Intelligent Design - The Modern Challenge to Darwinism
•
10 likes•6,647 views
Explore the evidence of intelligent design in the earth and in the universe with Dr. Ken Boa as he looks and multiple new discoveries in science, mathematics, and information technology that point to the necessity of some sort of intelligent designer.
Recommended
More Related Content
What's hot
What's hot (20)
Viewers also liked
Viewers also liked (7)
Similar to Intelligent Design - The Modern Challenge to Darwinism
Similar to Intelligent Design - The Modern Challenge to Darwinism (20)
More from KenBoa.org
More from KenBoa.org (20)
Recently uploaded
Recently uploaded (20)
Intelligent Design - The Modern Challenge to Darwinism
- 1. Intelligent Design The Modern Challenge to Darwinism Dr. Kenneth Boa and Bill Ibsen © Dr. Kenneth Boa & Bill Ibsen 2010. All Rights Reserved.
- 2. May 2005
- 3. July 2005
- 4. August 2005
- 6. D uses the scientific method to argue for an intelligent cause nature applied to the data of
- 7. Tangible signs of design by a preexisting intelligence
- 8. • Doesn’t define the designing intelligence • Not religious • Doesn’t specify the implications
- 13. Science versus Scientism • Scientism = Philosophy of Naturalism • “The cosmos is all that ever was, or is, or ever will be” - Astronomer Carl Sagan • A naturalistic rather than a scientific statement • Science = An empirical method of discovery • E.g., elliptical planetary orbits
- 14. Inferences to the Best Explanation Natural Causes Designed Designer Gutzon Borglum,Designer Gutzon Borglum, ca 1930ca 1930
- 17. Weighing Evidence Design No Design Mind Mindless Deliberate Accident Living Non-Living Purposeful Purposeless Intentional Randomness Reason Chance Order Chaos
- 18. Overview • Detecting Design: Irreducible Complexity • Design in Biochemistry • Detecting Design: Specified Complexity • Design in Genetics • Design in Paleontology • Design in Astronomy
- 20. Jenga
- 21. Irreducible Complexity Spring Holding Bar Platform Hammer Catch A minimum number of parts must be present to function
- 22. Closely Matched Parts • Right size • Right proportion • Right strength • Right tolerances • Right materials • Right alignment • Right assembly instructions Structure-Function Relationships That Display DESIGN
- 23. Irreducible Complexity Cannot be Produced by Darwinism • A missing single component: non-functional • “Selected out” • No memory • Can’t save changes
- 24. Jellyfish Stinging Cells Are Irreducibly Complex barb poison
- 25. Bird Lungs are Irreducibly Complex
- 26. Charles Darwin Darwin’s Failure Criterion “If it could be demonstrated that any complex organ existed which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down” Charles Darwin, On the Origin of Species, Chapter VI “Difficulties with the Theory”
- 27. Absolute Break-Down of Darwin’s Theory • Must “choose” pre-functioning components •Cannot produce new components
- 28. Absolute Break-Down of Darwin’s Theory • Multi-component (irreducibly complex) systems cannot be produced gradually • Missing part > Non-Functioning
- 30. What Darwin Never Knew • 1850’s technology • No electron microscopes, X-ray crystallography, etc.
- 31. What Darwin Never Knew • No understanding of cell complexity • No knowledge of genetics or DNA • 99.9% fossils discovered after 1860
- 35. What’s it Got Under the Hood? • Acid-powered, liquid-cooled rotary motor • 100,000 rpm • Rotor, stator, u-joints, bushings, and propeller • Propeller reverse within 1/4 of a turn
- 36. What’s it Got Under the Hood? • Almost 100% efficiency • Sensory system for steering • Synchrony with multiple flagella • Irreducibly complex
- 38. Assembly Instructions Included! Meaningful instructions are always a product of intelligence
- 39. Mom, I’ve Got a Motor in My Body! • 100+ molecular motors known to exist in human body • 8,000,000 machines can fit on the end of a human hair • Far exceeds the capacity of human technology
- 41. Cellular Factory Consists of 10 million million atoms
- 42. Cell: High-Tech Factory • Artificial languages + decoding systems • Memory banks: info storage and retrieval • Control systems: regulating auto self- assembly • Assembly processes involving prefabrication and modular construction • Complete self-replication of its entire structure within a few hours!
- 43. Darwinian Evolution’s Audacious Claim • Evolution can produce highly sophisticated, highly compact, highly complex, highly ordered, self-replicating systems... • ... which the pinnacle of human technology and intelligence is incapable of replicating • With NO INTELLIGENCE at all
- 45. WouldYou Believe This Happened by Chance?
- 46. Scrabble Tiles Set Randomly Dumped Randomness tends to produce nonsense
- 47. Four Possibilities for Information High ContentLow Content Not Complex Complex High Probability Low Probability Low Specificity High Specificity Specification = Conforms to an independently recognizable pattern
- 48. Ranges of Informational Possibilities Low Content High Content ComplexNot Complex
- 49. Informational Possibility #1 High ContentLow Content Not Complex Complex High Probability Low Probability Low Specificity High Specificity NDPOKNZMSVBWXLSRRE
- 50. JIMJIMJIMJIMJIMJIMJIMJIM High ContentLow Content Not Complex Complex High Probability Low Probability Low Specificity High Specificity Informational Possibility #2
- 51. High ContentLow Content Not Complex Complex High Probability Low Probability Low Specificity High Specificity PLCATVGETRUGAXRDJCOW Informational Possibility #3
- 52. High ContentLow Content Not Complex Complex High Probability Low Probability Low Specificity High Specificity OURNAMESAREKENANDBILL SPECIFIEDCOMPLEXITY Probability:1 in 1 billion quadrillion Informational Possibility #4
- 53. Definition of Information Complex High Content SPECIFIEDCOMPLEXITY INFORMATION = Content + Complexity High Specificity Low Probability
- 55. Necessity, Chance or Design? Contingent, Complex, Specified?
- 59. Chances of This Simple Sentence? 2,810,000,000,000,000,000,000,000,000,000,000,000,000,000 1
- 60. The Improbability of Chance “Give me a million monkeys over a million years, and they’ll be able to write Shakespeare’s Tempest!” - George Bernard Shaw Shaw
- 61. The Improbability of Chance of writing a simplified first line ofTempest # of 4-Letter Words in Sequence 1 2 3 4 Time ~12 Seconds ~ 5 Days ~ 100 Years ~ 100 BillionYears
- 66. M.I.T. Mathematician Norbert Wiener Any materialism that fails to take account of this will not survive one day.” “Information is information; neither matter nor energy.
- 67. The lower cannot account for the larger
- 68. Atheist Riddle Show me a message that doesn’t come from a mind.
- 69. assembly of informationinformation in the known universe DNA is the most densely packed, most elaborately detailed
- 70. Continuous DNA Strand Ruptured Bacterial Cell
- 71. AGATGGTTCATTCTGACTTGGGTATCGAAGAACTTGATTCACCTGAATCCAGTCTAAATGGAAGTGAAGATATGGAGTCCAAGAGCAACCTGTACAGC GGGGCAGTGGTATTGTTACAAGATGTCCTCTTGTGCTGAGGCTGAAAAAACTTGGGAATGAAGACGAGTGGAAAGGCAAAGTCAGCTTCCTGGACAAA TCTAAATGGAAGTGAAGATATGGAGTCCAAGAGCAACCTGTA AGACGAGTGGAAAGGCAAAGTCAGCTTCCTGG Page 311 of 600 Volume917 Volume345 1000 600-page Books ...in the area 10,000x smaller than a pin head
- 72. Billy, your genome sequence is A, T, C, G, A, T, C, G, A, T, C, G, A, C, T, A, G .... Speak aloud 10 bases/second non-stop 24 hrs./day: 9.5 years Speak aloud 3 bases/second non-stop 40 hrs./week: 132 years
- 73. Confidence Against Random Generation of 20 Digits
- 74. DNA Fun Fact 3.2B letters of coding provides 103,480,000,000 possible combinations
- 75. How could specified, complex information get from an organism’s environment into an organism’s genome? Millions upon millions of beneficial mistakes? Seriously!
- 76. “If it looks, walks and quacks like a duck ....”
- 79. “... the number of intermediate and transitional links, between all living and extinct species, must have been inconceivably great. - Charles Darwin, On the Origin of Species But assuredly, if this theory be true, such have lived upon the earth.”
- 81. Era Period/Epoch Age (Millions of Years) Pleistocene 0.01 Pliocene 1.8 Miocene 5 Oligocene 25 Eocene 38 Palaeocene 55 Cretaceous 65 Jurassic 144 Triassic 248 Permian 286 Carboniferous 354 Devonian 412 Silurian 435 Ordovician 492 Cambrian 550 Precambrian 600 Beginning of Life ca. 3800 CenozoicMesozoicPalaeozoic
- 82. The Cambrian Explosion The Biological “Big Bang”
- 83. Burgess Shale Site, British Columbia
- 84. Anomalocaris
- 85. Hallucigenia
- 86. Pikaia
- 87. Opabina
- 88. Wiwaxia
- 89. Marella
- 90. “Natural selection acts only by taking advantage of slight, successive variations. She can never take a great and sudden leap, but must advance by short and sure, though slow steps” - Charles Darwin, On the Origin of Species
- 91. The absence of the fossil evidence was “the most obvious and gravest objection which can be urged against my theory.” “... the case at present must remain inexplicable and may be truly argued as a valid argument against the views here entertained.” - Charles Darwin, On the Origin of the Species
- 92. The Embarrassing Fossil Record Darwinian Theory Cambrian Fact Common Ancestor No Ancestor Partially Formed Fully Formed Gradual Appearance Sudden Appearance Numerous Transitional Intermediates No Transitional Intermediates Cambrian Fossils Followed by Gradual Change Cambrian Fossils Followed by Stasis
- 93. Living Fossils
- 95. “The extreme rarity of transitional forms in the fossil record is ...the trade secret of paleontology” - Stephen Jay Gould, Evolutionary Biologist
- 97. “The universe that we observe has precisely the properties we should expect if there is, at bottom no design, no purpose, no evil and no good, nothing but blind, pitiless indifference.” Oxford University Professor Richard Dawkins
- 98. Fine-Tuning of the Universe • Rare, unique and complex conditions required for sustaining life • Earth has a myriad of incredibly interconnected, interrelated life-support systems
- 99. Our Just-Right Galaxy EllipticalSpiral 20% 60% Only spiral galaxies provide any “safe zone” for life-sustaining planets Irregular 20%
- 100. Our Just-Right Galaxy • Milky Way is top 1-2% most luminous and massive galaxies • Gravitational mass attracts helium & hydrogen to build heavy elements • Low-mass galaxies unable to attract helium & hydrogen • ∼200 billion stars, but little likelihood of life-sustaining planets
- 101. Our Just-Right Planetary Orbits • Jupiter’s orbit: nearly circular • Similar gas-giant planets in other solar systems have highly elliptical orbits • Gravitational pull would upset Earth’s nearly circular orbit, subjecting it to deadly temperature variations • Creates steady temperatures and a predictable climate
- 102. Our Just-Right Neighbors • Jupiter is +300X mass of Earth • Gravitational pull acts as a shield to protect us from deadly comets • Saturn and Uranus comet- catch for us • Mars andVenus take asteroid hits for us
- 103. Moon Battle Scars
- 104. Our Just-Right Distance From the Sun • Too close: boil off the oceans • Too far: H₂0 and C0₂ freeze • C0₂ traps sun’s radiation, keeps H₂0 liquid • Complex animal life needs 0₂ • +/- 5% distance Circumstellar Habitable Zone (not to scale) +/- 5%
- 105. Our Just-Right Sun • Right mass: Yellow dwarf; 10% most massive stars • Right light: Emits a balance of red & blue allowing photosynthesis • Right composition: High metallicity for creating terrestrial planets • Right orbit: Nearly circular for temperature stability
- 106. Our Just-Right Sun • Right energy output: 0.01% variance on an 11-year cycle • Right type: Bachelor star (10% of all stars) • Right luminosity: Not too much particle radiation • Destroys the atmosphere • Destroys the ozone layer Binary Stars
- 107. Our Just-Right Moon • Stabilizes the tilt of the Earth’s axis @ 23.5° • Variation of ~1.5° giving mild seasons • Mercury, Mars,Venus have chaotic variations in tilt
- 108. Our Just-Right Moon • Increases our tides (Moon = 68.5% and Sun = 31.5%) • Flushes out nutrients from continents to oceans • Single moon (Jupiter 63; Saturn 33; Uranus 26; Neptune 13; Mars 2) • Otherwise: chaotic, deadly tides & seasons • Circulates ocean water, regulating temperatures • Size: more massive > tidal and rotation effects
- 109. Our Just-Right Core/Engine • Radioactive decay helps drive convection of liquid iron surrounding core • Creates a dynamo generating magnetic field • Shields us from low-energy cosmic rays • Prevents solar winds from degrading our atmosphere
- 110. Our Just Right Earth-Mass • Terrestrial planets must have a minimum mass to retain an atmosphere • Atmosphere : keeps the good in and the bad out • Oxygen-rich atmosphere to support large-brained creatures (20%) • Minimum mass to retain heat • E.g., Mars
- 111. Our Just-Right Observation Position • Earth located between spiral arms • Fewer stars • Less gas and dust • Offers great visibility of the universe • Earth is best planet to view total solar eclipses
- 112. Probability of 200 finely-tuned parameters occurring by chance: 1010-215-215
- 113. . 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 00000000000000000000001 10 -215 is: What Are the Chances? Get heads 50X in a row: 1 chance in a million billion “Not a chance.” “Not a chance.”
