SlideShare une entreprise Scribd logo
1  sur  29
Télécharger pour lire hors ligne
The Tria Project: Genomics of the
  Mountain Pine Beetle System
            Janice Cooke
       and the Tria Consortium
Outline


State of the mountain pine beetle outbreak: context for
using a genomics approach in combatting the epidemic
   Introduction to the Tria Project and the Tria Team
   Key outcomes from the Tria Project to date
       Filling knowledge gaps and making discoveries
       Linking genomics and risk assessment
       Using genomics to inform policy makers and forest
        managers
   Perspectives and future directions
Unprecedented spread of mountain pine beetle
        during the current outbreak




                                                         10 µm




                                                            10 µm
                                                      Adrianne Rice
                  Jack Scott, University of Alberta
Unprecedented spread of mountain pine beetle
        during the current outbreak




                                    Data: Little (1971); S.
                                     Taylor, G. Thandi, D.
                                    Yemshinov (Canadian
                                       Forest Service)
The Tria Project:
 A large-scale multidisciplinary collaborative effort
                                    MPB vector

              How gene                                    Genetic variation
            products work                                 across landscapes
                                             Jack Scott
            Physiological                                                         Stakeholders
                                                           Population
            & Functional                                                          & End Users
                                                           Genomics
             Genomics
                                                                                       Policy
Genomic                            Environmental
               Pine                                            Fungal              development;
Resources                           & Economic                                         Forest
               host                                           pathogen
                                    Risk Models                                    management
                                                                                    and spread
                                                                                      control
                                                                                    programme
                                      Ecology                                        planning
                Janice Cooke                                      Adrianne Rice




                               How organisms function &
                                  interact in nature
The Tria Project:
A large-scale multidisciplinary collaborative effort

                    University of Alberta
               University of British Columbia
           University of Northern British Columbia
     Natural Resources Canada – Canadian Forest Service
  Michael Smith Genome Sciences Centre – BC Cancer Agency
                  University of Minnesota
Genomic resources
                    Bohlmann, Breuil, J
                            Re
           Cooke, Hamelin, Huber, Jones, Keeling,
                     Murray, Sperling
                 UBC, UNBC, UA, BCGSC
              Functional &      Population          Ecosystem         Risk
              physiological     genomics             ecology     modeling, monit
               genomics                                             oring &
                                  Sperling,                       assessment       Stakeholders
 Mountain     Huber, Keeling                         Erbilgin,
                                  Coltman,                                         and Endusers
   pine         Bohlmann                             Evenden
                                   Murray
  beetle         UNBC, UBC                                           B. Cooke,          Policy
                                  UA, UNBC           UA, UBC
                                                                     Aukema,        development;
                                                                      Hauer,           Forest
                 Breuil,       Hamelin, Sper Breuil, K Lewis           Lewis        management
  Fungal        Bohlmann           ling        J. Cooke,
                                                Erbilgin                             and spread
associates
                                                                     UA, CFS,          control
                    UBC           UBC, UA    UBC, UNBC, UA
                                                                      UMinn          programme
                                                                                      planning
                J Cooke,         Coltman,            Erbilgin,
   Pines        Bohlmann         J Cooke             K Lewis

                  UA, UBC            UA              UA, UBC

             Huber, Breuil,       Coltman,           Erbilgin,
                J Cooke,          Sperling,          Evenden
Interactions
               Bohlmann           Hamelin
             UNBC, UBC, UA        UA, UNBC           UA, UBC
Genomes and Genomic Resources


                                   Chromosomes




                                   Genetic linkage map (relative positions
                                   of gene-based or anonymous markers)



                                   Genome sequence


                                              Expressed gene sequences
   …AAGAGAGCCTGTCGCTAAATGCAAGCCTTGAGTACC…



(Adapted from Paul & Ferl, 2000)
Sequence data enables high-throughput analyses of
many genes and/or many individuals simultaneously


                     Physiological genomics: monitoring
                   large numbers of genes simultaneously
                           for gene activity levels
Sequence data enables high-throughput analyses of
many genes and/or many individuals simultaneously
   Population genomics: assessing
  genetic variation in large numbers
    of individuals simultaneously

                                                         Gene Markers

                                                         A B C … n
       A/A     A/G     G/G                           1



                                       Individuals
                                                     2
                                                     3
                                                     …
                                                     n
Tria-Generated Genomic Resources
                                 Mountain        Fungal spp.        Pines – lodgepole
                                Pine Beetle                           and jack pine
                      Mountain Pine Beetle
                            
Whole genome               Draft    High-quality reference plus   No
sequence               Draft whole genome sequence
                                       additional strains (G.
                                    clavigera); Draft (O. piceae)
                       Expressed gene sequences
               Jack Scott


Expressed gene              Yes     Yes (G. clavigera, O. piceae) Yes
sequences              Expressed gene sequence clones

Expressed gene         Microsatellite markers
                            Yes           Yes (G. clavigera)      Yes
sequence clones
                       Single nucleotide polymorphism gene markers
Microsatellite markers
        Adrianne Rice
                            Yes          Yes – multiple spp.      Yes
                       Protein “fingerprints”
Single nucleotide                  Yes        Yes – multiple spp.         Yes
polymorphism gene
markers
Protein “fingerprints”             Yes                No                   No

