How can Optical Mapping accelerate my research?
•Télécharger en tant que PPTX, PDF•
3 j'aime•2,038 vues
This presentation accompanies a webinar at: https://www1.gotomeeting.com/register/367952841 === Hitachi Solutions has partnered with OpGen to offer MapIt® Optical Mapping Services to our customers. Trevor Wagner, Senior Applications Scientist Manager from OpGen will be our guest presenter. Trevor was part of the team that developed, tested, and released OpGen’s first major product, the Argus Optical Mapping System in 2010. This webinar will describe: 1. How Optical Mapping technology will benefit you in the following application areas: -Strain Typing -Comparative Genomics -Whole-genome Sequence Assembly 2. How the MapIt Service works.
Recommandé
Recommandé
Contenu connexe
Tendances
Tendances (20)
Similaire à How can Optical Mapping accelerate my research?
Similaire à How can Optical Mapping accelerate my research? (20)
Dernier
Dernier (20)
How can Optical Mapping accelerate my research?
- 1. 1
- 2. Webinar: How can Optical Mapping accelerate my research? Please note: This presentation accompanies the webinar recording at: https://www1.gotomeeting.com/register/36795 2841 August 10th, 2011 Robert Lynde Deputy Director, Hitachi Solutions Erin Newburn Field Applications Scientist, OpGen Inc. www.miraibio.com | support@miraibio.com | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
- 3. Hitachi Solutions America, Ltd. • Part of the Hitachi family of companies that have been around for more than 100 years • #47 on the Global 500 • Everything from bullet trains to life science software and services • MasterPlex has been on the market for over 8 years • Introducing MapIt® Optical Mapping Services www.miraibio.com | support@miraibio.com | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
- 4. OpGen, Inc. • A leading innovator in rapid, accurate genomic and DNA analysis systems. • Its Optical Mapping technology is being used by leading genomic research centers, public health agencies, biodefense organizations, academic institutions, biotechnology companies, and clinical research organizations worldwide to help rapidly analyze microbial genomes. • In 2010, OpGen released its Optical Mapping System to allow individuals another method to access the Optical Mapping technology. www.miraibio.com | support@miraibio.com | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
- 5. What is Optical Mapping and how is it used? www.miraibio.com | support@miraibio.com | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
- 6. Optical Mapping—Solutions for Whole Genome Analysis Erin N. Newburn, Ph.D. Field Applications Scientist OpGen Inc.
- 7. Webinar Agenda • Optical Mapping technology overview • Optical Mapping applications – Strain typing – Comparative genomics – Whole genome sequence assembly • Argus®Optical Mapping System • Future applications for larger genomes
- 8. What is Optical Mapping? Whole genome, ordered restriction maps • Whole genome analysis of bacteria, yeast, fungi – High level of precision – Eliminates high cost of sequencing • De novo process, no sequencing required
- 9. Optical Mapping Locates and measures distance between restriction sites acagctctcgagaggatcctcgtcgggatccctcgcgctcgagatcgcgtagcgctagagc gctctagaggctcgcggagagctcgcgcgagtgcgtcggggacacattcgaggatccagtt agagatcggctcgtgctagaggcctgctcgtagagacacagatagacagatagagcggctcg ctctcgctgctcggaagtcgctcgcgtaagttcgcgctggatcccacagctcgcgctgacaca gtcgcgtagagatgcggctgagcgctggcgctgaggctggacagtgctgctgagctcggaca gctcgtgtggcgcggatccgtgctcggcggatcctagggcgtgtcgcgtgctggatgcgc tggtgggccccagtttggcggcgctcgcggctcggctgctggtcgcctgcttt These patterns are specific to individual organisms - identify, compare microbial isolates
- 10. How Optical Mapping Works Cells gently lysed to extract long genomic DNA molecules, pieces of microbial chromosomes DNA is captured in parallel arrays of single DNA molecules using microfluidic device After staining with intercalating dye digestion reveals restriction cleavage sites as ―gaps‖, under fluorescent microscopy
- 11. Image Analysis and Markup