- 116. Summary Irreducible complexity makes Darwin’s theory “absolutely break down” “... numerous, successive, slight modifications”
- 117. Summary Biochemistry describes intricate molecular machines that are irreducibly complex Evolution, by definition, can never account for the existence of irreducibly complex systems
- 118. Summary Specified complexity identifies information-rich sources belying their intelligent cause Darwinism is incapable of accounting for the origination of information
- 119. Summary Genetics uncovers the highest levels of information in the universe Complex information cannot originate by chance, natural processes
- 120. Summary “She can never take a sudden leap... but must advance by short, slow, though sure steps”
- 121. Summary Paleontology shows abrupt appearance and stasis--incompatible with Darwinism “She can never take a sudden leap... but must advance by short, slow, though sure steps”
- 122. Summary Astronomy reveals the amazing fine-tuning of the universe- a product of intelligence +/- 5% . 0000000000000000000000000000000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000000000000000000000001 chance occurrence of 200 fine-tuned parameters
- 123. Summary • Necessity (it had to be there) • Chance (a tornado blew it there) • Design (someone put it there)
- 124. Why Isn’t ID Widely Published? • Problem of censorship for dissenting opinions • Scientific journals have referees who eliminate any papers which imply design or a designer • “Darwin Industry” • Thousands of competent scientists now in the ID camp (and growing)
- 125. Extra-Scientific Implications • Metaphysical issues • “The ones who oppose the theory of design most vociferously do so for religious reasons” -Michael Behe, Biochemist • Darwinism tends to be off-limits for criticism
- 126. Weighing Evidence Design No Design Mind Mindless Deliberate Accident Living Non-Living Purposeful Purposeless Intentional Randomness Reason Chance Order ChaosIntelligent Design Darwinism
- 127. Conclusion •The momentum of the empirical evidence will predictably continue to grow in the direction of elegance, complexity, and information. •The neo-Darwinian account of naturalistic processes is already hopelessly outmoded and inadequate in its explanatory power • The increasing momentum of empirical evidence will only make this inadequacy even more obvious with every passing year.
- 128. The End
- 129. Books About I.D. • Evolution: ATheory in Crisis by Michael Denton • Darwin’s Black Box by Michael Behe • Intelligent Design by William Dembski • The Design Revolution by William Dembski • Icons of Evolution by Jonathan Wells • A Case for the Creator by Lee Stroebel • Darwin onTrial by Phillip Johnson • The Privileged Planet by Guillermo Gonzalez
- 130. KenBoa.org Resources Reflections - A free monthly teaching letter KenBoa.org website - Daily Growth email and free text and audio resources
- 131. www.KenBoa.org
Editor's Notes
- Somewhat of a revolution has occurred within the scientific community during the last 20 years, where many scientists are seriously questioning or renouncing their evolutionist views in favor of a new area of science called “Intelligent Design,” or “ID” for short. One notable example is the ardent evolutionist Dr. Antony Flew, who spent half a century defending evolution. Why would someone, near the end of their life, renounce the very thing they gave most of their life to defending? What is Intelligent Design, and why is it so compelling to scientists? We hope to answer these questions and others in this presentation. Article: “Famous Atheist Now Believes in God” Dec. 9, 2004: http://abcnews.go.com/US/wireStory?id=315976 http://images.google.com/imgres?imgurl=http://www.queenofpeace.ca/_derived/Flew.htm_txt_antony_flew.gif&imgrefurl=http://www.queenofpeace.ca/Flew.htm&h=243&w=200&sz=26&tbnid=UeSEF4_3TbkJ:&tbnh=105&tbnw=86&hl=en&start=1&prev=/images%3Fq%3Danthony%2Bflew%26hl%3Den%26lr%3D%26client%3Dsafari%26rls%3Den%26sa%3DN
- Simply put, when we observe signs of design, such as this image of a staircase, we intuitively know that this implies a designing intelligence. That is, some type of Designer acted upon the material and organized or arranged it in an obvious way.
- So what is Intelligent Design, or “ID,” for short? First, ID uses the scientific method (that is, to observe, hypothesize, predict, and test) applied to nature to argue for an intelligent cause. Simply put, nature shows tangible signs of having been designed by a preexisting intelligence. And if we’ll take a moment to consider the myriad of inter-connected biological systems, sub-systems, and components, we find an enormous complexity of life as well as finding information-rich molecules (such as in DNA, which we’ll look at later) which point towards an intelligent cause rather than ignorant, blind processes. Since the 1980s, however, advances in biology have convinced a new generation of scholars that Darwin’s theory was inadequate to account for the sheer complexity of living things. These scholars—chemists, biologists, mathematicians and philosophers of science—began to reconsider design theory. These information-rich sources which point to designing intelligence are empirically detectable (The Design Revolution, p.34)
- So what is Intelligent Design, or “ID,” for short? First, ID uses the scientific method (that is, to observe, hypothesize, predict, and test) applied to nature to argue for an intelligent cause. Simply put, nature shows tangible signs of having been designed by a preexisting intelligence. And if we’ll take a moment to consider the myriad of inter-connected biological systems, sub-systems, and components, we find an enormous complexity of life as well as finding information-rich molecules (such as in DNA, which we’ll look at later) which point towards an intelligent cause rather than ignorant, blind processes. Since the 1980s, however, advances in biology have convinced a new generation of scholars that Darwin’s theory was inadequate to account for the sheer complexity of living things. These scholars—chemists, biologists, mathematicians and philosophers of science—began to reconsider design theory. These information-rich sources which point to designing intelligence are empirically detectable (The Design Revolution, p.34)
- As ID has gained significant momentum in many parts of the scientific community and recently into mainstream society, and, as some evolutionists have vociferously rejected ID, much confusion and misinformation has been spread about ID. We’ll try to clear some of this up now. First, ID makes no claims on the nature or identity of the designing intelligence. The designing mind could be a vast super-intelligence, an alien, God, or something other type of intelligent being that we don’t understand. As a derivative of the first point, ID therefore has no allegiance to any religious view or religious literature. That is, it neither affirms nor denies any Jewish, Christian, Muslim, Hindu or any other religious view or scriptures. For evolutionists to recast ID into “Creationism 2.0” or affiliate it with any religion is simply spreading misinformation. The reality is that ID adherents include scientists of widely varying religions and non-religious positions. For example, Dr. Antony Flew explicitly claimed that his understanding of the designing intelligence was categorically different than the typical view of the Muslim or Christian. Flew commented “it could be a person in the sense of a being that has intelligence and a purpose, I suppose.” Article: “Famous Atheist Now Believes in God” Dec. 9, 2004: http://abcnews.go.com/US/wireStory?id=315976 Antony Flew Exclusive Interview: http://www.biola.edu/antonyflew/index.cfm Lastly, and arguably most importantly, ID makes no claims about its implications. ID makes no call to action or inaction regarding its theory in any field other than science. The implications of Darwinian evolution from the 1850’s were both dramatic and widespread as its implications affected education, theology, science, society, and nations. For example, as the Social Darwinists applied Darwin’s philosophy of the “survival of the fittest” to the Arian race, as well as the devaluation of humans as little more than animals, they logically concluded that Nazi regime could legitimately exterminate a weaker class of people. ID does not concern itself with the implications of its theory, though like any theory, implications will emerge.
- antony flew illustrates our point Somewhat of a revolution has occurred within the scientific community during the last 20 years, where many scientists are seriously questioning or renouncing their evolutionist views in favor of a new area of science called “Intelligent Design,” or “ID” for short. One notable example is the ardent evolutionist Dr. Antony Flew, who spent half a century defending evolution. Why would someone, near the end of their life, suddenly see unsolvable problems with the very thing they gave most of their life to defending? What is Intelligent Design, and why is it so compelling to scientists? We hope to answer these questions and others in this presentation. Source: Article: “Famous Atheist Now Believes in God” Dec. 9, 2004: http://abcnews.go.com/US/wireStory?id=315976 Source: http://images.google.com/imgres?imgurl=http://www.queenofpeace.ca/_derived/Flew.htm_txt_antony_flew.gif&imgrefurl=http://www.queenofpeace.ca/Flew.htm&h=243&w=200&sz=26&tbnid=UeSEF4_3TbkJ:&tbnh=105&tbnw=86&hl=en&start=1&prev=/images%3Fq%3Danthony%2Bflew%26hl%3Den%26lr%3D%26client%3Dsafari%26rls%3Den%26sa%3DN
- The concept of things being designed is certainly not new. The most famous version of the design argument came from theologian William Paley, who in 1802 proposed his “watchmaker” thesis. Paley wrote: “In crossing a heath, suppose I pitched my foot against a stone, and were asked how the stone came to be there; I might possibly answer, that, for anything I knew to the contrary, it had lain there for ever. ... But suppose I had found a watch upon the ground, and it should be inquired how the watch happened to be in that place; I should hardly think the answer which I had before given [would be sufficient]. To the contrary, the fine coordination of all its parts would force us to conclude that … the watch must have had a maker: that there must have existed, at some time, and at some place or other, an artificer or artificers, who formed it for the purpose which we find it actually to answer; who comprehended its construction, and designed its use.” And that is precisely what ID attempts to do: to scientifically demonstrate the presence of design, which is actually a process that you and I intuitively and often unconsciously go through. In other words, intuitively we make logical inferences to design in the normal course of life. Let’s demonstrate this right now by giving you a test. This is an “argument to complexity” versus natural causes.
- Is the particular shape and arrangement of these water droplets a product of chance or design? Intuitively, we know that these shapes and arrangements are random; they represent a formation by pure chance. We make inferences to design in the normal course of life. These water droplets are random, but not meaningful in the sense of offering specific information.
- But what about the arrangement and shapes of these so-called water droplets-are they the product of random chance, or design? Of course, we instantly know that this arrangement is the product of a designer-chance could never account for the complexity of this arrangement. But why? Logically, we know that the pattern of these water droplets presupposes that the designer knew the English language, knew the chemical symbol for water, and knew the precise alpha-numeric sequence required to communicate the word “water” using a dot-matrix style of writing with the very substance it describes. The designer was following a specific pattern (the alphabet and numbers) which are both recognizable and meaningful to other intelligent beings.