High-throughput gene
        Janice Cooke             Ref-Seq           Ref-Seq            Microarrays
expression tools
Genomic resources enabled Tria researchers to
   document beetle spread into jack pine
Lodgepole and jack pine can be difficult to tell from
 hybrids, and the hybrid zone was not well-defined




                            Catherine Cullingham, University of Alberta
Using molecular markers to distinguish
lodgepole pine, jack pine and their hybrids




                                                          Lodgepole pine
                                                          Jack pine
                                                          Hybrid
                       Catherine Cullingham, University of Alberta
Pine marker analyses revealed mountain pine
    beetle range expansion into jack pine




                       Catherine Cullingham, University of Alberta
Bringing a regional issue to national significance




                   Data: Little (1971), D. Yemshinov (Canadian Forest Service)
                                    Catherine Cullingham, University of Alberta
Defenses differ in lodgepole and jack pine,
   and are further altered by drought




    Janice Cooke   Alberta Sustainable Resources Development   Adriana Arango
At least some mountain pine beetle fungal
associates can detoxify pine defense compounds




                10 µm




                            http://flickr.com/photos/19964825@N00/2495786445/

                   10 µm
            Adrianne Rice
Genetic analyses provided strong evidence of beetle
 dispersal from northern BC into northwestern AB

                                        Beetles can
                                          migrate
                                           longer
                                         distances
                                            than
                                        previously
                                         supposed




                                     Samarasekara et al 2012
Beetles in novel habitats:
       are they becoming more cold tolerant?


Frequency
   5%



          Selection
         (cold winter
        temperatures)



 Frequency
    20%
                                   Cullingham and Janes, unpublished
Pines, beetle and fungal associates all show
   genetic variation across the landscape




                    Geographic        Ecoregions
Genetic variation    features
Pathways by which genomics data inform
     model-based risk assessment
The Tria Project: Genomics of the Mountain Pine Beetle System
Perspectives

The current MPB outbreak has provided excellent proof of
concept for application of genomics to forest pest management.
     MPB, fungal and pine populations are heterogeneous
          This landscape-level non-uniformity could affect

             MPB spread
     Genomics is already informing Risk Assessment
           Risk Assessment and risk models also inform

            genetics research by identifying knowledge gaps
     Genomics is already informing Tree Improvement
           Other possibilities for applying genetics to

            reforestation and genetic conservation strategies
Mountain pine beetle at the leading edge of the
     outbreak: new surprises at every turn




Lorraine Maclauchlan, BC Ministry of Forests and Range   Rory McIntosh, Saskatchewan Environment
Mountain pine beetle at the leading edge of the
   outbreak: new surprises at every turn
Future Research Needs

   East of the Rockies, why isn’t the outbreak unfolding as models
    predicted in the mid 2000s? Will the outbreak reach Ontario?
    If so, when?
           Genomics-enhanced risk models

   How much does genetic variation in mountain pine beetle,
    pine host and fungal pathogen matter in outbreak dynamics?
          Integrated genomic landscape mapping

   We are only just beginning to understand how the players in
    the mountain pine beetle system interact, and how these
    interactions might affect outbreak dynamics
          Functional and physiological genomics investigations
            have provided novel insights
Future Research Needs



   Continued integration of mountain pine beetle research
    across disciplines and across scales
         Complex problems require holistic approaches

         Genomics enables integration
Postdocs / Research Associates                     Research Technicians
                            Eri Adams                   Neils Jensen           Sean Bromilow
                            Jay Anderson                Ljerka Lah             Jeremiah Bolstad
                            Adriana Arango              Inka Lusebrink         Stephanie Beauseigle
Project Leaders             Celia Boone                 Mario Pineda-Krch      Tiffany Bonnet
Janice Cooke (U of A)       Catherine Cullingham        Isidro Ojeda           Marie Bourassa
                            Walid El Kayal              Caitlin Pitt           Stephanie Boychuk
Jörg Bohlmann (UBC)         Katrin Geisler              Adrianne Rice          William Clark
                            Dawn Hall                   Jeanne Robert          Amanda Cookhouse
                            Sajeet Haridas              Amanda Roe             Pat Crane
Co-Investigators            Uljana Hesse                Kishan Sambaraju       Sophie Dang
Brian Aukema (U Minn)       Kate Hrinkevich             Amy Thommasen          Christina Elliot
                            Patrick James               Clement Tsui           Harpreet Dullat
Colette Breuil (UBC)        Jasmine Janes               Ye Wang                Matt Ferguson
David Coltman (U of A)                                                         Joël Fillon
Barry Cooke (CFS)           Graduate Students                                  Leonardo Galindo
                            Sepideh Alamouti                                   Hannah Henderson
Nadir Erbilgin (U of A)                                 Lina Farfan
                            Nic Bartell                                        Ed Hunt
                                                        Jordie Fraser
Maya Evenden (U of A)       Christine Chui              Chris Hansen
                                                                               Robert Jagodzinski
                            Erin Clark                                         Brad Jones
Richard Hamelin (CFS)                                   Lily Khadempour
                                                                               Chelsea Ju
                            Scott DiGuistini            Euwing Teen
Grant Hauer (U of A)        Honey-Marie de la Giroday   Ye Wang
                                                                               Laura Kennedy
Robert Holt (GSC)                                                              Susanne King-Jones
                                                        Gayathri Weerasuriya
                                                                               Chris Konchalski
Dezene Huber (UNBC)                                                            Jordan Koopmans
                            Undergraduate Students
Steven Jones (GSC)          Simon Allard                Jean Linsky
                                                                               Ben Lai
                                                                               Maria Li
Christopher Keeling (UBC)   Travis Allen                Rosalyn Loerke         Yisu Li
Marco Marra (GSC)           Kyle Artym                  Fang Yuan Luo          Emilia Lim
                            Kathryn Berry               Mehvash Malik          Linette Lim
Brent Murray (UNBC)         Simren Brar                 Sophia McClair         Miranda Meents
Felix Sperling (U of A)     Huang-Ju Chen               Genny Michiel          Dominik Royko
                            Tiffany Clarke              Rhiannon
Tim Williamson (CFS)        Charles Copeland            Montgomery
                                                                               Harpreet Sandhu
                                                                               Bin Shan
                            Julia Dam                   Marcelo Mora           Andrea Singh
                            Shane Doddridge             Boyd Mori              Bill Sperling
Project Management          Patrick Gaudet              Mike Prior             Talya Truant
Matthew Bryman (U of A)     Andrew Ho                   Ting Pu                Tyler Watson
                            Cierra Hoecher              Andrew Sharp           Caroline Whitehouse
Karen Reid (UBC)            Byron Knoll                 Patrick Welsh          Mack Yuen
                            Siew Law                    Christina Wong

