SlideShare a Scribd company logo
1 of 14
Sequenced RAD Markers: A SNP
        Discovery and Genotyping Platform
         July 30th, 2009




                               Floragenex Presenter:

                               Dr. Eric Johnson, Chief Technology Officer




                           © Floragenex, Inc. 2009
www.floragenex.com
Applications for Sequenced RAD markers

   • SNP discovery
      – scalable discovery of markers in any genome
   • SNP discovery with RAD LongRead markers
      – identify SNPs and develop flanking sequence
   • Trait mapping
      – find linked markers by bulk segregant analysis
   • Genetic maps
      – SNP discovery and genotyping of a population




                               © Floragenex, Inc. 2009
www.floragenex.com
Floragenex Restriction-site Associated
DNA (RAD) Technology




                     © Floragenex, Inc. 2009
www.floragenex.com
RAD Markers Identify a Variety of
Polymorphisms
Sequences with a single change
A       B
18      00 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAAAAGAAGGACAA 38G>A
00      19 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAGAAGAAGGACAA


Sequences with complex changes
A       B
19      00 CCGGCGCAAGGCCTTCTACTGATCTGGTACGCTATCTCTTAGCATGTCC 20C>T 48A>C
00      17 CCGGCGCAAGGCCTTCTACCGATCTGGTACGCTATCTCTTAGCATGTAC

00      29 CCGGCGCGATCTGCAGGGGCGCCGACGACATTATTCCTTCGGCTCGCCG 33G>A 34+TTC
44      00 CCGGCGCGATCTGCAGGGGCGCCGACGACATTG---CTTCGGCTCGCCGTGG


Dominant markers “snip-SNPs”
A       B
00      42 CCGGCGAAACACGGGGCCACGGCGCAGGCGTTCTCCATCTCCAAAGAAC


                                      © Floragenex, Inc. 2009
www.floragenex.com
Applications for Sequenced RAD markers

   • SNP discovery
      – scalable discovery of markers in any genome
   • SNP discovery with RAD LongRead markers
      – identify SNPs and develop flanking sequence
   • Trait mapping
      – find linked markers by bulk segregant analysis
   • Genetic maps
      – SNP discovery and genotyping of a populatio




                               © Floragenex, Inc. 2009
www.floragenex.com
Paired-end Sequencing for RAD
LongReads




                     © Floragenex, Inc. 2009
www.floragenex.com
RAD LongRead contigs range in size
                                                 RAD LongRead contig lengths
                              1500




                              1125
               # of contigs




                               750




                               375




                                0
                                     100   200     300     400       500       600   700   800   900

                                                            Contig length

                                                         © Floragenex, Inc. 2009
www.floragenex.com
RAD LongReads for Genotyping Assay
Development
Goal
 • Identify testcross segregating alleles for translation into Sequenom iPlex assay
    format
RAD LongRead sequencing results
 • ~43,000 contigs
 • 9,903 SNPs identified
 • 1,005 InDels identified
Validation test
 • 280 SNPs were converted into a Sequenom assay (120 bp free of other
    polymorphisms)
Results
1) Nearly 100% conversion rate into a functional assay
2) ~85% of identified SNPs segregated as expected and mapped to LGs


                                   © Floragenex, Inc. 2009
www.floragenex.com
Applications for Sequenced RAD markers

   • SNP discovery
      – scalable discovery of markers in any genome
   • SNP discovery with RAD LongRead markers
      – identify SNPs and develop flanking sequence
   • Trait mapping
      – find linked markers by bulk segregant analysis
   • Genetic maps
      – SNP discovery and genotyping of a population




                               © Floragenex, Inc. 2009
www.floragenex.com
Trait mapping with bulked populations




                     © Floragenex, Inc. 2009
www.floragenex.com
Applications for Sequenced RAD markers

   • SNP discovery
      – scalable discovery of markers in any genome
   • SNP discovery with RAD LongRead markers
      – identify SNPs and develop flanking sequence
   • Trait mapping
      – find linked markers by bulk segregant analysis
   • Genetic maps
      – SNP discovery and genotyping of a population




