited Argentina and Australia which
had similar grassland ecosystems.
– those grasslands were inhabited by very different
animals.
– neither Argentina nor Australia was home to the
sorts of animals that lived in European grasslands.

28. Patterns of Diversity
• Darwin posed challenging questions.
– Why were there no rabbits in Australia, despite
the presence of habitats that seemed perfect for
them?
– Why were there no kangaroos in England?

29. Living Organisms and Fossils
• Darwin collected the preserved remains of
ancient organisms, called fossils.
• Some of those fossils resembled organisms
that were still alive today.
Others looked completely unlike any creature he had
ever seen.
• As Darwin studied fossils, new questions arose.
– Why had so many of these species disappeared?
– How were they related to living species?

30. The Galapagos Island
• The smallest, lowest islands were hot, dry, and nearly
barren-Hood Island-sparse vegetation
• The higher islands had greater rainfall and a different
assortment of plants and animals-Isabela- Island had
rich vegetation.
• Darwin was fascinated in particular by the land
tortoises and marine iguanas in the Galápagos.
• Giant tortoises varied in predictable ways from one
island to another.
• The shape of a tortoise's shell could be used to identify
which island a particular tortoise inhabited.

31. The Galapagos Island

32. Animals found in the Galapagos
• Land Tortoises
• Darwin Finches
• Blue-Footed Booby
• Marine Iguanas

33. The Journey Home
• Darwin Observed that characteristics of many
plants and animals vary greatly among the
islands
• Hypothesis: Separate species may have arose
from an original ancestor

34. Ideas that shaped Darwin’s Thinking
• James Hutton:
• 1795 Theory of
Geological change
– Forces change
earth’s surface
shape
– Changes are slow
– Earth much older
than thousands of
years

35. Ideas that shaped Darwin’s Thinking
• Charles Lyell
• Book: Principles of
Geography
• Geographical
features can be built
up or torn down
• Darwin thought if
earth changed over
time, what about
life?

36. Ideas that shaped Darwin’s Thinking
Population Growth
• Thomas Malthus-19th
century English
economist
• If population grew
(more Babies born
than die)
– Insufficient living
space
– Food runs out
– Darwin applied this
theory to animals

37. Discovery (1) Fixed species
From Classical times until long after the Renaissance, species
were considered to be special creations, fixed for all time.

38. Discovery (2): Transmutation
• Around 1800, scientists began to
wonder whether species could
change or transmute.
• Lamarck thought that if an animal
acquired a characteristic during its
lifetime, it could pass it onto its
offspring.
• Hence giraffes got their long necks
through generations of straining to
Jean Baptiste de Lamarck reach high branches.
commons.wikimedia.org/wiki/Image:Jean-baptiste_lamarck2.jpg
en.wikipedia.org/wiki/Image:Giraffe_standing.jpg

40. Discovery (3): Fossils and Strata
http://en.wikipedia.org/wiki/ http://en.wikipedia.org/wiki/Image: http://en.wikipedia.org/wiki/Image:Smith_fossils2.jpg
ImageWilliam_Smith.g.jpg Geological_map_of_Great_Britain.jpg
William Smith, his geology map & some of his fossil specimens
At about the same time, geologists like William Smith were
mapping the rocks and fossils of Britain. He and others showed
that different species existed in the past compared with today.

41. Discovery (4): Darwin’s Voyage
• From 1831-1836, a
young naturalist called
Charles Darwin toured
the world in HMS
Beagle.
• He was dazzled by the
amazing diversity of
life and started to
wonder how it might
Voyage of the Beagle have originated
en.wikipedia.org/wiki/Image:Charles_Darwin_by_G._Richmond.jpg
en.wikipedia.org/wiki/Image:HMS_Beagle_by_Conrad_Martens.jpg

42. Discovery (5): Survival of the Fittest
• In his Origin of Species, Natural Selection
explains adaption
published in 1859, Darwin
proposed how one species
might give rise to another.
• Where food was limited,
competition meant that only
the fittest would survive.
• This would lead to the natural selection
of the best adapted individuals and
eventually the evolution of a new species.
Darwin in 1860
en.wikipedia.org/wiki/Image:Darwin%27s_finches.jpeg

43. Discovery (6): Huxley v. Wilberforce
• Darwin’s idea of
Evolution by Natural
Selection was met with
huge controversy.
• A famous debate in
1860 pitted Bishop
Wilberforce against
Darwin’s bulldog,
Bishop Wilberforce v. T. H. Huxley Thomas Henry Huxley.
• Evolutionists got the better of the debate, but few were convinced
by Darwin’s idea of Natural Selection.
www.bbc.co.uk/religion/galleries/spiritualhistory/images/9.jpg