- Paley’s argument was intuituive; but the problem is that naturalism has can cause us to deny the implications of the evidence and impose a philosophical alternative based upon an anti-.... us to be counter-intuitive. Naturalism makes a conscious attempt to avoid what would seem obvious to the observer. Design is not a covert Creationism; ID does not identify the source of intelligence. It could be an extra-terrestrial being (though where would this come from?). Kepler discovered, through careful observation and calculations, that the planets orbit in an elliptical pattern.
- But as we have said, not just scientists, but virtually all humans naturally and often automatically surmise or infer design, and thus a designer. We make inferences to the best explanation for the presence of certain data. For example, when we look at this particular hillside located in the Black Hills of South Dakota, we see the likenesses of former American presidents George Washington, Thomas Jefferson, Theodore Roosevelt, and Abraham Lincoln. We may ask ourselves “how did these faces get here?” No one would attribute the shape of these features to natural causes such as sandstorms, or erosion. Nor would we attribute its shape to the result of wind and water over great periods of time. Instead, we recognize it as the work of an intelligent human agent- in fact its designer was Gutzon Borglum “who used simple multiplication and a plumb line to transfer the measurements of a scale model in his studio onto the mountain.” Delta Sky Magazine, Oct. 2004, p. 73 Image: http://www.historycooperative.org/journals/jah/89.3/images/mr_fig01_b.jpg Mt. Rushmore/Gutzon Borglum: http://www.historycooperative.org/cgi-bin/justtop.cgi?act=justtop&url=http://www.historycooperative.org/journals/jah/89.3/mr_9.html Highly improbable, and one that matches a specific pattern elsewhere. Seaside: John Loves Mary; no one would infer the message was written by the tides, but the product of intelligence. Inference: (webster online) 1 : the act or process of inferring : as a : the act of passing from one proposition, statement, or judgment considered as true to another whose truth is believed to follow from that of the former b : the act of passing from statistical sample data to generalizations (as of the value of population parameters) usually with calculated degrees of certainty 2 : something that is inferred; especially : a proposition arrived at by inference 3 : the premises and conclusion of a process of inferring
- Similarly, these structures would be instantly recognized not as the result of natural causes or of random chance, but as products of intelligent design. In fact, they are the products of some of the best engineering minds in the world, as they are actually two of the five rocket engines on a Saturn V rocket, with each engine standing taller than a man. Actually, it took far more than a single rocket-scientist to build these complex structures, a fact that would be obvious even to a child. If we can easily recognize the products of intelligence in the mechanical/artificial realm, why do some have trouble recognizing a far greater intelligence in the natural realm? We will begin to explore this and many other questions in this presentation.
- As we begin to look at various aspects of the natural world, begin to think like a forensic scientist and ask yourself the question: “how did this happen? Was it an accident, or was it intentional?” Plato’s Socrates encouraged, “go where the evidence leads.” As we look at new scientific findings in biochemistry, genetics, paleontology, and astronomy, weigh the evidence to determine if these natural phenomena are the result of design, or of no design; are they the product of a mind, or the result of mindlessness; are they deliberate designs, or mere accidents; are they the product of a living super-intelligence, or the product of non-living randomness; do they reflect purpose, or purposelessness; does their design appear intentional or random; are they the product of reason, or of chance; and lastly, do they reflect order, as in a design, or just chaos, as in randomness? You decide. http://www.biola.edu/antonyflew/index.cfm
- In this presentation we will be discussing two methods of scientifically detecting design, as well four areas of science that exhibit intelligent design. First, we’ll look at one aspect of detecting design called “Irreducible Complexity,” which, by his own admission would have stumped Charles Darwin. Next, we’ll look at one of the irreducibly complex molecular machines inside your body that the biochemists have recently discovered, Then we’ll discuss one scientific method of detecting design as we explore the concept of “Specified Complexity.” We’ll then see an outstanding example of specified complexity in the area of genetics, and we’ll look at the implications of the design paleontologist find in the fossil record, and lastly, we’ll have a look at some new aspects of astronomy that reveal specific clues that our universe may have been intentionally designed.
- The first aspect of detecting design that we’ll consider is one which Lehigh University Professor of Biochemistry Michael Behe coined in his 1996 book Darwin’s Black Box called “irreducible complexity.” Behe, Michael J, (1996) Darwin’s Black Box, The Biochemical Challenge to Evolution, The Free Press, pl. 39-40, 42-45
- If any single part of a multi-component system is missing or defective, then the machine wouldn’t work. All of these components must be present and functioning simeltaneously for the machine to perform its function. This can be illustrated using a familiar, non-biological machine: the mousetrap. 5 necessary components: platform, hammer, spring, holding bar, and catch. Must be correct shapes, sizes, and materials to function correctly (catching mice). Either it works, or it doesn’t. You cannot further reduce (remove) any of the parts and have the device or system still function.
- In reality, it is not enough just to have the five components available to make a mousetrap. The components must also be closely matched to fit and work properly together. For example, the parts must be the right size: If holding bar were too short, it wouldn’t reach the catch to hold the bar down. The components must also be sized in proper proportion to one another- for instance, the inner diameter of the spring must be large enough for the end of the hammer to pass through it. If these two components don’t fit together like a hand in a glove, the trap becomes useless. The components of the system must also be made out of materials of the right strength. If the hammer were made of thread, it simply wouldn’t have the killing power of a metal bar, even if all the other components were made of materials of the correct strength. It must be capable of generating a certain minimum force. The parts must also be placed in relation to one another within the right tolerances, too. For example, if the catch was positioned at the end of the holding bar instead of in the middle of its “hook,” it could not retain the “cocked” holding bar and hammer assembly, again, rendering the mousetrap as non-functional. The parts must manufactured of the right materials. If, for instance, the base were made out of paper, the trap would fall apart even as the hammer was attempted to be cocked back. The components of the system must also be positioned in the exact right alignment relative to each other. For example, if the hammer is placed sideways on the trap relative to the catch, the mousetrap could not possibly work. Lastly, the components of the mousetrap system must also be correctly assembled, which requires the right assembly instructions. Don’t forget the particular sequence of steps required for assembly! For example, you can’t install the holding bar until after the spring is attached to the hammer, and until the hammer is attached to the base. Get this sequence out of order, and the five components won’t be assembled, again, rendering the mousetrap useless. The parts, even for a simple mousetrap, are intricately coordinated. The very precise structure-function relationships of these parts all display aspects of an engineering mind, a designer, which we know in the real world is an absolute necessity. Mousetraps just don’t randomly spring out of a junk drawer, fully assembled and functional, even if the matched parts existed in the drawer disassembled. This structure-function relationship is a huge stumbling block to Darwinism- what are the chances, even if you had all five materials present, that all 7 of these factors would simultaneously occur? Virtually impossible.
- So where are we going with all this talk of irreducibly complex systems such as mousetraps? The main point is that irreducible complexity cannot be produced by Darwinism. It simply cannot account for irreducibly complex, multi-component systems because in Darwinism, all living things evolve gradually, not instantaneously. But remember that a missing single component of an irreducibly complex system would render the system as non-functional. It wouldn’t work, and therefore the non-functional variations would be automatically “selected out” according to Darwin. Note also that natural selection, being random, has no memory. Therefore natural selection cannot save changes for the future- it is a purposeless system. Back to our mousetrap scenario, if a hammer accidentally evolved without all the rest of the components present and functional, natural selection cannot save this future-helpful component because it doesn’t help the organism survive in the present generation. Thus, this beneficial change would die off in that generation. Molecular biologist and author Dr. Michael Denton succinctly noted this Darwinian weakness in his book titled Evolution: A Theory in Crisis published in 1985, writing “...complex systems cannot be approached gradually through functional intermediates because of the necessity of perfect coadaptation of their components as a pre-condition of function.” (p. 270 EATIC) Denton understood that Darwin’s gradual evolution theory could never account for irreducibly complex systems like an extremely simple mousetrap.
- As this illustration depicts, jellyfish stinging cells consist of a minimum number of parts: a lid, trigger, barb, stinging thread, and of course, the exact right poison capable of causing respiratory and circulatory failure in prey. In evolutionary terms, Darwinists must be able to explain how each of these individual parts gradually over time, in small, incremental steps over generations, though they would have no survival value until all the necessary parts where in place. Also with the wing, with its exquisitely detailed structure, it is difficult to imagine its numerous, successive, slight changes from a hypothetical frayed reptile scale to fully formed wing. Particularly in large birds, “about a million barbules cooperate to bind the barbs into an impervious vane” ( p.202) capable of flight.
- Like a multitude of systems in nature, the lungs of birds are irreducibly complex. Birds have a significantly different structure to their lungs than mammals do. In addition to the lungs themselves, birds have posterior and anterior air sacs (typically nine) which control air flow through the lungs, but do not play a direct role in gas exchange. They have a unidirectional flow-through respiration system, unlike mammals which are bidirectional, and thus are unique in the vertebrate world. Dr. Michael Denton comments “Just how an utterly different respiratory system could have evolved gradually from the standard vertebrate design is fantastically difficult to envisage, especially bearing in mind that the maintenance of respiratory function is absolutely vital to the life of an organism to the extent that the slightest malfunction leads to death within minutes.” (Source: EATIC p. 211-212). Gradualism and the necessary immediacy of irreducibly complex systems are thus antithetical concepts. Source: http://en.wikipedia.org/wiki/Lung#Avian_lungs Image Source: http://www.biology.eku.edu/RITCHISO/birdrespiration.html
- So why does the ID concept of irreducible complexity demonstrate insurmountable problems for the Darwinists? For that answer, we must look to Darwin’s great work, On the Origin of Species, where Charles Darwin, like many good scientists, presents the failure criteria for his own theory of evolution. Darwin said “If it could be demonstrated that any complex organ existed which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down.” Darwin clearly saw that in order for complex organs or systems to be explained as the product of blind chance, they must evolve through numerous, successive, slight changes. If complex systems originated in full, functional multi-component form, that is, in large developmental leaps, then clearly an outside Designer would be involved, in which case his theory which precluded a Designer, “would absolutely break down.” Irreducibly complex systems absolutely break down Darwin’s theory because it is impossible for them to be developed gradually.
- Darwin’s theory absolutely breaks down by his own criteria, because natural selection can only “choose” systems that are already working. They cannot produce new components; rather, components can only be produced gradually: step by step in numerous, slight, successive changes. Therefore, the main point is that multi-component (irreducibly complex systems) cannot be produced gradually, or piece by piece, because if the system is missing a part, it doesn’t function, and gets selected out because the unprofitable component doesn’t aid in survival. Darwinism is completely incapable of accounting for irreducibly complex organs, cells, or any of the myriad of sub-systems working within cells. Cannot be produced piece by piece, because they must be fully present to function. 3. Furthermore, just as with any machine, so also in a biological system, any change in one part will require simultaneous and coadaptive change throughout the mechanism to ensure that all the components function in a coherent and integrated manner (i.e., a change in the diameter of piston size in a car engine necessitates corresponding change in the cylinder and piston ring diameter, and possibly also the connecting rod, wrist-pin, etc. p. 91 EATIC
- Darwin’s theory absolutely breaks down by his own criteria, because natural selection can only “choose” systems that are already working. They cannot produce new components; rather, components can only be produced gradually: step by step in numerous, slight, successive changes. Therefore, the main point is that multi-component (irreducibly complex systems) cannot be produced gradually, or piece by piece, because if the system is missing a part, it doesn’t function, and gets selected out because the unprofitable component doesn’t aid in survival. Darwinism is completely incapable of accounting for irreducibly complex organs, cells, or any of the myriad of sub-systems working within cells. Cannot be produced piece by piece, because they must be fully present to function. 3. Furthermore, just as with any machine, so also in a biological system, any change in one part will require simultaneous and coadaptive change throughout the mechanism to ensure that all the components function in a coherent and integrated manner (i.e., a change in the diameter of piston size in a car engine necessitates corresponding change in the cylinder and piston ring diameter, and possibly also the connecting rod, wrist-pin, etc. p. 91 EATIC
- Now that we’ve looked at the concept of irreducible complexity and a few of its occurrences on a large scale, let’s now look at some surprising examples of it in the microscopic and cellular level.