                               © Floragenex, Inc. 2009
www.floragenex.com
RAD-based Physical and Genetic Maps can
optimize Whole Genome Assembly




                       © Floragenex, Inc. 2009
  www.floragenex.com
RAD Summary

RAD markers focus high-depth sequencing on a fraction of the genome
 • de novo marker discovery
 • marker density can scale with project goals
RAD LongRead markers
 • develop long contigs of 200-800 bp
 • good for porting SNPs to other genotyping platforms
 • discriminates between homeologous genomes
Trait mapping
 • Rapidly identify Mendelian alleles
Genetic mapping and physical mapping
 • RAD marker-based maps can tie together for genome assembly


                            © Floragenex, Inc. 2009
www.floragenex.com
Questions?
                     Floragenex Plant Genomics Team:
                     Eric Johnson, Chief Technical Officer
                        eric@floragenex.com
                     Rick Nipper, VP of Research
                        rick@floragenex.com

                     Office Phone
                        541.343.0747



                                    © Floragenex, Inc. 2009
www.floragenex.com

More Related Content

Viewers also liked

ROSEdu Tech Talks Prezentarea 01: Preprocesorul C
ROSEdu Tech Talks Prezentarea 01:  Preprocesorul CROSEdu Tech Talks Prezentarea 01:  Preprocesorul C
ROSEdu Tech Talks Prezentarea 01: Preprocesorul CROSEdu
 
Getting your masters doctorate in your p js
Getting your masters doctorate in your p jsGetting your masters doctorate in your p js
Getting your masters doctorate in your p jscdcummings
 
Marketing 101 Powerpoint Colorado Springs Ewi
Marketing 101 Powerpoint   Colorado Springs EwiMarketing 101 Powerpoint   Colorado Springs Ewi
Marketing 101 Powerpoint Colorado Springs Ewiseikotran
 
Sitecheckm8 Pres
Sitecheckm8 PresSitecheckm8 Pres
Sitecheckm8 PresAzulIT
 
Making Social Media Work for You
Making Social Media Work for YouMaking Social Media Work for You
Making Social Media Work for YouAllan Gates
 
Ncpea final 8-7-13
Ncpea final 8-7-13Ncpea final 8-7-13
Ncpea final 8-7-13cdcummings
 
Essentie Van Leiderschap
Essentie Van LeiderschapEssentie Van Leiderschap
Essentie Van LeiderschapRonvanschaik
 
Fansite“TenjinbashiBazaar” as local communication by socialmedia
Fansite“TenjinbashiBazaar” as local communication by socialmediaFansite“TenjinbashiBazaar” as local communication by socialmedia
Fansite“TenjinbashiBazaar” as local communication by socialmediaKazutaka NAKANO
 
Standards @ Peixe Urbano
Standards @ Peixe UrbanoStandards @ Peixe Urbano
Standards @ Peixe UrbanoFlávio Silva
 

Viewers also liked (20)

Keys to good cooking yummy mummy style
Keys to good cooking yummy mummy styleKeys to good cooking yummy mummy style
Keys to good cooking yummy mummy style
 
ROSEdu Tech Talks Prezentarea 01: Preprocesorul C
ROSEdu Tech Talks Prezentarea 01:  Preprocesorul CROSEdu Tech Talks Prezentarea 01:  Preprocesorul C
ROSEdu Tech Talks Prezentarea 01: Preprocesorul C
 
Home Fragrances Delights
Home  Fragrances DelightsHome  Fragrances Delights
Home Fragrances Delights
 
Sisältää jo vanhentunutta tietoa: (Humanistinen ammattikorkeakoulu 2010: Opo ...
Sisältää jo vanhentunutta tietoa: (Humanistinen ammattikorkeakoulu 2010: Opo ...Sisältää jo vanhentunutta tietoa: (Humanistinen ammattikorkeakoulu 2010: Opo ...
Sisältää jo vanhentunutta tietoa: (Humanistinen ammattikorkeakoulu 2010: Opo ...
 