Contenu connexe

Similaire à The Tria Project: Genomics of the Mountain Pine Beetle System

Lessons learned on the achievement of the Joint Program of Climate Change Ada...
Lessons learned on the achievement of the Joint Program of Climate Change Ada...Lessons learned on the achievement of the Joint Program of Climate Change Ada...
Lessons learned on the achievement of the Joint Program of Climate Change Ada...University of the Highlands and Islands
 
Dr. Steve Hoff - Progress on Pit Foam
Dr. Steve Hoff - Progress on Pit FoamDr. Steve Hoff - Progress on Pit Foam
Dr. Steve Hoff - Progress on Pit FoamJohn Blue
 
Adina's Faculty Introduction - ISU ABE
Adina's Faculty Introduction - ISU ABEAdina's Faculty Introduction - ISU ABE
Adina's Faculty Introduction - ISU ABEAdina Chuang Howe
 
The Ginés‐Mera Fellowship Fund for Postgraduates Studies in Biodiversity
The Ginés‐Mera Fellowship Fund for Postgraduates Studies in BiodiversityThe Ginés‐Mera Fellowship Fund for Postgraduates Studies in Biodiversity
The Ginés‐Mera Fellowship Fund for Postgraduates Studies in BiodiversityCIAT
 
Development of genomics pipelines and its integration with breeding
Development of genomics pipelines and its integration with breedingDevelopment of genomics pipelines and its integration with breeding
Development of genomics pipelines and its integration with breedingCIAT
 
Sharing the trail : Inspiring your students through GenOmics and other Social...
Sharing the trail : Inspiring your students through GenOmics and other Social...Sharing the trail : Inspiring your students through GenOmics and other Social...
Sharing the trail : Inspiring your students through GenOmics and other Social...gwardis
 
Iokiñe Rodriguez: Reframing the fire narrative in Canaima National Park, Vene...
Iokiñe Rodriguez: Reframing the fire narrative in Canaima National Park, Vene...Iokiñe Rodriguez: Reframing the fire narrative in Canaima National Park, Vene...
Iokiñe Rodriguez: Reframing the fire narrative in Canaima National Park, Vene...STEPS Centre
 
Using meat goats as weed control
Using meat goats as weed control Using meat goats as weed control
Using meat goats as weed control nacaa
 
Bioinformatics workshop presentation
Bioinformatics   workshop presentationBioinformatics   workshop presentation
Bioinformatics workshop presentationSKUAST-Kashmir
 

Similaire à The Tria Project: Genomics of the Mountain Pine Beetle System (12)

Lessons learned on the achievement of the Joint Program of Climate Change Ada...
Lessons learned on the achievement of the Joint Program of Climate Change Ada...Lessons learned on the achievement of the Joint Program of Climate Change Ada...
Lessons learned on the achievement of the Joint Program of Climate Change Ada...
 
URBE introduction
URBE introductionURBE introduction
URBE introduction
 
Dr. Steve Hoff - Progress on Pit Foam
Dr. Steve Hoff - Progress on Pit FoamDr. Steve Hoff - Progress on Pit Foam
Dr. Steve Hoff - Progress on Pit Foam
 
Adina's Faculty Introduction - ISU ABE
Adina's Faculty Introduction - ISU ABEAdina's Faculty Introduction - ISU ABE
Adina's Faculty Introduction - ISU ABE
 
The Ginés‐Mera Fellowship Fund for Postgraduates Studies in Biodiversity
The Ginés‐Mera Fellowship Fund for Postgraduates Studies in BiodiversityThe Ginés‐Mera Fellowship Fund for Postgraduates Studies in Biodiversity
The Ginés‐Mera Fellowship Fund for Postgraduates Studies in Biodiversity
 
Development of genomics pipelines and its integration with breeding
Development of genomics pipelines and its integration with breedingDevelopment of genomics pipelines and its integration with breeding
Development of genomics pipelines and its integration with breeding
 
Sharing the trail : Inspiring your students through GenOmics and other Social...
Sharing the trail : Inspiring your students through GenOmics and other Social...Sharing the trail : Inspiring your students through GenOmics and other Social...
Sharing the trail : Inspiring your students through GenOmics and other Social...
 