- As brilliant as Charles Darwin was, not only was he unaware of irreducible complexity in nature, but also he was completely ignorant of the contents and design of a basic cell. He incorrectly assumed that a cell was just a simple blob of protoplasm, like jelly. In all fairness, he used the technology available to him in the 1850’s. However, electron microscopes did not exist in those days, nor did X-ray crystallography nor the computers than required for the imaging of these machines, but instead, relatively primitive instruments existed such as simple microscopes that relied upon visible light to illuminate its object, rather than beams of electrons, as used with electron microscopes of today. Note that it is impossible to “see” objects as small as atoms or molecules using visible light. Thus, Darwin was incapable of seeing small objects and creatures like this bizarre-looking Antarctic mite. At the smallest level, all Darwin could perceive were small, hollow sections that were called cells, which were actually just cell walls. Source: http://www.yesmag.bc.ca/how_work/microscope.html Consequently, neither Darwin nor any nineteenth century biologist had any understanding of cell complexity, which biologists of today now know to be nothing short of dazzling. Neither did they have even a hint of the true nature of the gene and of the mechanism of inheritance. Source: p. 64, EATIC Another huge set of facts that Darwin didn’t have access to was the number of fossil specimens that we have today, 150 years later. According to Dr. Michael Denton, “So vast has been the expansion of paleontological activity over the past one hundred years that probably 99.9% of all paleontological work has been carried out since 1860. Only a small fraction of the hundred thousand or so species know today were known to Darwin.” Source: p. 160-161 EATIC This important lack of data will play a key role later in our presentation, when we compare all the fossil evidence we have today with Darwin’s evolutionary predictions. Why can't you see an atom or molecule with visible light? It never will be possible to see atoms or molecules using visible light, even with the most powerful of microscopes. In order to see an object, its size has to be at least half the wavelength of the light being used to see it. But the wavelength of visible light, though small, is much bigger than an atom, making it invisible. X-rays, however, have a wavelength short enough that they can be used to "see" atoms. How does X-ray crystallography work? The precise position of each atom in a molecule can only be determined if the molecule will form crystals, which researchers grow in the lab through a variety of methods. When X-rays hit a crystallized molecule, the electrons surrounding each atom bend, or diffract, the X-ray beam, which then forms a pattern as it exits -- an X-ray diffraction pattern. Crystals are used because the diffraction pattern from one single molecule could be insignificant, but the many individual, identical molecules in a crystal amplify the pattern. It takes a computer to mathematically interpret this pattern and reconstruct the positions of the atoms. Purdue University researcher Michael G. Rossmann was a pioneer in using these techniques to study viruses. He has developed advanced techniques that rely on powerful computers to determine the structure of complex biological structures. What's it good for? Scientists have used X-ray diffraction patterns since the early part of this century to aid their studies of molecules. In 1953, when Watson and Crick looked at X-ray diffraction patterns from crystallized DNA, they were able to determine for the first time that DNA molecules exhibit a double-helical structure. But it was only in the late '50s, with the advent of computers, that scientists were able to determine the precise three-dimensional atomic structure of large molecules, such as proteins and enzymes.
- As brilliant as Charles Darwin was, not only was he unaware of irreducible complexity in nature, but also he was completely ignorant of the contents and design of a basic cell. He incorrectly assumed that a cell was just a simple blob of protoplasm, like jelly. In all fairness, he used the technology available to him in the 1850’s. However, electron microscopes did not exist in those days, nor did X-ray crystallography nor the computers than required for the imaging of these machines, but instead, relatively primitive instruments existed such as simple microscopes that relied upon visible light to illuminate its object, rather than beams of electrons, as used with electron microscopes of today. Note that it is impossible to “see” objects as small as atoms or molecules using visible light. Thus, Darwin was incapable of seeing small objects and creatures like this bizarre-looking Antarctic mite. At the smallest level, all Darwin could perceive were small, hollow sections that were called cells, which were actually just cell walls. Source: http://www.yesmag.bc.ca/how_work/microscope.html Consequently, neither Darwin nor any nineteenth century biologist had any understanding of cell complexity, which biologists of today now know to be nothing short of dazzling. Neither did they have even a hint of the true nature of the gene and of the mechanism of inheritance. Source: p. 64, EATIC Another huge set of facts that Darwin didn’t have access to was the number of fossil specimens that we have today, 150 years later. According to Dr. Michael Denton, “So vast has been the expansion of paleontological activity over the past one hundred years that probably 99.9% of all paleontological work has been carried out since 1860. Only a small fraction of the hundred thousand or so species know today were known to Darwin.” Source: p. 160-161 EATIC This important lack of data will play a key role later in our presentation, when we compare all the fossil evidence we have today with Darwin’s evolutionary predictions. Why can't you see an atom or molecule with visible light? It never will be possible to see atoms or molecules using visible light, even with the most powerful of microscopes. In order to see an object, its size has to be at least half the wavelength of the light being used to see it. But the wavelength of visible light, though small, is much bigger than an atom, making it invisible. X-rays, however, have a wavelength short enough that they can be used to "see" atoms. How does X-ray crystallography work? The precise position of each atom in a molecule can only be determined if the molecule will form crystals, which researchers grow in the lab through a variety of methods. When X-rays hit a crystallized molecule, the electrons surrounding each atom bend, or diffract, the X-ray beam, which then forms a pattern as it exits -- an X-ray diffraction pattern. Crystals are used because the diffraction pattern from one single molecule could be insignificant, but the many individual, identical molecules in a crystal amplify the pattern. It takes a computer to mathematically interpret this pattern and reconstruct the positions of the atoms. Purdue University researcher Michael G. Rossmann was a pioneer in using these techniques to study viruses. He has developed advanced techniques that rely on powerful computers to determine the structure of complex biological structures. What's it good for? Scientists have used X-ray diffraction patterns since the early part of this century to aid their studies of molecules. In 1953, when Watson and Crick looked at X-ray diffraction patterns from crystallized DNA, they were able to determine for the first time that DNA molecules exhibit a double-helical structure. But it was only in the late '50s, with the advent of computers, that scientists were able to determine the precise three-dimensional atomic structure of large molecules, such as proteins and enzymes.
- OK, so Darwin used primitive instruments and technology, had no understanding of genetics, and only saw a small fraction of the fossils we have today to devise his theory of evolution in the mid-1850’s. What’s that got to do with a bacteria flagellum? In essence, the bacteria flagellum, which Darwin could not have known existed, represents yet another massive stumbling block for which the theory of evolution is inept in explaining, much less in scientifically demonstrating how this micro-machine could have possibly evolved. It bears the obvious marks of design within every molecule of its structure. Bacteria flagella are tiny biological machines that use a long, whip-like, spinning “tail” if you will for propelling cells in liquid.They perform like a rotary propeller, such as those fitted to an outboard motor. They are a perfect biological example of irreducible complexity. Let’s take a closer look at these micro-marvels.
- What astounded molecular biologists about the bacteria flagellum (found, by the way, on such infamous bacteria such as e coli), is that the overall design of the motor that turns the propeller is designed on a molecular level precisely the way human engineers design motors today! In this illustration, you can see the flagellum’s long, whip-like propeller, which is made out of a protein called flagellin. This is attached to a drive shaft by hook protein, which acts as a universal joint, allowing the propeller and drive shaft to rotate freely. Several types of proteins act as a bushing material to allow the drive shaft to penetrate the bacterial wall and attach to the rotary motor.
- What astounded molecular biologists about the bacteria flagellum (found, by the way, on such infamous bacteria such as e coli), is that the overall design of the motor that turns the propeller is designed on a molecular level precisely the way human engineers design motors today! In this illustration, you can see the flagellum’s long, whip-like propeller, which is made out of a protein called flagellin. This is attached to a drive shaft by hook protein, which acts as a universal joint, allowing the propeller and drive shaft to rotate freely. Several types of proteins act as a bushing material to allow the drive shaft to penetrate the bacterial wall and attach to the rotary motor.
- What does this rotary motor have “under its hood?” Measuring in at only 1/20,000 of an inch, with most of its length being the propeller, the bacteria flagellum is turned by an acid-powered, liquid-cooled rotary motor capable of spinning up to 100,000 rpm. You may note that the tachometer of your modern car shows that your engine redlines at around a mere 6500 rpm! Like man-made machines of today, this motor contains similar parts: they have a rotor, a stator, u-joints, bushings, and a propeller (a rotating helical propeller, to be exact). These amazing nanomachines sport a propeller which can stop spinning and reverse direction within ¼ of a turn- a feat which our modern technology and intelligent designers are incapable of replicating at that level of rpm. In fact, one wonders if any engineer has ever even conceived of such a machine as this prior to its discovery.
- Some biologists have called it the most efficient motor in the universe, as its energy conversion efficiency is nearly 100%- yet another feat that our modern technology has been incapable of replicating-but elusively sought after by the greatest engineering minds of planet Earth. Imagine a boat with its motor running in a harbor- without a rudder or anyone steering it: eventually it will crash into something. The bacteria have sensory systems that feed into the bacteria flagellum and tell it when to turn on, turn off, and reverse direction, so that it guides it to food, light, or whatever its seeking. Its like a self-guided smart missile. Thus, the motor/propeller are connected with a sensory system for steering. This motor and sensory system also works in synchrony with multiple other flagella to coordinate its movement. Not bad for a so-called simple cellular organism without even a nucleus! Prokaryotic organisms tend to be so underrated! And finally, the bacteria flagellum is a nano-sized example of irreducible complexity: it requires at least several parts: a propeller, rotor, and stator, although genetic studies show that about 40 proteins (several of which are not used anywhere else in the body) are need to create a functional flagellum. But eliminate any one of these parts, and you don’t get a partially working flagellum, you get one that doesn’t work at all. To date, no Darwinian has proposed a step-by-step evolutionary explanation of how a gradual process could have yielded a bacteria flagellum.
- Even something as simple as a 3-5 year old child’s toy requires specifically sequenced assembly instructions. For example, you can’t put the handlebars on in Step 6 until multiple other components are assembled to the frame. Try to put the handlebars on any step earlier, and they will not fit or work.