Introduction2comsci
Introduction2comsciIntroduction2comsci
Introduction2comsci
 
Getting your masters doctorate in your p js
Getting your masters doctorate in your p jsGetting your masters doctorate in your p js
Getting your masters doctorate in your p js
 
Lynn Dearmyer
Lynn DearmyerLynn Dearmyer
Lynn Dearmyer
 
Kokemuksia verkkonuorisotyön ja mediakasvatuksen opetuksesta reaaliaikainen v...
Kokemuksia verkkonuorisotyön ja mediakasvatuksen opetuksesta reaaliaikainen v...Kokemuksia verkkonuorisotyön ja mediakasvatuksen opetuksesta reaaliaikainen v...
Kokemuksia verkkonuorisotyön ja mediakasvatuksen opetuksesta reaaliaikainen v...
 
Marketing 101 Powerpoint Colorado Springs Ewi
Marketing 101 Powerpoint   Colorado Springs EwiMarketing 101 Powerpoint   Colorado Springs Ewi
Marketing 101 Powerpoint Colorado Springs Ewi
 
Sitecheckm8 Pres
Sitecheckm8 PresSitecheckm8 Pres
Sitecheckm8 Pres
 
Making Social Media Work for You
Making Social Media Work for YouMaking Social Media Work for You
Making Social Media Work for You
 
Awkward Family Pet Photos
Awkward Family Pet PhotosAwkward Family Pet Photos
Awkward Family Pet Photos
 
Humak: hakijan opas 2014
Humak: hakijan opas 2014Humak: hakijan opas 2014
Humak: hakijan opas 2014
 
Search Marketing
Search MarketingSearch Marketing
Search Marketing
 
Ncpea final 8-7-13
Ncpea final 8-7-13Ncpea final 8-7-13
Ncpea final 8-7-13
 
Essentie Van Leiderschap
Essentie Van LeiderschapEssentie Van Leiderschap
Essentie Van Leiderschap
 
Fansite“TenjinbashiBazaar” as local communication by socialmedia
Fansite“TenjinbashiBazaar” as local communication by socialmediaFansite“TenjinbashiBazaar” as local communication by socialmedia
Fansite“TenjinbashiBazaar” as local communication by socialmedia
 
Standards @ Peixe Urbano
Standards @ Peixe UrbanoStandards @ Peixe Urbano
Standards @ Peixe Urbano
 
Sims003
Sims003Sims003
Sims003
 
Johda ja hyödynnä sosiaalista mediaa – työkalupakki kunnan nuorisotyön johtam...
Johda ja hyödynnä sosiaalista mediaa – työkalupakki kunnan nuorisotyön johtam...Johda ja hyödynnä sosiaalista mediaa – työkalupakki kunnan nuorisotyön johtam...
Johda ja hyödynnä sosiaalista mediaa – työkalupakki kunnan nuorisotyön johtam...
 

Recently uploaded

08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking MenDelhi Call girls
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEarley Information Science
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxMalak Abu Hammad
 
Injustice - Developers Among Us (SciFiDevCon 2024)
Injustice - Developers Among Us (SciFiDevCon 2024)Injustice - Developers Among Us (SciFiDevCon 2024)
Injustice - Developers Among Us (SciFiDevCon 2024)Allon Mureinik
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreternaman860154
 
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j
 
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdfThe Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdfEnterprise Knowledge
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)Gabriella Davis
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Igalia
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...Neo4j
 
Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slidevu2urc
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024The Digital Insurer
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityPrincipled Technologies
 
2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...Martijn de Jong
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationSafe Software
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsEnterprise Knowledge
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Miguel Araújo
 
Factors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptxFactors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptxKatpro Technologies
 

Recently uploaded (20)

08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptx
 
Injustice - Developers Among Us (SciFiDevCon 2024)
Injustice - Developers Among Us (SciFiDevCon 2024)Injustice - Developers Among Us (SciFiDevCon 2024)
Injustice - Developers Among Us (SciFiDevCon 2024)
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreter
 
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
 
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdfThe Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
 
Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slide
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivity
 
2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI Solutions
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
 
Factors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptxFactors to Consider When Choosing Accounts Payable Services Providers.pptx
Factors to Consider When Choosing Accounts Payable Services Providers.pptx
 