Iokiñe Rodriguez: Reframing the fire narrative in Canaima National Park, Vene...
Iokiñe Rodriguez: Reframing the fire narrative in Canaima National Park, Vene...Iokiñe Rodriguez: Reframing the fire narrative in Canaima National Park, Vene...
Iokiñe Rodriguez: Reframing the fire narrative in Canaima National Park, Vene...
 
Science Seminar Series 10 Andrew Lowe
Science Seminar Series 10 Andrew LoweScience Seminar Series 10 Andrew Lowe
Science Seminar Series 10 Andrew Lowe
 
Using meat goats as weed control
Using meat goats as weed control Using meat goats as weed control
Using meat goats as weed control
 
Bioinformatics workshop presentation
Bioinformatics   workshop presentationBioinformatics   workshop presentation
Bioinformatics workshop presentation
 
Bioinformatics Course
Bioinformatics CourseBioinformatics Course
Bioinformatics Course
 

Plus de Genome Alberta

12 Tweets for Using Digital Media for Internal Communication
12 Tweets for Using Digital Media for Internal Communication12 Tweets for Using Digital Media for Internal Communication
12 Tweets for Using Digital Media for Internal CommunicationGenome Alberta
 
Ali toronto november 2012 so me govt
Ali toronto november 2012 so me govtAli toronto november 2012 so me govt
Ali toronto november 2012 so me govtGenome Alberta
 
Improving the ROI from Social Media
Improving the ROI from Social MediaImproving the ROI from Social Media
Improving the ROI from Social MediaGenome Alberta
 
Antimicrobial Resistance
Antimicrobial ResistanceAntimicrobial Resistance
Antimicrobial ResistanceGenome Alberta
 
Ali washington sept 2013 spear presentation
Ali washington sept 2013 spear presentationAli washington sept 2013 spear presentation
Ali washington sept 2013 spear presentationGenome Alberta
 
Genomics 101 jun 15 2012
Genomics 101 jun 15 2012Genomics 101 jun 15 2012
Genomics 101 jun 15 2012Genome Alberta
 
Fed press Ottawa December Presentation
Fed press Ottawa December PresentationFed press Ottawa December Presentation
Fed press Ottawa December PresentationGenome Alberta
 
Social Media Strategy to Deliver Results
Social Media Strategy to Deliver ResultsSocial Media Strategy to Deliver Results
Social Media Strategy to Deliver ResultsGenome Alberta
 
2010 science comp presentation
2010 science comp presentation2010 science comp presentation
2010 science comp presentationGenome Alberta
 
Prion Social Media Presentation
Prion Social Media PresentationPrion Social Media Presentation
Prion Social Media PresentationGenome Alberta
 
Media Kits & Kaboodles
Media Kits & KaboodlesMedia Kits & Kaboodles
Media Kits & KaboodlesGenome Alberta
 
CBGW Julie Stitt Panel
CBGW Julie Stitt PanelCBGW Julie Stitt Panel
CBGW Julie Stitt PanelGenome Alberta
 
CBGW Brian Van Doormaal
CBGW Brian Van DoormaalCBGW Brian Van Doormaal
CBGW Brian Van DoormaalGenome Alberta
 
CBGW David Chalack Panel
CBGW David Chalack PanelCBGW David Chalack Panel
CBGW David Chalack PanelGenome Alberta
 
CBGW Diane Panrucker Panel
CBGW Diane Panrucker PanelCBGW Diane Panrucker Panel
CBGW Diane Panrucker PanelGenome Alberta
 
CBGW Identigen Ronan Loftus
CBGW Identigen Ronan LoftusCBGW Identigen Ronan Loftus
CBGW Identigen Ronan LoftusGenome Alberta
 

Plus de Genome Alberta (20)

12 Tweets for Using Digital Media for Internal Communication
12 Tweets for Using Digital Media for Internal Communication12 Tweets for Using Digital Media for Internal Communication
12 Tweets for Using Digital Media for Internal Communication
 
Ali toronto november 2012 so me govt
Ali toronto november 2012 so me govtAli toronto november 2012 so me govt
Ali toronto november 2012 so me govt
 
Improving the ROI from Social Media
Improving the ROI from Social MediaImproving the ROI from Social Media
Improving the ROI from Social Media
 
Antimicrobial Resistance
Antimicrobial ResistanceAntimicrobial Resistance
Antimicrobial Resistance
 
Ali washington sept 2013 spear presentation
Ali washington sept 2013 spear presentationAli washington sept 2013 spear presentation
Ali washington sept 2013 spear presentation
 
