SlideShare une entreprise Scribd logo
1  sur  76
Phylogenetic Workflows: Tree Building and Post-tree Analyses Naim Matasci The iPlant Collaborative Plant Biology 2011 August 6-10, 2011
Why is the tree of life important? “ Knowledge of evolutionary relationships is fundamental to biology, yielding new insights across the plant sciences, from comparative genomics and molecular evolution, to plant development, to the study of adaptation, speciation, community assembly, and ecosystem functioning.”
Nothing in biology makes sense except in the light of evolution. T. G. Dobzahnsky
Scalability Ackerly, 2009; J. Felsenstein, ca. 1980; Ranger Cluster at TACC
iPlant Tree of Life Grand Challenge ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Ancestral state of Hawaiian lobelioids Lobelia niihauensis  (Image: David Eickhoff) Cyanea leptostegia  (Image: Karl Magnacca)
 
Continuous Ancestral Character Estimation  (Schulter  et al.  1997, Paradis 2004) ?
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
>gi|1835233|emb|Z83147.1| S.nepaulensis rbcL gene TTATTATACTCCTGAATAYGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTGCTCAGCCT GGAGTTCCACCCGAAGAAGCGGGGGCCGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGT GGACCGATGGACTTACTAACCTTGATCGTTACAAAGGGCGATGCTACAACATAGAGCCCGTTGCTGGAGA AGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATG TTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAA TCCCTACTGCGTATTGTAAAACTTTCCAAGGACCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAA CAAGTATGGTCGTCCCTTGCTGGGATGTACTATTAAACCTAAATTGGGGTTATCGGCTAAAAACTACGGT AGAGCAGTTTATGAATGTCTACGCGGTGGGCTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAAC CATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTTTAAAGCACAGTCTGAAACAGG TGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCTATATTT >gi|1835227|emb|Z83136.1| S.foetidissimum rbcL gene AAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAA GATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCG CGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGCCTTGATCG TTACAAAGGGCGATGCTACCACATCGAGCCCGTNGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCT TATCCTTTAGACCTYTTTGAAGAAGGTTCTGTTACTAATATGTKNACTTCCATTGTGGGGAATGTATTTG GGTTCAAAGCCCTGCGTGCTTTACGTCTGGAAGATCTGCGAATCCCTCCTGCGTATTCTAAAACTTTCCA AGGACCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGT ACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTG GACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTT ATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCT >gi|1834456|emb|Z83132.1| G.urceolata rbcL gene AACTAAAGCGGGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGACTAT GAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAG CGGGGGCCGCCGTAGCTGCCGAATCCTCCACTGGTACATGGACAACTGTGTGGACCGACGGACTTACTAG CCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTGGCTGGAGAAGAAAATCAATTTATTGCT TATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTA ATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCGTATGCTAA AACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAATAAGTATGGTCGTCCCCTG
Get Sequences ,[object Object],[object Object]
Get sequences DEMO
 
 
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
muscleDEMO
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Improved Tree Building Tools ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
RAxML DEMO
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Tree Visualization ,[object Object],[object Object],[object Object],[object Object],[object Object]
iPlant Tree Viewer http://portnoy.iplantcollaborative.org/
Live tree view demo
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Obstacles
Lopper DEMO
 
 
 
 
 
 
 
 
 
 
 
 
Lobelia kauaensis Lobelia villosa Galeatella gloria-montis Trematolobelia kauaiensis Trematolobelia macrostachys Lobelia hypoleuca Neowimmeria yuccoides Lobelia niihauensis Brighamia insignis Brighamia rockii Delissea rhytidosperma Delissea subcordata Cyanea acuminata Cyanea hirtella Cyanea coriacea Delissea leptostegia Clermontia kakeana Clermontia parviflora Clermontia arborescens Clermontia fauriei
The TNRS: A Taxonomic Name Resolution Service for Plants Tonight from 5:30 - 7:30 in Exhibit Hall A. Poster number  P21011 .
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
CACE DEMO
 
 
 
 
 
 
 
 
 