ISHS - Molecular Markers In Horticulture Presentation

  • 1. Sequenced RAD Markers: A SNP Discovery and Genotyping Platform July 30th, 2009 Floragenex Presenter: Dr. Eric Johnson, Chief Technology Officer © Floragenex, Inc. 2009 www.floragenex.com
  • 2. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population © Floragenex, Inc. 2009 www.floragenex.com
  • 3. Floragenex Restriction-site Associated DNA (RAD) Technology © Floragenex, Inc. 2009 www.floragenex.com
  • 4. RAD Markers Identify a Variety of Polymorphisms Sequences with a single change A B 18 00 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAAAAGAAGGACAA 38G>A 00 19 CCGGCGAGCACGGCGACAAGTCCGGCGACCACAAGGAGAAGAAGGACAA Sequences with complex changes A B 19 00 CCGGCGCAAGGCCTTCTACTGATCTGGTACGCTATCTCTTAGCATGTCC 20C>T 48A>C 00 17 CCGGCGCAAGGCCTTCTACCGATCTGGTACGCTATCTCTTAGCATGTAC 00 29 CCGGCGCGATCTGCAGGGGCGCCGACGACATTATTCCTTCGGCTCGCCG 33G>A 34+TTC 44 00 CCGGCGCGATCTGCAGGGGCGCCGACGACATTG---CTTCGGCTCGCCGTGG Dominant markers “snip-SNPs” A B 00 42 CCGGCGAAACACGGGGCCACGGCGCAGGCGTTCTCCATCTCCAAAGAAC © Floragenex, Inc. 2009 www.floragenex.com
  • 5. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a populatio © Floragenex, Inc. 2009 www.floragenex.com
  • 6. Paired-end Sequencing for RAD LongReads © Floragenex, Inc. 2009 www.floragenex.com
  • 7. RAD LongRead contigs range in size RAD LongRead contig lengths 1500 1125 # of contigs 750 375 0 100 200 300 400 500 600 700 800 900 Contig length © Floragenex, Inc. 2009 www.floragenex.com
  • 8. RAD LongReads for Genotyping Assay Development Goal • Identify testcross segregating alleles for translation into Sequenom iPlex assay format RAD LongRead sequencing results • ~43,000 contigs • 9,903 SNPs identified • 1,005 InDels identified Validation test • 280 SNPs were converted into a Sequenom assay (120 bp free of other polymorphisms) Results 1) Nearly 100% conversion rate into a functional assay 2) ~85% of identified SNPs segregated as expected and mapped to LGs © Floragenex, Inc. 2009 www.floragenex.com
  • 9. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population © Floragenex, Inc. 2009 www.floragenex.com
  • 10. Trait mapping with bulked populations © Floragenex, Inc. 2009 www.floragenex.com
  • 11. Applications for Sequenced RAD markers • SNP discovery – scalable discovery of markers in any genome • SNP discovery with RAD LongRead markers – identify SNPs and develop flanking sequence • Trait mapping – find linked markers by bulk segregant analysis • Genetic maps – SNP discovery and genotyping of a population © Floragenex, Inc. 2009 www.floragenex.com
  • 12. RAD-based Physical and Genetic Maps can optimize Whole Genome Assembly © Floragenex, Inc. 2009 www.floragenex.com
  • 13. RAD Summary RAD markers focus high-depth sequencing on a fraction of the genome • de novo marker discovery • marker density can scale with project goals RAD LongRead markers • develop long contigs of 200-800 bp • good for porting SNPs to other genotyping platforms • discriminates between homeologous genomes Trait mapping • Rapidly identify Mendelian alleles Genetic mapping and physical mapping • RAD marker-based maps can tie together for genome assembly © Floragenex, Inc. 2009 www.floragenex.com
  • 14. Questions? Floragenex Plant Genomics Team: Eric Johnson, Chief Technical Officer eric@floragenex.com Rick Nipper, VP of Research rick@floragenex.com Office Phone 541.343.0747 © Floragenex, Inc. 2009 www.floragenex.com