- But there’s an even bigger problem that Darwinist cannot account for: precise assembly instructions. Biologist refer to bacteria flagellum as “self-replicating.” But these organisms “build themselves” in a specific sequence, just as a man-made machine must be build in a specific sequence (you can’t assemble the pedals on a bicycle until the crank unit and bearings are first properly installed into the bicycle frame, for example). As you can see from this sequence of images, biologists have discovered the specific steps by which a bacteria flagellum is constructed. But where do these instructions come from? It may be a statement of an obvious fact, but meaningful instructions are always a product of intelligence, that is, of a designing mind. The don’t arise from nothing, and they certainly don’t arise from non-intelligence, purposelessness, and randomness, as the Darwinist maintain, particularly at the nano-scale. Darwinists say that there is no intelligent process that could produce the bacteria flagellum! Darwin hoped that complexity would resolve to simplicity once we found the basis for life. But we’ve found the exact opposite. The basis for life, the cell, is outrageously complex! The 19th century idea that life at the bottom would be a simple phenomenon, is spectacularly wrong. Bacteria swim in viscous liquid environments by rotating helical propellers called flagella. Note how perfectly and precisely matched these components are with each other. In evolutionary terms, Darwinists must be able to explain how each of these individual parts gradually over time, in small, incremental steps evolved over generations, though they would have no survival value until all the necessary parts where in place. Yet Darwin said that each successive change from random genetic mutations must provide some advantage to the organism in its struggle for survival. Darwin said “Natural selection is scrutinizing the slightest variations, rejecting those that are bad, preserving and adding up all that are good.” But how could an organism evolve a bacterial flagellum when no such mechanism previously existed? How could a population of bacteria develop this new, multi-component system when each change must provide some type of advantage? Imagine, by some amazing stroke of chance, a bacteria developed a tail, complete with all its parts to attach it to the cell wall. Yet without a motor assembly, this innovation would provide no advantage to the cell. Instead, the tail would lie immobile and useless, invisible to natural selection, which by definition, can only favor changes that aid survival. So unless the tail system is fully assembled and works completely, natural selection cannot preserve it; it cannot be passed on to the next generation. NS only selects FOR a functional advantage, therefore, chance natural selection would select against a non-functioning tail. The only way to select for a flagellum is if you have one that works- that all the parts are present and function simultaneously, to begin with. Thus, NS can’t get you a bacteria flagellum; it can only work after the flagellum exists and is operating. “Co-option” idea suggests the components already existed for other molecular machines. NS was able to borrow components from one machine and use these to build another. BF flagellum has 40 structural parts; yes, we find ten in other molecular machines, but the other 30 are unique. So where is NS going to find these other 30 parts? It can’t. You’re borrowing parts from nothing. NS simply cannot account for this. But even if all 40 parts were somewhere present, you still have a more perhaps complex problem: assembly instructions. The construction not only requires specific parts (in the correct quantity) but also a precise sequence of assembly (and positioning) with feedback loops to indicate when a certain step is complete, and a different component can be added, plus quality checks to ensure that the machine functions, so the organism doesn’t waste energy building non-functional machines. Actually, in reality, other molecular machines are used in the regulating and construction of the bacterial flagellum- and those machines require yet other machines for their assembly! The origin of assembly instructions is never addressed by evolutionists. It’s like building a house: the foundation must first be poured before the walls are erected; similarly the roof cannot go on until the rafters are all in place. These instructions are provided by yet another system: DNA transcription and translation systems. And yet, if any one of these 40 pcs. are missing or put in the wrong place, the motor isn’t going to work. So, the apparatus to assemble the bacterial flagellum motor is itself irreducibly complex. In fact, we have irreducible complexity all the way down. 150 years ago, Darwin and other scientists were unaware of the components of a cell and of irreducibly complex machines. The bacterial flagellum is a nanomachine made of about 40 different proteins, each of them in multiple copies ranging from a few to tens of thousands. It is constructed by self-assembly of these large numbers of proteins, each into a different part that exerts a different function, such as a rotary motor, bushing, drive shaft, rotation-switch regulator, universal joint, helical propeller, and rotary promoter for self-assembly. Flagellar proteins are synthesized within the cell body and transported through a long, narrow central channel in the flagellum to its distal (outer) end, where they self-assemble to construct complex nano-scale structures efficiently, with the help of the flagellar cap as the assembly promoter. The rotary motor, with a diameter of only 30 to 40 nm, drives the rotation of the flagellum at around 300 Hz, at a power level of 10-16 W with energy conversion efficiency close to 100 %.
- The bacteria flagellum rotary motor is not some strange exception in nature; over 100 molecular motors are known to exist in the human body, with many more possibly being discovered. Each of these molecular motors have very specific analogies to human-designed motors. These motors are so small that 8 million of them can fit on the end of a human hair. Perhaps it is an understatement to say that these machines far exceed the capacity of human intelligence to replicate, though the Darwinists insist that no intelligent process produced them.
- Darwin hoped that complexity would resolve to simplicity once we found the basis for life. But we’ve found the exact opposite. The basis for life, the cell, is outrageously complex! The 19th century idea that life at the bottom would be a simple phenomenon, is spectacularly wrong. biochemists have learned that the cell is an incredible, intricate, highly complex, highly calibrated, Lilliputian world where a typical cell takes ten million million atoms to build. Says Dr. Michael Denton, to get a sense of the extreme complexity of the cell, magnify it a thousand million times until it is 12 miles in diameter, resembling a Zeppelin like the famous Hindenberg. You would then see a object of unparalleled intricacy, supreme technology, and bewildering complexity. ( Source: EATIC p. 328). Denton adds that the cell is “in effect a veritable microminiaturized factory containing thousands of intricate molecular machinery...far more complicated than any machine built by man and absolutely without parallel in the non-living world.” “The same sort of conceptual problem is met in trying to reconstruct the hypothetical sequence of transitional systems which led eventually to the modern cell.” ( Source: EATIC p. 250-251).
- Run by micromachines, the cell is staggeringly complicated, bearing obvious marks of design as a high-tech factory. For example, the cell utilized artificial languages and decoding systems. It contains memory banks for information storage and retrieval. There are control systems which regulate its automatic, self-assembly. It utilizes assembly processes involving prefabrication and modular construction. It is capable of complete self-replication of its entire, complex structure within a few hours! And one more thing: Let’s not forget that the cell also is electrochemically connected to about 100 trillion other cells in the body to work in perfect synchronicity, 24 hours per day, 7 days per week, 365 days per year without failure or stoppage, all for about 80 years or more! ( Source: ACFTC, p. 194)
- After having discussed the enormous complexity of just a single cell, it may seem at this point almost comical to consider Darwinian evolution’s audacious claim: That evolution can produce highly sophisticated, highly compact, highly complex, highly ordered, self-replicating systems like the cell or molecular machines… …which the pinnacle of human technology and intelligence is incapable of replicating… all with no intelligence at all. Frankly, it is this kind of scientific incongruity, plus others to be discussed later within this presentation, that have caused many evolutionists to become skeptical about the theory that they have previously fiercely protected and defended.
- We’ll now turn our attention to a scientific method for detecting design called “specified complexity.” Imagine that a friend hands you a sheet of paper with part of Lincoln’s Gettysburg address written on it: FOURSCOREANDSEVENYEARSAGOOURFATHERSBROUGHTFORTHONTHISCONTINENTANEWNATIONCONCEIVEDINLIBERTY … Your friend tells you that he wrote the sentence by pulling Scrabble pieces out of a bag at random. Would you believe him? Probably not. But why? One reason is that the odds against it are just too high. There are so many other ways the results could have turned out—so many possible sequences of letters—that the probability of getting that particular sentence is almost nil. But there’s more to it than that. If our friend had shown us the letters below, we would probably believe his story. ZOEFFNPBINNGQZAMZQPEGOXSYFMRTEXRNYGRRGNNFVGUMLMTYQXTXWORNBWIGBBCVHPUZMWLONHATQUGOTFJKZXFHP … Why? Because of the kind of sequence we see. The first string fits a recognizable pattern: It's a sentence written in English, minus spaces and punctuation. The second string fits no such pattern. Now we can understand specified complexity. When a design theorist says that a string of letters is specified, he’s saying that it fits a recognizable pattern. And when he says it's complex, he's saying there are so many different ways the object could have turned out that the chance of getting any particular outcome by accident is hopelessly small. Thus, we see design in our Gettysburg sentence because it is both specified and complex. We see no such design in the second string. Although it is complex, it fits no recognizable pattern. And if our friend had shown us a string of letters like "BLUE" we would have said that it was specified but not complex. It fits a pattern, but because the number of letter is so short, the likelihood of getting such a string is relatively high. Four slots don’t give you as many possible letter combinations as 143, which is the length of our Gettysburg sentence. So that’s the basic notion of specified complexity.
- Suppose a friend came to you with a bag of scrabble game pieces and told you that he dumped the bag out on the table and the tiles perfectly spelled out this sentence from Shakespeare’s play Hamlet: “To be, or not to be, that is the question.” Would you believe him? Probably not. But why?
- One reason is that the odds against it are just too high. There are so many other ways the results could have turned out—so many possible sequences of letters, plus the fact that some tiles would land face down, as this photo showing the tiles actually dumped out from a brand new set of Scrabble tiles—that the probability of getting that particular sentence is almost nil. Randomness tends only to produce a heap of nonsense combinations of letters, like “DSLCEDN” as shown in yellow. We would expect to see a random sequence like this. However, the sequence of “To be or not to be, that is the question” is unexpected because it fits a recognizable pattern: it’s a complete, meaningful sentence written in English using all the rules of proper syntax, spelling, and grammar. However, the sequence of DSLCEDN does not fit this recognizable pattern. Now we can understand specified complexity. When a design theorist says that a string of letters is specified, he’s saying that it fits a recognizable pattern. And when he says it's complex, he's saying there are so many different ways the object could have turned out that the chance of getting any particular outcome by accident is hopelessly small. Thus, we see design in our Shakespeare sentence because it is both specified and complex. We see no such design in the DSLCEDN. Although it is complex, it fits no recognizable pattern. So that’s the basic notion of specified complexity. And if our friend had shown us a string of letters like "BLUE" we would have said that it was specified but not complex. It fits a pattern, but because the number of letter is so short, the likelihood of getting such a string is relatively high. Four slots don’t give you as many possible letter combinations as 143, which is the length of our Gettysburg sentence. So that’s the basic notion of specified complexity.
- Let’s take a look at specified complexity by using a grid with four quadrants as a model. Each quadrant represents one of four possibilities for information. In the upper quadrants, we find that information can either be of low content or high content. In the lower quadrants, we find that information can also either be not complex or complex. Remember that when we’re using the term “specification” we mean that the information conforms to an independently recognizable pattern. To add another dimension to each of the quadrants, consider that information can also be of low specificity (that is, it barely conforms to an independently recognizable pattern) or high specificity. Also, based upon the amount and the meaningfulness of the information, its occurrence can also be of high probability, or low probability. Now let’s illustrate examples of each of the four quadrants.
- As a caveat to our grid model, note that many of these parameters actually occur in a range of possibilities, not just an either/or scenario. For example, the content may range from low and high, or anywhere in between. Similarly, the complexity of information can vary anywhere along the range from not complex at all (simple) to extremely complex information. Now let’s illustrate examples of each of the four informational possibilities.
- In our first possibility, the information contains low content and low specificity, and is also not complex, and as such, is highly probable. This string of letters contains no meaningful words at all (low content and low complexity). Apart from the individual letters of the alphabet itself, the complete string does not conform to any outside pattern, such as any English words. And lastly, since it is so low in content (virtually zero content), a monkey could type this out on a typewriter, therefore it’s occurrence is highly probable. In general, the lower the content of the information, the higher the probability of it occurring.
- Our second possibility is still low in content (it’s a simple word “Jim” and specificity (Jim conforms to a very basic outside pattern, namely, the English name “Jim.”). However, it has a higher complexity than our last example, though not very high complexity, and as such, would also represent a low probability, because, for example, it would be unlikely that a monkey could randomly type out these three letters in perfect sequence eight consecutive times.
- Our third possibility in not complex as a whole because it contains low meaning and is not recurring, although it does have several meaningful words such as “cat,” “get,” “rug,” and “cow.” Since it is relatively simple information, it is also high in probability- it is conceivable that a monkey could type out a few three-letter words in a random string like this. However, going back to our spectrum illustration earlier, this string would tend to lean towards the higher side of content because it does contain four meaningful words, and as such, would be considered to lean also towards the higher side of specificity, since it conforms to the external pattern of the four English words.
- Now we’ve reached the fourth possibility of information, and that string of data contains high content, specificity, and complexity, and as such, the likelihood of this string being randomly generated is of very low probability. It is this kind of information that illustrates we call specified complexity. It is specified, meaningful, matches an outside pattern, and highly improbable that this kind of information could be randomly typed out by a monkey. In fact, statistically speaking, the probability that these twenty-one letters be arranged in exactly this sequence is basically nil: one chance in one billion quadrillion chances.
- So from here on in our presentation, when we are speaking about information, we are defining it as having both content and complexity, as well as conforming to a specific outside pattern. And having all these characteristics, this information would be improbable in terms of random occurrence. Now we’re ready to make our main point in this section. Thus information is quantifiable in terms of improbable states and in terms of quantity of bits of information.