Genomics 101 jun 15 2012
Genomics 101 jun 15 2012Genomics 101 jun 15 2012
Genomics 101 jun 15 2012
 
Fed press Ottawa December Presentation
Fed press Ottawa December PresentationFed press Ottawa December Presentation
Fed press Ottawa December Presentation
 
Social Media Strategy to Deliver Results
Social Media Strategy to Deliver ResultsSocial Media Strategy to Deliver Results
Social Media Strategy to Deliver Results
 
2010 science comp presentation
2010 science comp presentation2010 science comp presentation
2010 science comp presentation
 
Prion Social Media Presentation
Prion Social Media PresentationPrion Social Media Presentation
Prion Social Media Presentation
 
Media Kits & Kaboodles
Media Kits & KaboodlesMedia Kits & Kaboodles
Media Kits & Kaboodles
 
CBGW Bob Church
CBGW Bob ChurchCBGW Bob Church
CBGW Bob Church
 
CBGW Julie Stitt Panel
CBGW Julie Stitt PanelCBGW Julie Stitt Panel
CBGW Julie Stitt Panel
 
CBGW Brian Van Doormaal
CBGW Brian Van DoormaalCBGW Brian Van Doormaal
CBGW Brian Van Doormaal
 
CBGW David Chalack Panel
CBGW David Chalack PanelCBGW David Chalack Panel
CBGW David Chalack Panel
 
CBGW Diane Panrucker Panel
CBGW Diane Panrucker PanelCBGW Diane Panrucker Panel
CBGW Diane Panrucker Panel
 
CBGW Heather Burrow
CBGW Heather BurrowCBGW Heather Burrow
CBGW Heather Burrow
 
CBGW Identigen Ronan Loftus
CBGW Identigen Ronan LoftusCBGW Identigen Ronan Loftus
CBGW Identigen Ronan Loftus
 
CBGW John Pollak
CBGW John PollakCBGW John Pollak
CBGW John Pollak
 
CBGW Stephen Miller
CBGW Stephen MillerCBGW Stephen Miller
CBGW Stephen Miller
 

Dernier

UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdf
UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdfUiPath Solutions Management Preview - Northern CA Chapter - March 22.pdf
UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdfDianaGray10
 
COMPUTER 10: Lesson 7 - File Storage and Online Collaboration
COMPUTER 10: Lesson 7 - File Storage and Online CollaborationCOMPUTER 10: Lesson 7 - File Storage and Online Collaboration
COMPUTER 10: Lesson 7 - File Storage and Online Collaborationbruanjhuli
 
Videogame localization & technology_ how to enhance the power of translation.pdf
Videogame localization & technology_ how to enhance the power of translation.pdfVideogame localization & technology_ how to enhance the power of translation.pdf
Videogame localization & technology_ how to enhance the power of translation.pdfinfogdgmi
 
UiPath Studio Web workshop series - Day 7
UiPath Studio Web workshop series - Day 7UiPath Studio Web workshop series - Day 7
UiPath Studio Web workshop series - Day 7DianaGray10
 
Using IESVE for Loads, Sizing and Heat Pump Modeling to Achieve Decarbonization
Using IESVE for Loads, Sizing and Heat Pump Modeling to Achieve DecarbonizationUsing IESVE for Loads, Sizing and Heat Pump Modeling to Achieve Decarbonization
Using IESVE for Loads, Sizing and Heat Pump Modeling to Achieve DecarbonizationIES VE
 
Linked Data in Production: Moving Beyond Ontologies
Linked Data in Production: Moving Beyond OntologiesLinked Data in Production: Moving Beyond Ontologies
Linked Data in Production: Moving Beyond OntologiesDavid Newbury
 
UiPath Community: AI for UiPath Automation Developers
UiPath Community: AI for UiPath Automation DevelopersUiPath Community: AI for UiPath Automation Developers
UiPath Community: AI for UiPath Automation DevelopersUiPathCommunity
 
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCostKubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCostMatt Ray
 
IESVE Software for Florida Code Compliance Using ASHRAE 90.1-2019
IESVE Software for Florida Code Compliance Using ASHRAE 90.1-2019IESVE Software for Florida Code Compliance Using ASHRAE 90.1-2019
IESVE Software for Florida Code Compliance Using ASHRAE 90.1-2019IES VE
 
activity_diagram_combine_v4_20190827.pdfactivity_diagram_combine_v4_20190827.pdf
activity_diagram_combine_v4_20190827.pdfactivity_diagram_combine_v4_20190827.pdfactivity_diagram_combine_v4_20190827.pdfactivity_diagram_combine_v4_20190827.pdf
activity_diagram_combine_v4_20190827.pdfactivity_diagram_combine_v4_20190827.pdfJamie (Taka) Wang
 
Computer 10: Lesson 10 - Online Crimes and Hazards
Computer 10: Lesson 10 - Online Crimes and HazardsComputer 10: Lesson 10 - Online Crimes and Hazards
Computer 10: Lesson 10 - Online Crimes and HazardsSeth Reyes
 
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdfIaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdfDaniel Santiago Silva Capera
 
Introduction to Matsuo Laboratory (ENG).pptx
Introduction to Matsuo Laboratory (ENG).pptxIntroduction to Matsuo Laboratory (ENG).pptx
Introduction to Matsuo Laboratory (ENG).pptxMatsuo Lab
 