- 12. Map Assembly 27.52 40.52 51.99 24.45 58.94 17.93 45.26 28.99 46.25 8.89 7.20 5.52 1.56 8.08 Overlapping single molecule restriction maps are aligned to produce a map assembly covering an entire chromosome
- 13. Map Assembly consensus map Patterns of restriction sites highly informative ~ 500 sites per Salmonella genome Characteristic of microbial species and individual isolates Use to identify samples to strain level Overlapping single molecule restriction maps are aligned to produce a map assembly covering an entire chromosome
- 15. Optical Mapping Single molecule approach generates whole-genome, ordered restriction maps Optical Maps are compared to perform high resolution epidemiology, discover genetic variation, and accelerate sequence assembly Strain Comparative Sequence Typing Genomics Assembly
- 16. Strain Typing
- 17. Strain Typing High Resolution Epidemiology with Optical Mapping Traditional technologies (PFGE, ribotyping & Rep-PCR) provide limited information, are unreliable for distinguishing closely related isolates, do not relate to sequencing data
- 18. Strain Typing Optical Mapping Compared to PFGE USA-400(MW2) GLMC-10 GLMC-10 USA 400 SSCMec VS-alpha PhiSA2 (PVL) Optical Mapping detects absence of SSCmec, VS-α, PhiSA2/PVL
- 19. Strain Typing: Ongoing E coli Outbreak • E coli O104:H4 outbreak reported in Germany, May 2011 – Shiga toxin positive (rare for O104:H4) – High incidence of hemolytic uremic syndrome (HUS) – Similar to Enteroaggregative E coli (EAEC) which normally produces mild illness • Reports spread to 12 countries, including US, Canada • Over 3,000 cases reported by June 13, including 35 deaths
- 20. Strain Typing: Ongoing E. coli Outbreak Current Outbreak 2001 HUS outbreak EAEC Seq. Reference • Whole genome maps available in 48 hours • Indicated outbreak was clonal – single source • Identified genomic islands unique to the outbreak
- 21. Strain Typing: Ongoing E coli Outbreak Current Outbreak Outbreak Specific Conserved Region 2 stx2 tehA Outbreak Specific Outbreak Specific Conserved Conserved Region 1 Region 3
- 22. Strain Typing: Publication Example 2006 E. coli O157:H7 ―Spinach‖ Outbreak • 51% hospitalizations v typical 10-20% • 15% kidney failure v typical 2-7% (and 3 deaths) • FDA CFSAN used Optical Mapping to identify 13 chromosomal markers that define the outbreak strain • Outbreak strain contained prophage insertions carrying extra Shiga toxin genes resulting in increased pathogenicity • “Most of the chromosomal changes found by optical mapping would not have been detected by microarray-based techniques” • “Optical mapping ….. provides insights into chromosomal changes and gene acquisitions that neither PFGE nor microarray analysis allow” Kotewicz et al (2008) Microbiology 154: 3518-3528
- 23. Strain Typing Summary • Optical Mapping provides required resolution to differentiate closely related strains: > 90% sequence similarity • Other technologies lack resolution and typically focus on a few loci, may not relate to sequencing
- 25. Comparative Genomics Background Definition: Analysis and comparison of genomes from different strains and different species to better understand gene function and relatedness. Involves: • Sequence similarity • Gene location and synteny (order of genes) • Conserved and non-conserved regions of the genome
- 26. Comparative Genomics Comparative analysis of US Vancomycin-resistant Staphylococcus aureus strains
- 27. Comparative Genomics Comparative analysis of US Vancomycin-resistant Staphylococcus aureus strains VRSA-6 has direct repeat
- 28. Comparative Genomics: Enterococcus faecalis • E. faecalis isolates are diverse at whole genome level with differences from 0% to 35% • Strain V583 is whole genome DNA sequence • ATCC 49477 is 2.9% different at the whole-genome level from V583 using Optical Map
- 29. Comparative Genomics: Enterococcus faecalis ATCC 49477 V583 • van genes are responsible for vancomycin resistance in Enterococcus faecalis1 • Optical Mapping can draw attention to insertions that confer antibiotic resistance 1Evers & Courvalin (1996). J Bacteriol 178(5):1302-9.