44. Discovery (7): Genetics
Mendel and his peas • From 1856-63, a monk called Gregor
Mendel cultivated 29,000 pea plants
to investigate how evolution worked
i.e., how characteristics were passed
down the generations.
• He figured out the basic principles of
genetics. He showed that offspring
received characteristics from both
parents, but only the dominant
characteristic trait was expressed.
Mendel’s work only came to light in
1900, long after his death
en.wikipedia.org/wiki/Image:Mendel.png
en.wikipedia.org/wiki/Image:Doperwt_rijserwt_peulen_Pisum_sativum.jpg

45. Discovery (8): Making Sense
• In the early 20th century, scientist started to
make sense of how evolution worked.
• Building on Mendel’s genetics, studies
showed how characteristics in a population
could be selected by environmental
pressures.
Julian Huxley • This Modern Synthesis, as Julian Huxley
and the called it, brought Darwin’s Natural Selection
Modern Synthesis back to the centre of evolutionary theory.
en.wikipedia.org/wiki/Image:Hux-Oxon-72.jpg

46. Discovery (9): Opposition
• Despite the achieval of
scientific consensus on
evolution, some Christian
groups continued to
oppose the concept.
• In 1925, the teaching of
evolution was outlawed
in Tennessee, USA,
resulting in the infamous
Outside the Scopes Trial Scopes Monkey Trial
www.templeton-cambridge.org/fellows/vedantam/publications/2006.02.05/eden_and_evolution/

47. Discussion: Should Creationism and Evolution
be given equal time in science lessons?
science.kukuchew.com/wp-content/uploads/
2008/01/stop_following_me_creationist.jpg

48. Mechanism (1): All in the Genes
• The genetic make-up of
an organism is known as
its genotype.
• An organism’s genotype
and the environment in
which it lives determines
its total characteristic traits
i.e. its phenotype.
Genotype Phenotype
commons.wikimedia.org/wiki/Image:DNA_double_helix_vertikal.PNG

49. Mechanism (2): DNA
• The double-helix
structure of DNA
was discovered
in 1953.
• This showed how
genetic information
is transferred from
one cell to another
almost without error.
Watson and Crick and their DNA
model of DNA replication
www.chem.ucsb.edu/~kalju/chem110L/public/tutorial/images/WatsonCrick.jpg
en.wikipedia.org/wiki/DNA

50. Mechanism (3): Mutation
Types of mutation • However, occasional
mutations or copying errors
can and do occur when
DNA is replicated.
• Mutations may be caused
by radiation, viruses, or Mutant fruitfly
carcinogens.
• Mutations are rare and often have
damaging effects. Consequently organisms
have special enzymes whose job it is to
repair faulty DNA.
upload.wikimedia.org/wikipedia/commons/7/79/Types-of-mutation.png humansystemstherapeutics.com/bb.htm

51. Mechanism (4): Variation
• Nevertheless, some
mutations will persist and
increase genetic variation
within a population.
• Variants of a particular
gene are known as alleles.
For example, the one of
the genes for hair colour
comprises brown/blonde
alleles.
majorityrights.com/index.php/weblog/comments/racial_variation_in_some_
parts_of_the_skull_involved_in_chewing/

52. Mechanism (5): Natural Selection
• Mutant alleles spread through a
Selection of dark gene population by sexual reproduction.
• If an allele exerts a harmful effect,
it will reduce the ability of the
individual to reproduce and the
allele will probably be removed
from the population.
• In contrast, mutants with favorable
effects are preferentially passed on
en.wikipedia.org/wiki/Image:Mutation_and_selection_diagram.svg

53. Mechanism (6): Peppered Moth
Haldane and the peppered moth • The Peppered Moth is an
example of Natural Selection
 in action discovered by Haldane
• During the Industrial Revolution
the trees on which the moth
rested became soot-covered.
 • This selected against the allele for pale
colour in the population (which were
poorly camouflaged from predators)
and selected for the dark colour allele.
http://en.wikipedia.org/wiki/Image:Biston.betularia.7200.jpg
en.wikipedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpg
en.wikipedia.org/wiki/J._B._S._Haldane

54. Mechanism (7): Microevolution
• The dog is another example of how
selection can change the frequency
of alleles in a population.
• Dogs have been artificially selected
for certain characteristics for many
years, and different breeds have
different alleles.
• All breeds of dog belong to the same
species, Canis lupus (the wolf) so this
is an example of Microevolution as no
new species has resulted.
Dogs are wolves
www.puppy-training-solutions.com/image-files/dog-breed-information.jpg

55. Mechanism (8): Macroevolution
• However, if two populations of a
species become isolated from
one another for tens of thousands
of years, genetic difference may
become marked.
• If the two populations can no-longer Galapagos finches
interbreed, new species are born.
This is called Macroevolution.
• Darwin’s Galapagos finches are
an example of this process in action.
www.ingala.gov.ec/galapagosislands/images/stories/ingala_images/galapagos_take_a_tour/small_pics/galapagos_map_2.jpg