Igniting Next Level Productivity with AI-Infused Data Integration Workflows
Igniting Next Level Productivity with AI-Infused Data Integration WorkflowsIgniting Next Level Productivity with AI-Infused Data Integration Workflows
Igniting Next Level Productivity with AI-Infused Data Integration WorkflowsSafe Software
 
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...UbiTrack UK
 
COMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a WebsiteCOMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a Websitedgelyza
 
Crea il tuo assistente AI con lo Stregatto (open source python framework)
Crea il tuo assistente AI con lo Stregatto (open source python framework)Crea il tuo assistente AI con lo Stregatto (open source python framework)
Crea il tuo assistente AI con lo Stregatto (open source python framework)Commit University
 
VoIP Service and Marketing using Odoo and Asterisk PBX
VoIP Service and Marketing using Odoo and Asterisk PBXVoIP Service and Marketing using Odoo and Asterisk PBX
VoIP Service and Marketing using Odoo and Asterisk PBXTarek Kalaji
 

Dernier (20)

UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdf
UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdfUiPath Solutions Management Preview - Northern CA Chapter - March 22.pdf
UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdf
 
COMPUTER 10: Lesson 7 - File Storage and Online Collaboration
COMPUTER 10: Lesson 7 - File Storage and Online CollaborationCOMPUTER 10: Lesson 7 - File Storage and Online Collaboration
COMPUTER 10: Lesson 7 - File Storage and Online Collaboration
 
Videogame localization & technology_ how to enhance the power of translation.pdf
Videogame localization & technology_ how to enhance the power of translation.pdfVideogame localization & technology_ how to enhance the power of translation.pdf
Videogame localization & technology_ how to enhance the power of translation.pdf
 
UiPath Studio Web workshop series - Day 7
UiPath Studio Web workshop series - Day 7UiPath Studio Web workshop series - Day 7
UiPath Studio Web workshop series - Day 7
 
Using IESVE for Loads, Sizing and Heat Pump Modeling to Achieve Decarbonization
Using IESVE for Loads, Sizing and Heat Pump Modeling to Achieve DecarbonizationUsing IESVE for Loads, Sizing and Heat Pump Modeling to Achieve Decarbonization
Using IESVE for Loads, Sizing and Heat Pump Modeling to Achieve Decarbonization
 
Linked Data in Production: Moving Beyond Ontologies
Linked Data in Production: Moving Beyond OntologiesLinked Data in Production: Moving Beyond Ontologies
Linked Data in Production: Moving Beyond Ontologies
 
UiPath Community: AI for UiPath Automation Developers
UiPath Community: AI for UiPath Automation DevelopersUiPath Community: AI for UiPath Automation Developers
UiPath Community: AI for UiPath Automation Developers
 
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCostKubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
KubeConEU24-Monitoring Kubernetes and Cloud Spend with OpenCost
 
IESVE Software for Florida Code Compliance Using ASHRAE 90.1-2019
IESVE Software for Florida Code Compliance Using ASHRAE 90.1-2019IESVE Software for Florida Code Compliance Using ASHRAE 90.1-2019
IESVE Software for Florida Code Compliance Using ASHRAE 90.1-2019
 
activity_diagram_combine_v4_20190827.pdfactivity_diagram_combine_v4_20190827.pdf
activity_diagram_combine_v4_20190827.pdfactivity_diagram_combine_v4_20190827.pdfactivity_diagram_combine_v4_20190827.pdfactivity_diagram_combine_v4_20190827.pdf
activity_diagram_combine_v4_20190827.pdfactivity_diagram_combine_v4_20190827.pdf
 
Computer 10: Lesson 10 - Online Crimes and Hazards
Computer 10: Lesson 10 - Online Crimes and HazardsComputer 10: Lesson 10 - Online Crimes and Hazards
Computer 10: Lesson 10 - Online Crimes and Hazards
 
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdfIaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
IaC & GitOps in a Nutshell - a FridayInANuthshell Episode.pdf
 
Introduction to Matsuo Laboratory (ENG).pptx
Introduction to Matsuo Laboratory (ENG).pptxIntroduction to Matsuo Laboratory (ENG).pptx
Introduction to Matsuo Laboratory (ENG).pptx
 
20230104 - machine vision
20230104 - machine vision20230104 - machine vision
20230104 - machine vision
 
Igniting Next Level Productivity with AI-Infused Data Integration Workflows
Igniting Next Level Productivity with AI-Infused Data Integration WorkflowsIgniting Next Level Productivity with AI-Infused Data Integration Workflows
Igniting Next Level Productivity with AI-Infused Data Integration Workflows
 
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
 
20150722 - AGV
20150722 - AGV20150722 - AGV
20150722 - AGV
 
COMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a WebsiteCOMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a Website
 
Crea il tuo assistente AI con lo Stregatto (open source python framework)
Crea il tuo assistente AI con lo Stregatto (open source python framework)Crea il tuo assistente AI con lo Stregatto (open source python framework)
Crea il tuo assistente AI con lo Stregatto (open source python framework)
 