- What we’re about to present here, which we’ve been leading up to until now, is what mathematician Dr. William Dembski calls “The Explanatory Filter.” This filter, or flowchart, is actually a systematic, scientific way of detecting the presence of design, just by asking three questions. So if I want to scientifically determine if something is designed, or the product of chance, I first ask “Is it contingent?” In other words, can it happen in more than one way. If the answer is no, then it is necessary that a thing be the way that it is. However, if it is contingent, then we ask “Is it complex?” meaning, is it improbable? If the answer is no, it is highly probable, then the thing is the product of chance, not design. On the other hand, if it is complex or improbable, then we ask the last question: “Is it specified?” That is, does it match an independently given pattern or specification? If it does not match an independently given pattern or specification, then it, too, is the product of chance. However, if it does match an independently given pattern or specification, and is both contingent and complex, then it was designed; it was the effect of intelligence. Let’s now test this filter out on a real subject.
- Back to our Mt. Rushmore photo, we look at the carved faces and ask our first question: “Is it contingent?” Can the stone be shaped any other way than the shapes of the presidents faces? We can see from the surrounding stone that that is certainly the case, so the answer is “yes, it is contingent.” We then move down to the next question “Is it complex?” The shaping, carving, and smoothing of the stone is highly improbable and complex, so again, our answer is “yes, it is complex.” Our last question is “Is it specified?” Our answer is yes, the images of the faces carved on this mountain match the independent patterns of these same faces as found on various paintings, coins, and currency. This then leads us to the unmistakable conclusion that these carved faces were not the result of natural causes such as wind, erosion, rain, or glaciers- in other words, by chance, but rather by design. We recognize this sculpture as the work of at least one intelligent agent. Inferences to the best explanation. In this case, intelligence is the best explanation. Noone would attribute the shape of this mountain to natural causes such as sandstorms, or erosion. Nor would we attribute its shape as the result of wind and water over great periods of time. Instead, we recognize it as the work of an intelligent human agent- in fact its designer was Gutzon Borglum “who used simple multiplication and a plumb line to transfer the measurements of a scale model in his studio onto the mountain.” (Delta Sky Magazine, Oct. 2004, p. 73) Highly improbable, and one that matches an specific pattern elsewhere. Seaside: John Loves Mary; noone would infer the message was written by the tides, but the product of intelligence.
- Just for the fun of it, let’s try our filter out on another test case. This image illustrates a group of random rocks, yet several of them appear to be perfectly shaped letters of the alphabet, all in the same font style (though different sizes). These letters conform to the external pattern of the alphabet, though in this case, they do not form any complex pattern. Because of their contingency (they don’t have to be shaped like letters) and their specificity (some are shaped like letters of the alphabet), we intuitively and scientifically know that they are designed, rather than the products of chance. But most likely, you didn’t need the Explanatory Filter to know that these things were designed; this process is quite intuitive to humans. We know and are often awed when we stand in the presence of excellent design.
- But supposing your friend showed you this sequence of letters- would you believe that he dumped these out randomly? Possibly, since we would not consider it a miracle if one, two, or even three sequences of adjacent tiles happened to land to spell very short, unrelated words. Notice that we have assisted by turning all the tiles facing upward.
- What are the chances of forming a meaningful sentence by randomly dropping the Scrabble pieces on the tabletop to form a sentence? Note that only one of the twenty-six letters of the alphabet will be correctly positioned in the thirty-slot phrase. The probability of randomly getting all 30 letters of just one line of Shakespeare’s play Hamlet are one over 26 to the 30th power= 2.8x10 to the 39th power.
- George Bernard Shaw claimed “Give me a million monkeys over a million years, and they’ll be able to write Shakespeare’s Tempest” If we assume 100% participation constantly typing 24 hrs./day, 365 days/yr with 40 keys without concern for case or spacing., for simplified words of the first lines of the play, the “random” keystrokes could not produce 16 correctly spelled and sequenced letters matching just the first lines of this play (not the entire play!). Information doesn’t arise from random chance.
- Oh, but what about random mutation? Go to the website randommutation.com and type in any sentence—the quick brown fox jumped over the fence. Watch the fun as it mutates. You will discover that the sentence simply becomes more chaotic until it becomes incomprehensible. Mutations are just systematic noise and noise is not something you want to have. It requires intentionality to build up the possibility of information and that is what I am suggesting here. You have systems that cannot be built in small degrees. They are non-incremental and they all fit together.
- “one single cell can carry more data than all the volumes of the Encyclopedia Britannica.” I think that is pretty impressive, because we have to ask ourselves, where does all this information come from? What makes a message? If it symbolically represents something other than itself, it requires a speaker—which is a transmitter—and a listener—which is a receiver—and it contains the elements of language.
- Information must have an alphabet, it must have syntax—it must have meaning—and it must have intent. For example, I can say, “He didn’t steal that car.” It has an alphabet, which builds up to words, which builds to syntax and grammar, and then symbolic context. “HE didn’t steal that car” is very different in meaning than “He didn’t steal THAT car.” The same sentence can mean something different according to the intention, which now brings us to a fourth level.
- I am having this talk with you. You are recording it. What can we do with that? You can turn it into an MP3. You can send that as an electronic transmission to another computer. The computer can open it up. You can hear it or someone could transcribe it. You could then read it and you could print it out. But, here is the interesting point: Whether it is energy or matter, it is the same information—if it is a book or an image on a computer screen, it is the same information. Information transcends matter and energy. It is a third ‘ultimate’ and it cannot be reduced to matter and energy. It has to do with intentionality because you cannot have information without intention.
- I am having this talk with you. You are recording it. What can we do with that? You can turn it into an MP3. You can send that as an electronic transmission to another computer. The computer can open it up. You can hear it or someone could transcribe it. You could then read it and you could print it out. But, here is the interesting point: Whether it is energy or matter, it is the same information—if it is a book or an image on a computer screen, it is the same information. Information transcends matter and energy. It is a third ‘ultimate’ and it cannot be reduced to matter and energy. It has to do with intentionality because you cannot have information without intention.
- Norbert Weiner, who was an M.I.T. mathematician, is the father of modern cybernetics. He put it this way: “Information is information; neither matter nor energy. Any materialism that fails to take account of this will not survive one day.” The point, again, is that you are dealing with intentionality. Information is independent of all matter and all energy.
- Suppose you have a ‘green light’. What does that mean? It means you can get moving…or it could mean that you have go-ahead for the project. You are dealing with intention and you have to a mind to comprehend that. The lower cannot account for the larger. The larger can always account for the lower, but the little bits cannot account for the larger. Image: http://www.tackyandimmaculate.com/totd/traffic_light_green.png
- This is where we move into the atheist riddle. It is so simple that a child can understand it, but it is so complex that an atheist can’t solve it: Show me a message that doesn’t come from a mind. If you can show me a message—information—that doesn’t come from a mind I will be impressed.
- We’re not talking about just a little bit of information contained in DNA, we’re talking about a non-living substance encoded with the most densely packed, most elaborately detailed assembly of information in the known universe.
- Ruptured bacterial cell. No free ends in this chromosome loop!
- DNA is estimated to contain instructions that, if written out, would fill a thousand six-hundred page books (only 400 books are represented here, plus a one-page sample). A nerve cell may operate according to instructions from volume number 429 and a kidney cell from volume number 917, but both carry the whole compendium. It provides each cell’s sealed credential of membership in the body, all in an area ten thousand times smaller than a pinhead. Brand, Paul and Yancey, Philip, In The Likeness of God, Grand Rapids, MI.: Zondervan, 1980, P. 62
- To read a person’s genome sequence out loud without stopping at a rate of ten bases per second (A, T, C, G, A, T, C, G, A, T, and so on) would take 9 ½ years to finish. At a more realistic pace of three bases per second (rather than 10 per second) and a forty-hour reading week (rather than nonstop ready 24 hours a day), it would take 132 years to finish. Swensen, Richard A., More Than Meets the Eye, Colorado Springs, Co.: Navpress, 2000, P. 66
- To prevent fraud and unintentional errors by unauthorized users, VISA and AMEX both use a string of sixteen numbers, which their experience in security shows them statistically cannot be randomly generated, or even intentionally generated along with the name of the card holder. Thus, even with a common American name like “John Smith,” VISA’s security department is confident that his credit card number is highly unlikely to be randomly or intentionally generated. Interestingly enough, when we move from money to software, Microsoft is a little more stringent, using a 20 digit alpha-numeric sequence as a key to unlock this Microsoft Word software product which they believe is a extremely low probability can be randomly or intentionally generated by pirates. As you can see, two of America’s largest and most successful corporations live and know the improbability of randomly (or intentionally!) generating just 20 digits... which represents a mere 4-5 words of one encyclopedia! Were not even talking about generating a single sentence of data, a single page of data, a single chapter of data, a single volume of data, much less a full set of encyclopedias. It would be safe to say that both VISA and Microsoft would agree that the probability of generating a meaningful data set consisting of more than a full set of encyclopedias is ridiculously low--in fact, astronomically low.
- But there’s more! Did you know that the 3.2 billion letters of coding provides ten to the 3,480,000,000 power of possible combinations? That accounts for the amazing diversity of humans, from Aborigines to Eskimos. But as different in appearance as an Australian Aborigine is from an Alaskan Eskimo, from a genetic standpoint, their DNA is actually 99.9% identical to each other, and to yours! In other words, your DNA is only 0.1% different than that of any of the 6 billion people alive today.Also, 98% of DNA is referred to by genetic scientists as “junk DNA,” since only 2% of the DNA is made up of genes. That term has more to do with the scientific ignorance of the function of the vast majority of DNA than it does with the actual usefulness of the DNA.DNA is also implanted in the human body in vast quantities. Laid end to end, all your DNA strands from your 100 trillion cells would stretch from here to the sun and back 600 times! (And the sun is 93 million miles away!). You literally have an astronomical amount of genetic information encoded in your body.
- Quote from Dembski, p. 159 Intelligent Design Learning from one’s environment cannot be “saved” from one generation to the next.
- In a recent editorial Michael Behe said this about the pervasiveness of design: “The strong appearance of design allows a disarmingly simple argument: if it looks, walks and quacks like a duck, then, absent compelling evidence to the contrary, we have warrant to conclude it's a duck. Design should not be overlooked simply because it's so obvious. Still, some critics claim that science by definition can't accept design, while others argue that science should keep looking for another explanation in case one is out there. But we can't settle questions about reality with definitions, nor does it seem useful to search relentlessly for a non-design explanation of Mount Rushmore.” Source: February 7, 2005 OP-ED CONTRIBUTOR Design for Living By MICHAEL J. BEHE
- “One of the most spectacular discoveries of an assemblage of new fossil species was made in 1909 by the American paleontologist Charles Doolittle Walcott when he recovered from the Burgess shale formation of British Columbia a remarkable collection of wonderfully preserved animals dating from Cambrian times...” p. 161 EATIC “Alongside the many well-known forms such as jellyfish, starfish, trilobites and early molluscs present in these ancient sediments, Walcott found many species which were clearly representative of a hitherto unknown phyla...” p. 161 So what’s the significance of this fossil discovery? As Michael Denton puts it “If transitional types between major phyla ever existed then it is in these pre-Cambrian strata that their fossils should be found.