56. Mechanism (9): Speciation Today?
• The mosquito was introduced to
the London Underground during
its construction around 1900.
• It became infamous in the War
for attacking people sheltering
London Underground Mosquito
from the Blitz.
• Studies indicate several genetic
differences from its above-ground
ancestors. Interbreeding between
populations is difficult suggesting
en.wikipedia.org/wiki/Image:Gb-lu-Angel-southbound.jpg
that speciation may be occurring.
en.wikipedia.org/wiki/Culex

57. 4 major mechanisms that drive evolution:
• Natural Selection
• Mutation
• Gene Flow
• Genetic Drift

58. Unifying Principles of Evolution
• Perpetual Change: All species are in a
continuous state of change

59. Unifying Principles of Evolution
• *Nature- The combined influences of
physical and biological limiting factors*
acting upon an organism.

60. Unifying Principles of Evolution
• *Limiting Factor- Any factor (physical or biological)
which regulates
• the welfare of an organism
–Disease, competition, predation, environmental change, etc.

62. Darwinian Natural Selection
• Three conditions necessary for evolution by
natural selection to occur:
– Natural variability for a trait in a population
– Trait must be heritable
– Trait must lead to differential reproduction
• A heritable trait that enables organisms to
survive AND reproduce is called an
adaptation

63. Steps of Evolution by Natural Selection
• Genetic variation is added to genotype by mutation
• Mutations lead to changes in the phenotype
• Phenotype is acted upon by nat’l selection
• Individuals more suited to environment produce more
offspring (contribute more to total gene pool of population)
• Population’s gene pool changes over time
• Speciation may occur if geographic and reproductive isolating
mechanisms exist…
• Natural Selection in action ...
• A demonstration...

64. Selection Against or in Favor of Extreme
Phenotypes
• Stabilizing Selection
– Intermediate forms of a trait
are favored
– Alleles that specify extreme
forms are eliminated from a
population
– EX: Birth Weight and Clutch
Size

65. Stabilizing Selection
Number of individuals
Number of individuals
Light snails Dark snails Natural Snails with
eliminated eliminated selection extreme
coloration are
eliminated
Coloration of snails Coloration of snails
Average remains the same
Number of individuals with
intermediate coloration increases
Eliminates Fringe Individuals

66. Selection Against or in Favor of Extreme
Phenotypes
• Disruptive Selection
– Both forms at extreme
ends are favored
– Intermediate forms are
eliminated
– Bill size in African finches

67. Directional Change in the Range of
Variation
• Directional Selection
– Shift in allele frequency in a
consistent direction
• Phenotypic Variation in a
population of butterflies

68. MUTATIONS, MY FRIENDS!
• Changes in the structure of the
DNA
• Adds genetic diversity to the
population
• May or may not be adaptive
– Depends on the environment!

69. Sooooo….What’s Evolution?
• The change in a POPULATION’S genetic makeup (gene pool) over
time (successive generations)
– Those with selective advantages (i.e., adaptations), survive and reproduce
– All species descended from earlier ancestor species
• Microevolution
• Small genetic changes in a population such as the
spread of a mutation or the change in the frequency of
a single allele due to selection (changes to gene pool)
– Not possible without genetic variability in a pop…
• Macroevolution
– Long term, large scale evolutionary changes through which new
species are formed and others are lost through extinction

70. Microevolution
• Changes in a population’s gene pool over time.
– Genetic variability within a population is the catalyst
• Four Processes cause Microevolution
– Mutation (random changes in DNA—ultimate source of
new alleles) [stop little]
• Exposure to mutagens or random mistakes in copying
• Random/unpredictable relatively rare
– Natural Selection (more fit = more offspring)
– Gene flow (movement of genes between pop’s)
– Genetic drift (change in gene pool due to
random/chance events)

71. The Case of the
Peppered Moths
• Industrial revolution
– Pollution darkened tree trunks
• Camouflage of moths increases survival from
predators
• Directional selection caused a shift away from light-
gray towards dark-gray moths

72. Fig. 18.5, p. 287

73. Gene Flow and Genetic Drift
• Gene Flow
– Flow of alleles
• Emigration and immigration of individuals
• Genetic Drift
– Random change in allele frequencies over generations brought
about by chance
– In the absence of other forces, drift leads to loss of genetic
diversity
• Elephant seals, cheetahs

74. Speciation
Adapted to cold
through heavier
Northern fur, short ears,
population short legs, short
nose. White fur
Arctic Fox matches snow
Spreads for camouflage.
northward Different environmental
Early fox and conditions lead to different
population southward selective pressures and evolution
and into two different species.
separates
Adapted to heat
through lightweight
Southern
fur and long ears,
population legs, and nose, which
Gray Fox
give off more heat.