VoIP Service and Marketing using Odoo and Asterisk PBX
VoIP Service and Marketing using Odoo and Asterisk PBXVoIP Service and Marketing using Odoo and Asterisk PBX
VoIP Service and Marketing using Odoo and Asterisk PBX
 

The Tria Project: Genomics of the Mountain Pine Beetle System

  • 1. The Tria Project: Genomics of the Mountain Pine Beetle System Janice Cooke and the Tria Consortium
  • 2. Outline State of the mountain pine beetle outbreak: context for using a genomics approach in combatting the epidemic  Introduction to the Tria Project and the Tria Team  Key outcomes from the Tria Project to date  Filling knowledge gaps and making discoveries  Linking genomics and risk assessment  Using genomics to inform policy makers and forest managers  Perspectives and future directions
  • 3. Unprecedented spread of mountain pine beetle during the current outbreak 10 µm 10 µm Adrianne Rice Jack Scott, University of Alberta
  • 4. Unprecedented spread of mountain pine beetle during the current outbreak Data: Little (1971); S. Taylor, G. Thandi, D. Yemshinov (Canadian Forest Service)
  • 5. The Tria Project: A large-scale multidisciplinary collaborative effort MPB vector How gene Genetic variation products work across landscapes Jack Scott Physiological Stakeholders Population & Functional & End Users Genomics Genomics Policy Genomic Environmental Pine Fungal development; Resources & Economic Forest host pathogen Risk Models management and spread control programme Ecology planning Janice Cooke Adrianne Rice How organisms function & interact in nature
  • 6. The Tria Project: A large-scale multidisciplinary collaborative effort University of Alberta University of British Columbia University of Northern British Columbia Natural Resources Canada – Canadian Forest Service Michael Smith Genome Sciences Centre – BC Cancer Agency University of Minnesota
  • 7. Genomic resources Bohlmann, Breuil, J Re Cooke, Hamelin, Huber, Jones, Keeling, Murray, Sperling UBC, UNBC, UA, BCGSC Functional & Population Ecosystem Risk physiological genomics ecology modeling, monit genomics oring & Sperling, assessment Stakeholders Mountain Huber, Keeling Erbilgin, Coltman, and Endusers pine Bohlmann Evenden Murray beetle UNBC, UBC B. Cooke, Policy UA, UNBC UA, UBC Aukema, development; Hauer, Forest Breuil, Hamelin, Sper Breuil, K Lewis Lewis management Fungal Bohlmann ling J. Cooke, Erbilgin and spread associates UA, CFS, control UBC UBC, UA UBC, UNBC, UA UMinn programme planning J Cooke, Coltman, Erbilgin, Pines Bohlmann J Cooke K Lewis UA, UBC UA UA, UBC Huber, Breuil, Coltman, Erbilgin, J Cooke, Sperling, Evenden Interactions Bohlmann Hamelin UNBC, UBC, UA UA, UNBC UA, UBC
  • 8. Genomes and Genomic Resources Chromosomes Genetic linkage map (relative positions of gene-based or anonymous markers) Genome sequence Expressed gene sequences …AAGAGAGCCTGTCGCTAAATGCAAGCCTTGAGTACC… (Adapted from Paul & Ferl, 2000)
  • 9. Sequence data enables high-throughput analyses of many genes and/or many individuals simultaneously Physiological genomics: monitoring large numbers of genes simultaneously for gene activity levels
  • 10. Sequence data enables high-throughput analyses of many genes and/or many individuals simultaneously Population genomics: assessing genetic variation in large numbers of individuals simultaneously Gene Markers A B C … n A/A A/G G/G 1 Individuals 2 3 … n
  • 11. Tria-Generated Genomic Resources Mountain Fungal spp. Pines – lodgepole Pine Beetle and jack pine Mountain Pine Beetle  Whole genome Draft High-quality reference plus No sequence  Draft whole genome sequence additional strains (G. clavigera); Draft (O. piceae)  Expressed gene sequences Jack Scott Expressed gene Yes Yes (G. clavigera, O. piceae) Yes sequences  Expressed gene sequence clones Expressed gene  Microsatellite markers Yes Yes (G. clavigera) Yes sequence clones  Single nucleotide polymorphism gene markers Microsatellite markers Adrianne Rice Yes Yes – multiple spp. Yes  Protein “fingerprints” Single nucleotide Yes Yes – multiple spp. Yes polymorphism gene markers Protein “fingerprints” Yes No No High-throughput gene Janice Cooke Ref-Seq Ref-Seq Microarrays expression tools
  • 12. Genomic resources enabled Tria researchers to document beetle spread into jack pine
  • 13. Lodgepole and jack pine can be difficult to tell from hybrids, and the hybrid zone was not well-defined Catherine Cullingham, University of Alberta
  • 14. Using molecular markers to distinguish lodgepole pine, jack pine and their hybrids Lodgepole pine Jack pine Hybrid Catherine Cullingham, University of Alberta
  • 15. Pine marker analyses revealed mountain pine beetle range expansion into jack pine Catherine Cullingham, University of Alberta
  • 16. Bringing a regional issue to national significance Data: Little (1971), D. Yemshinov (Canadian Forest Service) Catherine Cullingham, University of Alberta