- 31. Sequence Assembly Re-sequencing Validation Anne Buboltz, Microbial Genomics Conference (2009)
- 32. Sequence Assembly Re-sequencing Validation Alignment with MapSolver™ Four Misassemblies Anne Buboltz, Microbial Genomics Conference (2009)
- 33. Sequence Assembly Re-sequencing Validation Contig Breakage and Alignment Anne Buboltz, Microbial Genomics Conference (2009)
- 34. Sequencing Assembly Inversion Identified Anne Buboltz, Microbial Genomics Conference (2009)
- 35. Sequence Validation: Optical Mapping Finished Genomes • Finished whole-genome DNA sequences are considered the gold standard (Chain et al. 2009) • Finished whole-genome DNA sequences provide valuable insights into organization and structure of the genome that draft quality sequences cannot offer (Fraser et al. 2002) • However, currently no strict quality or validation requirement for submitting a finished whole-genome to GenBank or peer- reviewed journal
- 36. Sequence Validation: Optical Mapping Finished Genomes • Purpose – Produce Optical Maps of published and peer-reviewed finished bacterial genomes to validate quality of the finished genome • Hypothesis – Optical Mapping will identify at least one finished genome to contain a discrepancy.
- 37. Sequence Validation: Optical Mapping Finished Genomes • Methodology – Select organisms with finished genomes that are linked to a specific ATCC submission – Generate Optical Maps using Argus® Optical Mapping System – Compare Optical Maps to in silico maps of finished genomes
- 38. Sequence Validation: Optical Mapping Finished Genomes 13 ATCC isolates selected for validation
- 39. Sequence Validation: Optical Mapping Finished Genomes Relative in silico Insertion Discrepancy Example Finished whole-genome DNA sequence contained 131 Kb extra DNA that should not be in ATCC 17978
- 40. Sequence Validation: Optical Mapping Finished Genomes Relative in silico Deletion Discrepancy Example • Finished whole-genome DNA sequence missed a 375 Kb repetitive region, most likely a ribosomal repeat that the sequence assembler compressed • Optical Mapping can span these large regions by using >150 Kb single molecule restriction maps
- 41. Sequence Validation: Optical Mapping Finished Genomes Relative in silico Inversion Discrepancy Example • The first V. cholerae finished genome published in 1999 contains a putative inverted misassembly
- 42. Sequence Validation: Optical Mapping Finished Genomes • Optical Map of N16961 compared to finished genome of V. cholerae M66-2 published in 2009 • M66-2 contains a putative inverted misassembly at the same locus as the DNA sequence of N16961, and is probably a resequencing error propagated into M66-2
- 43. Optical Mapping Complements Sequence Assembly DNA Sequence Identify Order gggtcagtcgtctaaaggtcgctacgtcagctgat & cgtgacgcccctttttaacagtgcagctatgtgga Orient cgtacgtagctagcatcgttgcagtcgatgcaag gcgcggctcgcgcggggaaaattttttcgatcgat cgatcgatcgatgcgatcgatttcgcgtatcgatc gatcgtcgatcgatcggcgcgctagaaagagaga Gaps gctcgcgcgtacatatcgcgtcccttggaggatcg atatagcgctacgagctacgatcgactgatcgat Overlaps
- 44. Sequence Assembly: Summary • Maximum value in contig alignment & gap closure as well as independently validating sequence • Optical Mapping works best with larger contigs: >40 Kb
- 46. Four Key Components Argus® MapCard Processor Argus® Optical Mapper Instrumentation Argus® Mapping Work Station Argus® Oil Applicator Optical Mapping Argus® MapCard Argus® QCard Cards Argus® Sample Preparation Kit HMW Argus® Stain Kit Reagents Argus® Enzyme Kits MapManager Software MapSolver™