Contenu connexe

Tendances

Phylogenetic Tree evolution
Phylogenetic Tree evolutionPhylogenetic Tree evolution
Phylogenetic Tree evolutionMd Omama Jawaid
 
Bioinformatics.Assignment
Bioinformatics.AssignmentBioinformatics.Assignment
Bioinformatics.AssignmentNaima Tahsin
 
Molecular Phylogenetics
Molecular PhylogeneticsMolecular Phylogenetics
Molecular PhylogeneticsMeghaj Mallick
 
Survey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysisSurvey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysisArindam Ghosh
 
MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)Athar Mutahari
 
Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...IAEME Publication
 
PMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological dataPMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological dataYiteng Dang
 
Phylogenetic analysis in nutshell
Phylogenetic analysis in nutshellPhylogenetic analysis in nutshell
Phylogenetic analysis in nutshellAvinash Kumar
 

Tendances (12)

Phylogenetic Tree evolution
Phylogenetic Tree evolutionPhylogenetic Tree evolution
Phylogenetic Tree evolution
 
Bioinformatics.Assignment
Bioinformatics.AssignmentBioinformatics.Assignment
Bioinformatics.Assignment
 
Molecular Phylogenetics
Molecular PhylogeneticsMolecular Phylogenetics
Molecular Phylogenetics
 
Survey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysisSurvey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysis
 
Phylogenetic studies
Phylogenetic studiesPhylogenetic studies
Phylogenetic studies
 
MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)
 
Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...
 
The tree of life
The tree of lifeThe tree of life
The tree of life
 
Fasta
FastaFasta
Fasta
 
PMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological dataPMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological data
 
Protease Phylogeny
 Protease Phylogeny  Protease Phylogeny
Protease Phylogeny
 
Phylogenetic analysis in nutshell
Phylogenetic analysis in nutshellPhylogenetic analysis in nutshell
Phylogenetic analysis in nutshell
 

Similaire à Phylogenetic Workflows

Post-tree Analyses Workflow
Post-tree Analyses WorkflowPost-tree Analyses Workflow
Post-tree Analyses WorkflowNaim Matasci
 
iPlant Tree of Life
iPlant Tree of LifeiPlant Tree of Life
iPlant Tree of LifeNaim Matasci
 
Functionally annotate genomic variants
Functionally annotate genomic variantsFunctionally annotate genomic variants
Functionally annotate genomic variantsDenis C. Bauer
 
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Spark Summit
 
Thesis def
Thesis defThesis def
Thesis defJay Vyas
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitNaim Matasci
 
Carleton Biology talk : March 2014
Carleton Biology talk : March 2014Carleton Biology talk : March 2014
Carleton Biology talk : March 2014Karen Cranston
 
2 md2016 annotation
2 md2016 annotation2 md2016 annotation
2 md2016 annotationScott Dawson
 
Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...Anubis Hosein
 
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...Natalio Krasnogor
 
Visual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationVisual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationNils Gehlenborg
 
Inference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' worldInference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' worldJoe Parker
 
Transcript detection in RNAseq
Transcript detection in RNAseqTranscript detection in RNAseq
Transcript detection in RNAseqDenis C. Bauer
 
Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1 Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1 Denis C. Bauer
 
Utility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogeneticUtility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogeneticEdizonJambormias2
 
Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012gregcaporaso
 
Introduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysisIntroduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysisJosh Neufeld
 
Network Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systemsNetwork Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systemsGanesh Bagler
 

Similaire à Phylogenetic Workflows (20)

Post-tree Analyses Workflow
Post-tree Analyses WorkflowPost-tree Analyses Workflow
Post-tree Analyses Workflow
 
iPlant Tree of Life
iPlant Tree of LifeiPlant Tree of Life
iPlant Tree of Life
 
Functionally annotate genomic variants
Functionally annotate genomic variantsFunctionally annotate genomic variants
Functionally annotate genomic variants
 
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
 
Omics Integration
Omics IntegrationOmics Integration
Omics Integration
 
Thesis def
Thesis defThesis def
Thesis def
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and Toolkit
 
Carleton Biology talk : March 2014
Carleton Biology talk : March 2014Carleton Biology talk : March 2014
Carleton Biology talk : March 2014
 
2 md2016 annotation
2 md2016 annotation2 md2016 annotation
2 md2016 annotation
 
Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...
 