  • 17. Defenses differ in lodgepole and jack pine, and are further altered by drought Janice Cooke Alberta Sustainable Resources Development Adriana Arango
  • 18. At least some mountain pine beetle fungal associates can detoxify pine defense compounds 10 µm http://flickr.com/photos/19964825@N00/2495786445/ 10 µm Adrianne Rice
  • 19. Genetic analyses provided strong evidence of beetle dispersal from northern BC into northwestern AB Beetles can migrate longer distances than previously supposed Samarasekara et al 2012
  • 20. Beetles in novel habitats: are they becoming more cold tolerant? Frequency 5% Selection (cold winter temperatures) Frequency 20% Cullingham and Janes, unpublished
  • 21. Pines, beetle and fungal associates all show genetic variation across the landscape Geographic Ecoregions Genetic variation features
  • 22. Pathways by which genomics data inform model-based risk assessment
  • 24. Perspectives The current MPB outbreak has provided excellent proof of concept for application of genomics to forest pest management.  MPB, fungal and pine populations are heterogeneous  This landscape-level non-uniformity could affect MPB spread  Genomics is already informing Risk Assessment  Risk Assessment and risk models also inform genetics research by identifying knowledge gaps  Genomics is already informing Tree Improvement  Other possibilities for applying genetics to reforestation and genetic conservation strategies
  • 25. Mountain pine beetle at the leading edge of the outbreak: new surprises at every turn Lorraine Maclauchlan, BC Ministry of Forests and Range Rory McIntosh, Saskatchewan Environment
  • 26. Mountain pine beetle at the leading edge of the outbreak: new surprises at every turn
  • 27. Future Research Needs  East of the Rockies, why isn’t the outbreak unfolding as models predicted in the mid 2000s? Will the outbreak reach Ontario? If so, when?  Genomics-enhanced risk models  How much does genetic variation in mountain pine beetle, pine host and fungal pathogen matter in outbreak dynamics?  Integrated genomic landscape mapping  We are only just beginning to understand how the players in the mountain pine beetle system interact, and how these interactions might affect outbreak dynamics  Functional and physiological genomics investigations have provided novel insights
  • 28. Future Research Needs  Continued integration of mountain pine beetle research across disciplines and across scales  Complex problems require holistic approaches  Genomics enables integration
  • 29. Postdocs / Research Associates Research Technicians Eri Adams Neils Jensen Sean Bromilow Jay Anderson Ljerka Lah Jeremiah Bolstad Adriana Arango Inka Lusebrink Stephanie Beauseigle Project Leaders Celia Boone Mario Pineda-Krch Tiffany Bonnet Janice Cooke (U of A) Catherine Cullingham Isidro Ojeda Marie Bourassa Walid El Kayal Caitlin Pitt Stephanie Boychuk Jörg Bohlmann (UBC) Katrin Geisler Adrianne Rice William Clark Dawn Hall Jeanne Robert Amanda Cookhouse Sajeet Haridas Amanda Roe Pat Crane Co-Investigators Uljana Hesse Kishan Sambaraju Sophie Dang Brian Aukema (U Minn) Kate Hrinkevich Amy Thommasen Christina Elliot Patrick James Clement Tsui Harpreet Dullat Colette Breuil (UBC) Jasmine Janes Ye Wang Matt Ferguson David Coltman (U of A) Joël Fillon Barry Cooke (CFS) Graduate Students Leonardo Galindo Sepideh Alamouti Hannah Henderson Nadir Erbilgin (U of A) Lina Farfan Nic Bartell Ed Hunt Jordie Fraser Maya Evenden (U of A) Christine Chui Chris Hansen Robert Jagodzinski Erin Clark Brad Jones Richard Hamelin (CFS) Lily Khadempour Chelsea Ju Scott DiGuistini Euwing Teen Grant Hauer (U of A) Honey-Marie de la Giroday Ye Wang Laura Kennedy Robert Holt (GSC) Susanne King-Jones Gayathri Weerasuriya Chris Konchalski Dezene Huber (UNBC) Jordan Koopmans Undergraduate Students Steven Jones (GSC) Simon Allard Jean Linsky Ben Lai Maria Li Christopher Keeling (UBC) Travis Allen Rosalyn Loerke Yisu Li Marco Marra (GSC) Kyle Artym Fang Yuan Luo Emilia Lim Kathryn Berry Mehvash Malik Linette Lim Brent Murray (UNBC) Simren Brar Sophia McClair Miranda Meents Felix Sperling (U of A) Huang-Ju Chen Genny Michiel Dominik Royko Tiffany Clarke Rhiannon Tim Williamson (CFS) Charles Copeland Montgomery Harpreet Sandhu Bin Shan Julia Dam Marcelo Mora Andrea Singh Shane Doddridge Boyd Mori Bill Sperling Project Management Patrick Gaudet Mike Prior Talya Truant Matthew Bryman (U of A) Andrew Ho Ting Pu Tyler Watson Cierra Hoecher Andrew Sharp Caroline Whitehouse Karen Reid (UBC) Byron Knoll Patrick Welsh Mack Yuen Siew Law Christina Wong

Notes de l'éditeur

  1. Spatially delinate adaptive variation on the landscape (associating selected loci with variables, application to other aspects of forest management