75. Speciation
• Two species arise from one
– Requires Reproductive isolation
• Geographic: Physically separated
• Temporal: Mate at different times
• Behavioral: Bird calls / mating rituals
• Anatomical: Picture a mouse and an elephant hooking up
• Genetic Inviability: Mules
• Allopatric
– Speciation that occurs when 2 or more populations of a species are
geographically isolated from one another
– The allele frequencies in these populations change
– Members become so different that that can no no longer interbreed
– See animation
• Sympatric
– Populations evolve with overlapping ranges
– Behavioral barrier or hybridization or polyploidy

76. COEVOLUTION: Interaction Biodiversity
• Species so tightly connected, that the
evolutionary history of one affects the other
and vice versa.
– Ant Farmers of the Amazon

77. Coevolution
• Interactions between species can cause
microevolution
– Changes in the gene pool of one species can cause changes in
the gene pool of the other
• Adaptation follows adaptation in something of a long
term “arms race” between interacting populations of
different populations
– The Red Queen Effect
• Can also be symbiotic coevolution
– Angiosperms and insects (pollinators)
– Corals and zooxanthellae
– Rhizobium bacteria and legume root nodules

78. And NUH is the letter I use to spell Nutches,
Who live in small caves, known as Niches, for hutches.
These Nutches have troubles, the biggest of which is
The fact there are many more Nutches than Niches.
Each Nutch in a Nich knows that some other Nutch
Would like to move into his Nich very much.
So each Nutch in a Nich has to watch that small Nich
Or Nutches who haven't got Niches will snitch.
-On Beyond Zebra (1955)
Dr. Seuss

79. Niches
• A species functional role in an ecosystem
• Involves everything that affects its survival and reproduction
– Includes range of tolerance of all abiotic factors
– Trophic characteristics
– How it interacts with biotic and abiotic factors
– Role it plays in energy flow and matter cycling
• Fundamental Niche
– Full potential range of physical chemical and biological conditions and
resources it could theoretically use if there was no direct competition
from other species
• Realized Niche
– Part of its niche actually occupied
• Generalist vs. Specialist
– Lives many different places, eat many foods, tolerate a wide range of
conditions vs few, few, intolerant…
– Which strategy is better in a stable environment vs unstable?

80. Competition and Community Diversity
•Species evolve to
minimize
competition and
niche overlap
•Results in a
diverse matrix of
differing species
within a
community

81. Local, ecological and true extinction
The ultimate fate of all species just as death is for all
individual organisms
99.9% of all the species that have ever existed are now
extinct
To a very close approximation, all species are extinct
Background vs. Mass Extinction
Low rate vs. 25-90% of total
Five great mass extinctions in which numerous new
species (including mammals) evolved to fill new or
vacated niches in changed environments
10 million years or more for adaptive radiations to
rebuild biological diversity following a mass extinction
Extinctions open up new opportunities for speciation and
adaptive radiation..BUT you can have too much of a good
thing!

82. Factors Affecting Extinction Rates
• Natural Extinctions
– Climate change
– Cataclysmic event (volcano, earthquake)
• Human Activities
– Habitat Loss/Fragmentation
– Introduction of exotic/invasive species
– Pollution
– Commercial harvesting
– Accidental killing (tuna nets)
– Harassing
– Pet Trade
– Urbanization
– Damming/Flooding
– Agricultural conversion

83. Extinction in the Context of Evolution
• If
– the environment changes rapidly and
– The species living in these environments do not
already possess genes which enable survival in the
face of such change and
– Random mutations do not accumulate quickly
enough then,
• All members of the unlucky species may die

84. Biodiversity
• Speciation – Extinction=Biodiversity
• Humans major force in the premature extinction of species.
Extinction rate increased by 100-1000 times the natural
background rate.
• As we grow in population over next 50 years, we are expected
to take over more of the earth’s surface and productivity. This
may cause the premature extinction of up to a QUARTER of
the earth’s current species and constitute a SIXTH mass
extinction
– Genetic engineering won’t solve this problem
– Only takes existing genes and moves them around
• Know why this is so important and what we are
losing as it disappears….

85. USING EVOLUTION AND GENETICS TO
INFORM CONSERVATION
• EcoRegions Approach
– Identifying biodiversity “hotspots” and focusing conservation efforts
on maintaining those ecosystems
– Ex. Tropics, Appalachian Mountains, etc.
• “Umbrella Species” Conservation
– Conserve one “sexy”, species and you conserve several others because
if the interactions they have with one another
– Keystone species concept
• Species Survival Plan (SSP)
– Zoo captive breeding programs
– Population genetics in wild populations
• Ex. Cheetahs, Primates, Bears, etc.