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
 
Visual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationVisual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient Stratification
 
phy prAC.pptx
phy prAC.pptxphy prAC.pptx
phy prAC.pptx
 
Inference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' worldInference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' world
 
Transcript detection in RNAseq
Transcript detection in RNAseqTranscript detection in RNAseq
Transcript detection in RNAseq
 
Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1 Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1
 
Utility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogeneticUtility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogenetic
 
Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012
 
Introduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysisIntroduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysis
 
Network Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systemsNetwork Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systems
 

Plus de Naim Matasci

iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3Naim Matasci
 
iPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio WorkshopiPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio WorkshopNaim Matasci
 
The iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life SciencesThe iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life SciencesNaim Matasci
 
Phylotastic reconciliation
Phylotastic reconciliationPhylotastic reconciliation
Phylotastic reconciliationNaim Matasci
 
Phylogenetic Workflows
Phylogenetic WorkflowsPhylogenetic Workflows
Phylogenetic WorkflowsNaim Matasci
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitNaim Matasci
 
The TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for PlantsThe TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for PlantsNaim Matasci
 

Plus de Naim Matasci (8)

iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3
 
iPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio WorkshopiPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio Workshop
 
The iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life SciencesThe iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
 
iPlant TNRS
iPlant TNRSiPlant TNRS
iPlant TNRS
 
Phylotastic reconciliation
Phylotastic reconciliationPhylotastic reconciliation
Phylotastic reconciliation
 
Phylogenetic Workflows
Phylogenetic WorkflowsPhylogenetic Workflows
Phylogenetic Workflows
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and Toolkit
 
The TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for PlantsThe TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for Plants
 

Dernier

AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024The Digital Insurer
 
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWEREMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWERMadyBayot
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodJuan lago vázquez
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoffsammart93
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024The Digital Insurer
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processorsdebabhi2
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Miguel Araújo
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfsudhanshuwaghmare1
 
MS Copilot expands with MS Graph connectors
MS Copilot expands with MS Graph connectorsMS Copilot expands with MS Graph connectors
MS Copilot expands with MS Graph connectorsNanddeep Nachan
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?Igalia
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)wesley chun
 
Corporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxCorporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxRustici Software
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonAnna Loughnan Colquhoun
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherRemote DBA Services
 
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...apidays
 
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobeapidays
 
Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024The Digital Insurer
 

Dernier (20)

AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024
 
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWEREMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
 
MS Copilot expands with MS Graph connectors
MS Copilot expands with MS Graph connectorsMS Copilot expands with MS Graph connectors
MS Copilot expands with MS Graph connectors
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)
 
Corporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxCorporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptx
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a Fresher
 