- 47. Optical Mapping Cards QCard • Performs DNA Quality Check • DNA Concentration optimization MapCard • MapCard and Argus® MapCard Surface assembled and CFD placed • DNA deposited • Enzymatic reaction performed
- 48. MapCard Setup Micro Fluidic Reagent Reservoirs Channels Argus® MapCard Surface Bottom View of CFD Top View of CFD
- 49. MapCard—Stretching DNA Molecules Place CFD on Map Card Deposit DNA Remove CFD Add Cap
- 50. MapCard Processing Place MapCard in Load Argus® MapCard MapCard Processor Reagents Result: RE Digested and Stained Single Molecules
- 51. Image & Data Acquisition Place MapCard in Optical Mapper Optical Mapper Processing
- 52. Optical Mapper Assembly Process Single Molecule Linear Assembly Restriction Map Consensus Optical Map
- 54. Large Genome Application • Focus on Super-scaffolding – Order and orientate contigs or scaffolds by creating Super-scaffolds with mapping information • Hybrid approach combining draft sequence and Optical Mapping • Uses Argus® System to produce mapping information with cluster-based data pipeline
- 55. OpGen Application Accelerates Workflow Bioinformatics Bioinformatics Bioinformatics Bioinformatics Library Prep Multiple Paired-end, Construct Construct BAC Marker Shotgun seq Mate-Pair Libraries Fosmid library Library Analysis Sequence runs Sequence runs Sequence runs Multiple rounds YEARS WEEKS WEEKS MONTHS Bioinformatics Bioinformatics Review sequence data in SS context Library Prep Multiple Paired-end, Shotgun seq Mate-Pair Libraries Optical Map Sequence runs SUPER-SCAFFOLD DONE Multiple rounds OPTICAL 1 WEEK PCR, PE libraries if MAPPING need more seq info 1 WEEK
- 56. Scaffolding Process Sequence Scaffold In Silico Map + Single Molecule Maps Sequence Driven Map Alignment Sequence Driven Map Alignment
- 57. Scaffolding Process Extended Scaffolds Pair-wise Alignment Super- scaffolding Final Scaffold
- 58. Goat Genome Collaboration with BGI, representing the Goat Genome Consortium BGI Original Result After Input Before O.M. Data O.M. Data* N50 (MB) 2.29 16.89 N80 (MB) 0.91 6.23 N90 (MB) 0.52 2.83 Scaffolds (90% Genome Coverage) 1236 181 Gap closed (from scaffolds > 200 kb) N/A 1284 *Illumina HiSeq Results presented at Plant and Animal Genome Conference January, 2011
- 59. How does the MapIt service work? www.miraibio.com | support@miraibio.com | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
- 60. Q&A www.miraibio.com | support@miraibio.com | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
- 61. Resources • Learn more: http://www.miraibio.com/mapit/optical-map-service • Support: support@miraibio.com or 1-650-615-7680 • Sales: info@miraibio.com or 1-424-237-8524 • MiraiBio Support Menu • Community • Knowledge Base • Blog http://www.MiraiBio.com/blog • Webinars: http://www.MiraiBio.com/Webinars • Online Store http://store.MiraiBio.com www.miraibio.com | support@miraibio.com | 1-424-237-8524 | © Hitachi Solutions America, Ltd. 2011. All rights reserved.
- 62. 62
Notes de l'éditeur
- Another one of our powerful applications is found in the area of comparative genomics. So, Perhaps, you’ve done some strain typing and would like to now dig into your data a little more.
- The Argus system is a complete system for performing optical mapping. And it includes hardware, reagents, consumables and instrumentation. There are 4 Key ComponentsInstrumentation—Some Consumables or Qcards, Mapcards, which have these derivitaized glass surfaces….Reagents (the fluorescent stain and enzyme kit)And our SoftwareMapManager is the System Software and MapSolver is the Software analysis tool.
- Here is a nice animation of the process.