- Small scale changes imply large scale changes. It is interesting to note that both Darwinist and creationists acknowledge the fact of what is called “micro-evolution.” To extend this idea from micro to macro is the issue between ID and
- “Figure 4: Microevolution vs. Macroevolution. Notice that macroevolution would require an upward change in the complexity of certain traits and organs. Microevolution involves only horizontal (or downward) changes—no increasing complexity. Because science should always base conclusions on what is seen and reproducible, what is observed? We see variations in lizards, four of which are shown at the bottom. We also see birds, represented at the top. In-between forms (or intermediates), which should be vast in number if macroevolution occurred, are never seen as fossils or living species. A careful observer can usually see unbelievable discontinuities in these claimed upward changes. Ever since Darwin, evolutionists have made excuses for why the world and our fossil museums are not overflowing with intermediates.” “Creationists and evolutionists agree that microevolution occurs. Minor change has been observed since history began. But notice how often evolutionists give evidence for microevolution to support macroevolution. It is macroevolution—which requires new abilities, increasing complexity, and new genetic information—that is at the center of the creation-evolution controversy.” Source: Center for Scientific Creation: http://www.creationscience.com/onlinebook/LifeSciences2.html
- p. 172 EATIC
- Using good science to empirically prove the theory of macroevolution, one would expect to find, as Darwin said, an innumerable number of transitional species. Thus, we’d expect to see something like a reptile that could fly, perhaps an amphibious dog, a fish that really could fly, and an insect that was a transitional species to the larger animals like this “zebrapillar.” These illustrations are of course absurd and funny to us, because we all recognize that these creatures do not exist. Unfortunately, Darwinism has failed to produce proof of them, either, yet still claims to utilize good scientific analysis.
- Cambrian are the oldest fossil-bearing rocks. Note: Only 30-50 million years elapsed between the Cambrian and Precambrian eras- very little time to create new body forms of highly complex, fully functional creatures.
- For Darwinism, the fossil record is embarrassing. But nowhere is it more embarrassing than in the Cambrian Explosion (about 550 million years ago), also known as “the biological big-bang.” Here a dazzling array of new life forms suddenly appeared fully formed in the fossil record, without any of the ancestors required by Darwinism- also is powerful evidence of a designer. The reason: the phenomenon would have required the sudden infusion of massive amounts of new genetic and other biological information that only could have come from an intelligent source. Darwin knew the problems of the Cambrian explosion for his theory, but he had hoped that more exploration would vindicate him. After 150 years of fossil finds in Burgess Shales of Canada and the Chenjiang, China region, this problem has only worsened for evolutionists. Basically, most of the phyla suddenly appeared with complete and radically new body plans. This doesn’t square well with “numerous, successive, slight modifications” required by Darwin.
- Burgess Shale fossils found in the Rocky Mountains in western Canada in 1909 are believed to be dated about 520 million years old. Animals having bizarre shapes, without bones or shells, are here preserved intact. Darwin wrote “Natural selection has been the most important, but not the exclusive, means of modification,” but he had no direct evidence of natural selection. There was plenty of evidence that plants and animals vary, and that they struggle for survival. It was reasonable to conclude, by analogy, with domestic breeding, that organisms with the most advantageous variations would survive and pass them on to their offspring. But no one had actually documented this process in the wild. The best Darwin could do in the The Origin of Species was “give one or two imaginary examples.”
- Anomalocaris (proto-arthropod). A nasty predator of the Burgess shale that grew to a known length of 6 feet.
- hallucigenia - a small creature less than 1” in length, features unusual body construction with a bulbous head, stiff legs, and spine-like tentacles on its back connected to its gut. 420 million years ago a community of strange animals living on and around the sea bed were buried under a mud slide, in what is now British Columbia. Very unusually, the geological processes which turned this mud into rock did not destroy the soft parts of these animals, but preserved them in fine detail. For the first time, the soft parts of animals such as trilobites could be studied, but far more dramatically, a wide range of seemingly bizarre and unique soft-bodied animals were preserved. The Burgess Shale, as this rock is now called, gives us a special insight into life in the lower Cambrian. anomalocaris Hallucigenia, Pikaia, Eldonia, Halkieria, Marella, Vauxia Opabina, Wiwaxia Odonthogriphus
- With a retractable arm, five eye-stalks, and Stegosaurus-Like spiky tail, the Opabina is a bizarre-looking creature.
- Darwin also said “the number of intermediate and transitional links, between all living and extinct species, must have been inconceivably great.” Yet in 1859 those transitional links had not been found. But what does the fossil record show- an inconcievably great number of transitional species, or none at all?
- The embarrassing fossil record. Prior to the Cambrian, the fossil record only shows some jellyfish, sponges and worms. Then at the beginning of the Cambrian, BOOM! All of a sudden, we see representatives of arthropods, modern representatives which are insects, crabs, and the like; echinoderms, which include modern starfish and sea urchins; chordates, which include modern vertebrates; and so forth. Mammals came later, but the chordates--the major group to which they belong-- were right there at the beginning of the Cambrian. This irrefutable evidence is absolutely contrary to Darwin’s Tree of Life. Paleontologists have called this the single most spectacular phenomenon of the fossil record.
- The embarrassing fossil record. Prior to the Cambrian, the fossil record only shows some jellyfish, sponges and worms. Then at the beginning of the Cambrian, BOOM! All of a sudden, we see representatives of arthropods, modern representatives which are insects, crabs, and the like; echinoderms, which include modern starfish and sea urchins; chordates, which include modern vertebrates; and so forth. Mammals came later, but the chordates--the major group to which they belong-- were right there at the beginning of the Cambrian. This irrefutable evidence is absolutely contrary to Darwin’s Tree of Life. Paleontologists have called this the single most spectacular phenomenon of the fossil record.
- Phyla (major animal groups) represent the highest biological categories in the animal kingdom, with each phylum exhibiting a unique architecture, blueprint, or structural body plan. Familiar examples of basic animal body plans are cnidarians (corals and jellyfish), mollusks (squids and shellefish), arthropods (crustaceans, insects, and trilobites), echinoderms (sea star and sea urchins) and chordates, the phylum to which all vertebrates including humans belong. At the level of kingdoms, phyla, and classes, descent with modification from common ancestors is obviously not an observed fact.
- To build an animal requires, at a minimum, building many new types of cells. But cell types themselves require specialized proteins, and novel proteins require novel gene sequences- that is, new genetic information. The organisms that suddenly appeared in the Cambrian had many more novel and specialized cell types (and thus many more novel and specialized proteins) than the much more simple organisms found in the Precambrian. Hence, they would have required, at a minimum, a vast amount of new genetic information.
- Evolution in essence is a theory about history; there are only two ways to prove it: find the connecting links or reconstruct them in a plausible way.
- The embarrassing fossil record. Prior to the Cambrian, the fossil record only shows some jellyfish, sponges and worms. Then at the beginning of the Cambrian, BOOM! All of a sudden, we see representatives of arthropods, modern representatives which are insects, crabs, and the like; echinoderms, which include modern starfish and sea urchins; chordates, which include modern vertebrates; and so forth. Mammals came later, but the chordates--the major group to which they belong-- were right there at the beginning of the Cambrian. What’s more, pre-Cambrian fossils have subsequently been discovered in Edicara, Australia, and Cheng-Zhen, China with the same results. This irrefutable evidence is absolutely contrary to Darwin’s Tree of Life. Paleontologists have called this the single most spectacular phenomenon of the fossil record.
- “While most species make only, what is on a geological time scale, a fleeting appearance in the fossil record, often no more than a few million years, some have persisted almost unchanged for hundreds of millions of years down to modern times--these we call living fossils.” p. 301 EATIC “The overall picture of life on Earth today is so discontinuous, the gaps between the different types so obvious, that, as Steven Stanley reminds us in his book “Macroevolution,” if our knowledge of biology was restricted to those species presently existing on Earth, “we might wonder whether the doctrine of evolution would qualify as anything more than an outrageous hypothesis.” p. 157-158 EATIC
- The Coelacanth was a creature presumed by the scientific body before 1938 to have been extinct for 75 million years and purported to be as old as 450 million years. Evolutionary scientists used the coelacanth fossils as evidence to support their theory that fish evolved into amphibians. It was hailed as one of the great missing links, which was well on it's way to becoming an amphibian, that is, until one was caught off the coast of Madagascar in the Indian Ocean. Surprisingly it looked the same as it's alleged 75 million year old fossilized ancestor. It was found to be a fully functional fish type creature that forgot to evolve. A few days before Christmas in 1938, a Coelacanth was caught at the mouth of the Chalumna River on the east coast of South Africa. The fish was caught in a shark gill net by Captain Goosen and his crew, who had no idea of the significance of their find. They thought the fish was bizarre enough to alert the local museum in the small South African town of East London. The Director of the East London Museum at the time was Miss Marjorie Courtney-Latimer. She alerted the prominent south African ichthyologist Dr J.L.B. Smith to this amazing discovery. The Coelacanth was eventually named (scientific name: Latimeria chalumnae) in honour of Miss Courtney-Latimer. This Coelacanth specimen led to the discovery of the first documented population, off the Comoros Islands, between Africa and Madagascar. For sixty years this was presumed to be the only Coelacanth population in existence. The Coelacanth specimen caught in 1938 is still considered to be the zoological find of the century. This 'living fossil' comes from a lineage of fishes that was thought to have been extinct since the time of the dinosaurs. Coelacanths are known from the fossil record dating back over 360 million years, with a peak in abundance about 240 million years ago. Before 1938 they were believed to have become extinct approximately 80 million years ago, when they disappeared from the fossil record. http://www.austmus.gov.au/fishes/fishfacts/fish/coela.htm
- Aurora Borealis: when there is a flare on the sun, and the particles eventually reach the Earth, they’re funneled down the magnetic field to the north and south poles. We see thee beautiful lights in the northern hemisphere.
- Dawkins himself is probably the premier proponent of atheism.
- We know more about astronomy in this generation than in all the previous generations combined.
- Spiral galaxies get their name from the shape of their disks, in which stars, gas and dust are concentrated in spiral arms that extend outward from the central nucleus of the galaxies. Elliptical galaxies are elliptical in shape. Irregular galaxies have no particular shape. They are among the smallest galaxies and they contain a vast amount of gas and dust. As a result, they have a very high rate of star formation. The Large and Small Magellanic Clouds are examples of irregular galaxies. (Source: http://coolcosmos.ipac.caltech.edu/cosmic_classroom/cosmic_reference/galaxies.html) Caltech estimates galaxy percentages to be about: 20% spiral, 60% elliptical and 20% irregular (Source: http://coolcosmos.ipac.caltech.edu/cosmic_classroom/cosmic_reference/galaxies.html) Elliptical galaxies look sort of amorphous or egg-shaped, containing stars having very random orbits, like bees swarming a beehive. The gravitational pull of these swarming stars creates unstable planetary orbits (elliptical rather than circular), which in turn cause deadly temperature swings, and deadly exposure to stellar radiation. In any case, you’re less likely to find Earth-like planets in elliptical galaxies because most of them lack the heavy elements (carbon, nitrogen, oxygen, magnesium, and silicone, which are “cooked” in the interior of stars from hydrogen and helium and then expelled into the interstellar medium when the stars exploded as supernovae) needed to form them.
- Most elliptical galaxies are less massive and luminous than our galaxy. 1. Our galaxy is on the top one or two percent of the most massive and luminous. 2. The bigger the galaxy, the more heavy elements it can have, because its stronger gravity can attract more hydrogen and helium and cycle them to build heavy elements. 3. In low-mass galaxies, which make up the vast majority, you can have whole galaxies without a single Earth-like planet, because they just don’t have enough heavy elements to construct Earths. 4. Just like a globular cluster- you can have a whole globular cluster with hundreds of thousands of stars, and yet
- 1. Jupiter orbits the sun in 12 years in a nearly circular orbit, far out from the terrestrial planets- Mercury, Venus, Earth, and Mars. 2. Most other planets circling other stars orbits are highly elliptical; very few are circular. 3/4. Elliptical orbits pose a habitability problem for any of the terrestrial planets in their system, because it would make them less likely to have stable circular orbits (like Earth’s nearly perfect circle orbit). A planet with the mass of Earth would be sensitive to any of the gas giant planets if they had more eccentric orbits, exposing the planet to dangerous surface temperature variations. Earth’s and Jupiter’s circular orbits result in steady temperature and predictable climate on Earth.