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
 
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
 
Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024
 

Phylogenetic Workflows

  • 1. Phylogenetic Workflows: Tree Building and Post-tree Analyses Naim Matasci The iPlant Collaborative Plant Biology 2011 August 6-10, 2011
  • 2. Why is the tree of life important? “ Knowledge of evolutionary relationships is fundamental to biology, yielding new insights across the plant sciences, from comparative genomics and molecular evolution, to plant development, to the study of adaptation, speciation, community assembly, and ecosystem functioning.”
  • 3. Nothing in biology makes sense except in the light of evolution. T. G. Dobzahnsky
  • 4. Scalability Ackerly, 2009; J. Felsenstein, ca. 1980; Ranger Cluster at TACC
  • 5.
  • 6. Ancestral state of Hawaiian lobelioids Lobelia niihauensis (Image: David Eickhoff) Cyanea leptostegia (Image: Karl Magnacca)
  • 7.  
  • 8. Continuous Ancestral Character Estimation (Schulter et al. 1997, Paradis 2004) ?
  • 9.
  • 10.
  • 11. >gi|1835233|emb|Z83147.1| S.nepaulensis rbcL gene TTATTATACTCCTGAATAYGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTGCTCAGCCT GGAGTTCCACCCGAAGAAGCGGGGGCCGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGT GGACCGATGGACTTACTAACCTTGATCGTTACAAAGGGCGATGCTACAACATAGAGCCCGTTGCTGGAGA AGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATG TTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAA TCCCTACTGCGTATTGTAAAACTTTCCAAGGACCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAA CAAGTATGGTCGTCCCTTGCTGGGATGTACTATTAAACCTAAATTGGGGTTATCGGCTAAAAACTACGGT AGAGCAGTTTATGAATGTCTACGCGGTGGGCTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAAC CATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTTTAAAGCACAGTCTGAAACAGG TGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCTATATTT >gi|1835227|emb|Z83136.1| S.foetidissimum rbcL gene AAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAA GATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCG CGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGCCTTGATCG TTACAAAGGGCGATGCTACCACATCGAGCCCGTNGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCT TATCCTTTAGACCTYTTTGAAGAAGGTTCTGTTACTAATATGTKNACTTCCATTGTGGGGAATGTATTTG GGTTCAAAGCCCTGCGTGCTTTACGTCTGGAAGATCTGCGAATCCCTCCTGCGTATTCTAAAACTTTCCA AGGACCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGT ACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTG GACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTT ATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCT >gi|1834456|emb|Z83132.1| G.urceolata rbcL gene AACTAAAGCGGGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGACTAT GAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAG CGGGGGCCGCCGTAGCTGCCGAATCCTCCACTGGTACATGGACAACTGTGTGGACCGACGGACTTACTAG CCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTGGCTGGAGAAGAAAATCAATTTATTGCT TATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTA ATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCGTATGCTAA AACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAATAAGTATGGTCGTCCCCTG
  • 12.
  • 14.  
  • 15.  
  • 16.  
  • 17.  
  • 18.  
  • 19.  
  • 20.  
  • 21.  
  • 22.
  • 24.  
  • 25.  
  • 26.  
  • 27.  
  • 28.  
  • 29.  
  • 30.
  • 31.
  • 33.  
  • 34.  
  • 35.  
  • 36.  
  • 37.  
  • 38.  
  • 39.
  • 40.
  • 41. iPlant Tree Viewer http://portnoy.iplantcollaborative.org/
  • 43.  
  • 44.  
  • 45.  
  • 46.  
  • 47.  
  • 48.  
  • 49.
  • 52.  
  • 53.  
  • 54.  
  • 55.  
  • 56.  
  • 57.  
  • 58.  
  • 59.  
  • 60.  
  • 61.  
  • 62.  
  • 63.  
  • 64. Lobelia kauaensis Lobelia villosa Galeatella gloria-montis Trematolobelia kauaiensis Trematolobelia macrostachys Lobelia hypoleuca Neowimmeria yuccoides Lobelia niihauensis Brighamia insignis Brighamia rockii Delissea rhytidosperma Delissea subcordata Cyanea acuminata Cyanea hirtella Cyanea coriacea Delissea leptostegia Clermontia kakeana Clermontia parviflora Clermontia arborescens Clermontia fauriei
  • 65. The TNRS: A Taxonomic Name Resolution Service for Plants Tonight from 5:30 - 7:30 in Exhibit Hall A. Poster number P21011 .
  • 66.
  • 68.  
  • 69.  
  • 70.  
  • 71.  
  • 72.  
  • 73.  
  • 74.  
  • 75.  
  • 76.  

Notes de l'éditeur

  1. Our understanding of the phylogeny of the half million known species of green plants has expanded dramatically over the past two decades, The task of assembling a comprehensive "tree of life" for them presents a Grand Challenge. Also part of the grand challenge is developing the necessary infrastructre to view and use the tree of life, to put it into the hands of plant biologists
  2. Left tree: Maple tree phylogeny from D. Ackerly Left picture: Joe Felsenstein, ca. 1980 Right picture: Ranger cluster at TACC
  3. Distance matrix calculation compared to FASTREE