- Other planets tie into the habitability of Earth. 1/2. Jupiter is +300X the mass of the Earth- it acts as a shield to protect us from too many comet impacts. It actually absorbs or deflects comets and keeps may of them from coming into the inner solar system, where they could collide with Earth with life-extinguishing consequences. 3. Saturn and Uranus participate in comet-catching for Earth, as well. 4. Our inner solar system also protects us from getting bombarded by asteroids from the asteroid belt. The asteroids are mostly between the orbits of Mars and Jupiter.
- If you want to get an idea of the stuff that would have probably hit Earth, look at the surface of the moon. The moon, unfortunately, has too little surface area to provide much protection for Earth.
- Astrobiologists coined the term “Circumstellar Habitable Zone,” meaning the region around a star where you can have liquid water on the surface of a terrestrial planet. This is determined by the amount of light you get from the host star. 1. You can’t be too close, otherwise too much water evaporates into the atmosphere and it causes a runaway greenhouse effect, and you boil off the oceans. This may be what happened to Venus. 2. If you get too far out, it gets too cold. Water and carbon dioxide freeze and you eventually develop runaway glaciation. 3. The further you go out from the sun, the more you must increase the carbon dioxide content of the planet’s atmosphere to trap the sun’s radiation and keep water liquid. The problem is that there wouldn't be enough oxygen to have mammal-like organisms. 4/5. It’s only on the very inner edge of the Circumstellar Habitable Zone where you can have low enough carbon dioxide and high enough oxygen to sustain complex animal life: +/-5% from exactly where Earth is.
- The sun, whose nuclear fusion, taking place at 27 million degrees Fahrenheit at its core, provides us with consistent warmth and energy 93 million miles away. Its mass is 300,000X the Earth’s mass. 1. Red dwarfs make up 80% of the stars, another 9% are called G dwarfs, most of which also are less massive than the sun. The sun is a yellow dwarf. 2. Problem with red dwarfs is they emit most of their radiation in the red part of the spectrum, making photosynthesis less effective, because photosynthesis requires both red and blue light. 3. Our sun has a higher abundance of heavy elements compared to other stars of its age in this region of the galaxy. The sun’s metallicity may be near the golden mean for building Earth-size habitable terrestrial planets. 4. The sun’s orbit is more nearly circular in the galaxy than most other stars of its age. That helps by keeping us away from the galaxy’s dangerous spiral arms (ie., supernovae, molecular clouds).
- 1. Binary, triple, and quadruple star systems. Most stars are multiple, two or three siblings swinging round one another in orbits comparable to those of the planets of the solar system. Most stars are too young, too old, too close, too far, too metallic, not metallic enough to sustain life on Earth. Must be a bachelor star, else incredible heat, magnetic, and gravitational pulls. That’s what we need. But only 1 in 10 stars are bachelors. 2. Too much luminosity causes increased particle radiation resulting from flares (which red dwarfs have). On Earth, we get a very mild effect called the aurora borealis. 3/4. But particle radiation has the effect of quickly stripping away the atmosphere, increasing the surface radiation levels, must most importantly, destroying the ozone layer, which we need to protect from radiation. All of this would be deadly for any life on a planet near a red dwarf.
- The moon really does support life- ours! Scientific evidence confirms how this parched, airless satellite actually contributes in unexpected ways to creating a lush and stable environment 250,000 miles away on Earth. 1. The moon actually stabilizes the tilt of the Earth’s axis. The tilt is responsible for our seasons. During the summer, in the northern hemisphere the north pole axis is pointed more toward the sun. Six months later, when the Earth is on the other side of the sun, the south pole is more pointed toward the sun. With the Earth’s tilt at 23.5 degrees, this gives us very mild seasons. Thus, the stability of our climate is attributable to the moon. 2. If the moon were not there, then our tilt could swing wildly over a large range, resulting in major temperature swings. If our tilt were more like 90 degrees, the north pole would be exposed to the sun for six months while the south pole would be in darkness, then vice-versa. Instead, it varies by only about 1.5 degrees- just a tiny variation, because the gravity from the moon’s orbit keeps it stabilized. 3. Mercury and Venus have no moons. Mars has two tiny moons- probably captured asteroids- and they don’t do anything to stabilize the axis of Mars. Its axis varies over a huge range. In fact, all three of these planets have chaotic variations in their tilt.
- 1. The Moon, because it is closer, is responsible for most of the tide (68.5%, or about twice as much tidal forcing as the sun). These are called “the lunar tides.” The Sun creates tides, also (about 31.5% of the total). [University of Alaska Fairbanks School of Ocean Sciences, http://www.sfos.uaf.edu/msl111/notes/tides.html] 2. Tides serve an important role by flushing out nutrients from the continents to the oceans. 3, NASA “Planetary Fact Sheet” shows the number of moons accordingly. [http://nssdc.gsfc.nasa.gov/planetary/planetfact.html] 4. Multiple moons would create deadly tides (like in the scene in Bruce Almighty where Bruce pulls the moon closer to Earth and causes a Tsunami in Japan). 5. Scientists discovered just a few years ago that lunar tides also help to keep large-scale ocean circulation going. That’s important because the oceans carry a lot of heat, which is necessary to keep the temperature of the higher latitudes relatively mild. 6. Size: there are several moons larger than Pluto and two larger than Mercury, and some are just asteroids. If the moon were more massive and in the same place, the tides would be much too strong, creating devastation. Also, the moon slows the Earth’s rotation. The tides pull on the Earth and slow it down a bit. Were it more massive, the slowdown of the Earth’s rotation would cause the days to become too long, then you could have large temperature differences between day and night.
- Earth’s interior is a dynamic and complex system 8,000 miles in diameter, with a solid iron core surface surrounded by iron that has been rendered liquid by the heat. At its center, where the pressure is more than 3 million times greater than at the planet’s surface, temperatures soar to 9000 degrees F. 1. The radioactive decay (from radioactive isotopes like Uranium 235, 238 and others) also helps drive the convection of the liquid iron surrounded the Earth’s core, which results in an amazing phenomenon: 2. the creation of a dynamo that actually generates the planet’s magnetic field, which is crucial to life on Earth 3. This magnetic field shields us from low-energy cosmic rays (dangerous radiation). 4. Also, solar wind particles would directly interact with the upper atmosphere, stripping it away, especially the molecules of hydrogen and oxygen from water. That would be bad news because water would be lost more quickly.
- 1. A terrestrial planet must have a minimum mass to retain an atmosphere. 2. You need an atmosphere for the free exchange of the chemicals of life and to protect inhabitants from cosmic radiation. 3. You need an oxygen-rich atmosphere to support large-brained creatures like humans. Earth’s atmosphere is 20% oxygen- just right, it turns out. 4. The planet must be a minimum size to retain its interior heat from being lost too quickly. It’s the heat from its radioactive decaying interior that drives the critically important mantle convection inside the Earth. If the Earth were smaller, like Mars, it would cool down too quickly; in fact, Mars cooled down and basically is dead.
- 1/2/3. Our planet is located between spiral arms of the Milky Way Galaxy where there are fewer stars (less harmful radiation and disruptive gravity) and less gas and dust (we can see the rest of the galaxy and universe). 4. Total eclipses are possible because the sun is 400X larger than the moon, and 400X farther away, creating a perfect match. Allows astronomers to discern finer details in the sun’s chromosphere and corona than from any other planet. Partial eclipse of the sun (where moon covers the sun’s photosphere).
- If we could say that life was created by extra-terrestrials, that’s OK, but if we say that it was created by something not in the physical universe, then there is a worldview If you look at the deepest pictures ever taken by the Hubble Space Telescope, they show literally millions of galaxies when the universe was young. People have commented, “Wow, look at all those galaxies! I wonder how many civilizations there are looking back at us?” Most astronomers would answer “zero.” There are thousands and thousands of galaxies- but zero Earths, because the heavier elements haven’t built up enough, not to mention the multiple factors 10 -215 Probability of all 200 fine-tuned parameters occurring by chance; Water is but one of 200 factors required to be present in order to sustain life on Earth (let alone provide the mechanism for life). The conditions necessary for life are far more numerous, and far more narrow (finely-tuned) in order for life to exist than ever imagined! There is a very delicate balance needed to provide exactly the right conditions required to permit life. These factors, present on Earth, show unmistakable fingerprints of intentionality: Intelligent Design. While the Earth is not at the geographic center of the universe, it is at its biological center.
- 60 dials, not 215 dials!
- Intelligent agents can produce information-rich systems. This we know for sure. We also know at present that there is no naturalistic explanation or natural cause that produces information- not natural selection, not pure chance, not self-organization. But we do know a cause that is capable of producing information, and that is intelligence. So when we find information in a system, such as a cell, we can infer that intelligence was the cause of that information, even if we weren’t present to observe the cell coming into existence.
- Intelligent agents can produce information-rich systems. This we know for sure. We also know at present that there is no naturalistic explanation or natural cause that produces information- not natural selection, not pure chance, not self-organization. But we do know a cause that is capable of producing information, and that is intelligence. So when we find information in a system, such as a cell, we can infer that intelligence was the cause of that information, even if we weren’t present to observe the cell coming into existence.
- Intelligent agents can produce information-rich systems. This we know for sure. We also know at present that there is no naturalistic explanation or natural cause that produces information- not natural selection, not pure chance, not self-organization. But we do know a cause that is capable of producing information, and that is intelligence. So when we find information in a system, such as a cell, we can infer that intelligence was the cause of that information, even if we weren’t present to observe the cell coming into existence.
- Intelligent agents can produce information-rich systems. This we know for sure. We also know at present that there is no naturalistic explanation or natural cause that produces information- not natural selection, not pure chance, not self-organization. But we do know a cause that is capable of producing information, and that is intelligence. So when we find information in a system, such as a cell, we can infer that intelligence was the cause of that information, even if we weren’t present to observe the cell coming into existence.
- The fine-tuning of the universe reveal the immense probabilities of chance.
- Turtle on a Fencepost illustration: You have 3 options;1. Its necessary; the turtle HAD to be there. Natural laws (like gravity, etc. simply demand that all turtles be placed atop fenceposts) 2. By chance; yes it could, conceivably, but remotely. But common sense will tell you that you could be there 10 million years and it wouldn’t get on top of the fencepost. If you see anything complex, there are only three options: contingency, complexity, specification. Specificity has both design and information.
- While there are competent and a growing number of scientists, if there is a paper that specifically implies ID, it is censored.
- 1/2, Behe said “It seems that the folks who get the most animated when talking about Darwinian evolution are the ones most concerned with the theological and philosophical ramifications of the theory, not the science itself.” I.D. may have religious implications, but it does not rely on religious premises. “So ID has profound metaphysical implications- so be it; let the truth lead where it may.” Scott Minnich, Molecular Biologist, University of Idaho * Sacred ground worthy only of the gnostic, high-priests of scientism
- "Our willingness to accept scientific claims that are against common sense is the key to an understanding of the real struggle between science and the supernatural. We take the side of science in spite of the patent absurdity of some of its constructs, in spite of its failure to fulfill many of its extravagant promises of health and life, in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism. It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, that we are forced by our a priori adherence to material causes to create an apparatus of investigation and a set of concepts that produce material explanations, no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is absolute, for we cannot allow a Divine Foot in the door." -- Richard Lewontin, Evolutionary Geneticist and Alexander Agassiz Research Professor at the Museum of Comparative Zoology, Harvard University, "Billions and Billions of Demons", The New York Review of Books, January 9, 1997 (see http://www.csus.edu/indiv/m/mayesgr/Lewontin1.htm) Darwinism claim for the all-sufficiency of chance (a completely mindless trial and error selection of random molecules p.357) as the agent of creation “one of the most daring claims in the history of science. But it is also one of the least substantiated.” (p.324 , EATIC). The hold of the evolutionary paradigm is so powerful that an idea which is more like a principle of medieval astrology than a serious twentieth-century scientific theory has become a reality for evolutionary biologists” p. 306 EATIC