Hépatite C  Virus et marqueurs.pdf
Upcoming SlideShare
Loading in...5
×
 

Hépatite C Virus et marqueurs.pdf

on

  • 2,954 vues

S. Chevaliez

S. Chevaliez

Statistiques

Vues

Total des vues
2,954
Vues sur SlideShare
2,954
Vues externes
0

Actions

J'aime
2
Téléchargements
368
Commentaires
0

0 Ajouts 0

No embeds

Accessibilité

Catégories

Détails de l'import

Uploaded via as Adobe PDF

Droits d'utilisation

© Tous droits réservés

Report content

Signalé comme inapproprié Signaler comme inapproprié
Signaler comme inapproprié

Indiquez la raison pour laquelle vous avez signalé cette présentation comme n'étant pas appropriée.

Annuler
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Votre message apparaîtra ici
    Processing...
Poster un commentaire
Modifier votre commentaire

Hépatite C  Virus et marqueurs.pdf Hépatite C Virus et marqueurs.pdf Presentation Transcript

  • HEPATITE CVirus & Marqueurs Stéphane Chevaliez Centre National de Référence Des Hépatites B, C et delta Laboratoire de Virologie & INSERM U955 Hôpital Henri Mondor Université Paris-Est Créteil
  • Hépatite C : virus et marqueurs Virus de l’Hépatite C • Découvert par Houghton en 1989 • 1ère cause d’hépatite chronique et de cirrhose en Europe et en Amérique du Nord • 1ère indication de transplantation hépatique dans les pays industrialisésAfdhal,
NH.
2004;
Sem
Liv
Dis,
24(Supp
2):
3‐8
  • Hépatite C : virus et marqueursVirus de l’Hépatite C• Famille : Flaviviridae• Genre : Hepacivirus Phylogénie de la région codant la protéine NS5BAdapted
from
Simmonds
et
al.,
1999;
2001.
  • Hépatite C : virus et marqueursVirus de l’Hépatite C• Famille : Flaviviridae• Genre : Hepacivirus• Hôte naturel : Homme• Tropisme : Hépatocyte
  • Hépatite C : virus et marqueursOrganisation Structurale
  • Hépatite C : virus et marqueursOrganisation Génomique desFlaviviridae 0 1800 3600 5400 7200 9000 10800 Hepatitis
C
virus 5’UTR 3’UTR C E1 E2 NS2 NS3 NS4B NS5A NS5B p7 4A Pestivirus 5’UTR 3’UTR C E0 E1 E2 NS2 NS3 NS4B NS5A NS5B Npro 4A p7 Yellow
fever
virus 5’UTR 3’UTR prM Cap C E NS1 2A 2B NS3 NS4A 4B NS5
  • Hépatite C : virus et marqueursOrganisation Génomique Protéines structurales Protéines non structuralesPopescu
and
Dubuisson,
Bio.
Cell
2010,
102(1):
63‐74.
  • Hépatite C : virus et marqueursOrganisation GénomiqueBartenschlager
et
al,
Trends
Microbiol,
in
press.
  • Hépatite C : virus et marqueursIRES et TraductionFrom
Department
of
Structural
Biology,
Stanford
University
Medical
School,
USA.
  • Hépatite C : virus et marqueursRéseaux d’InteractionsPark
et
al,
BMC
Bioinformatics
2010,
11(Suppl
1):
S23.
  • Hépatite C : virus et marqueursProtéine de CapsideBoulant
et
al,
J
Virol
2005,
79(17):
11353‐11365.
  • VHC G1bPiodi
et
al.,
Hepatology
2008,
48(1):
16‐27.
  • Hépatite C : virus et marqueurs Capside et LipidesBartenschalger
et
al.,
Tends
Microbiol,
in
press.
  • Hépatite C : virus et marqueurs Interaction entre la Capside et DGAT-1 *Diacylglycérol diacyltransférase-1Herker
et
al.,
Nat
Med
2010,
16(11):
1295‐1298.
  • Hépatite C : virus et marqueurs Glycoprotéine E2 • Hétérodimère avec E1 • Régions hypervariables – HVR1 – HVR2 – igVR • Rôles – HVR2 et igVR indispensables au “folding“ E1-E2 – Étapes précoces (interaction avec CD81, peptide de fusion)Krey
et
al.,
PLoS
Pathog.
2010,
6(2):
e1000762;
McCaffrey
et
al.,
J
Gen
Virol
2011,
92:
112‐121.
  • Hépatite C : virus et marqueursÉtape Précoce : Entrée du VHCPopescu
et
al.,
Bio
Cell
2010,
102:
63‐74.
  • Hépatite C : virus et marqueursHVR1 Région HVR1 (27 amino-acides)  80% de divergence nucléotidique entre génotypes  Epitope majeur de neutralisationTimm
et
al.,
World
J
Gastroenterol
2007;
13(36)4808‐4817.

  • Hépatite C : virus et marqueursTransmission du VHC
  • Hépatite C : virus et marqueursAnalyse Phylogénique 4a_ED43 Patient 7 Patient 4 Patient 8 1b_AWV2C33 Patient 6 1a_HCT18X5 Région HVR1 (81 nt) 3a_CB CLUSTALX 2a_Q2B DNADist (PHYLIP 3.5) 1a_HCT27X5 Matrice de distance: Kimura 2-parameter (Ts/Tv=2) S1 (6/05) Neighbor-Joining Patient 3 (01/05) Bootstraping : 1000 replicates NJPlot S2 (6/05) S3 (6/05) S4 (6/05) Patient 3 (7/04) Patient 2 (9/04) Patient 2 (7/04) 100 Patient 3 (9/05) Patient 3 (7/05) S5 (7/05) 1b_HVR3812 5a_SA13 Patient 1 (7/04) 2b_JFH1 Surfaces inertes 6a_33 Séroconversion VHC 0.2 Patients VHC chroniquesGirou
et
al.,
Clin
Infect
Disease
2008,
47(5):
627‐633.
  • Hépatite C : virus et marqueursProtéine p7• Viroporine dont la structure 3D a été récemment déterminée par ME• Rôle(s) in vivo ?• Cible thérapeutique potentielleLuik
et
al.,
Proc
Natl
Acad
Sci
2009,
4;106(31):
12712‐6;
Griffin
S,
Proc
Natl
Acad
Sci
2009,
106(31):
12567‐68.
  • Hépatite C : virus et marqueursActivité Antivirale du BIT225• IC50 de 314 nM dans le modèle du BVDV• Activité synergiqueLuscombe
et
al.,
Antiviral
Res
2010
May;86(2):144‐53.
  • Hépatite C : virus et marqueursProtéine NS2• NS2 (région N-ter) – Rôle dans l’organisation de la formation des nucléocapsides• NS2pro (région C-ter)Jirasko
et
al.,
PLoS
pathog
2010
Dec
16;6(12):
e1001233;
Ivo
et
al.,
Nature
2006,
442:
831‐835.
  • Hépatite C : virus et marqueursProtéine NS3-4ARaney
et
al.,
J
Biol
Chem
2010,
285(30):
22725‐731.
  • Hépatite C : Nouvelles Hepatite C : virus et marqueursInhibition de la Production d’IFNpar NS3
  • Hépatite C : virus et marqueursProtéase NS3Raney
et
al.,
J
Biol
Chem
2010,
285(30):
22725‐731.
  • Hépatite C : virus et marqueursEtudes de Phase III Présentées àl’AASLD™ 2010• SPRINT-2 BOCEPREVIR (BOC)• RESPOND-2• ADVANCE• ILLUMINATE TELAPREVIR (TVR)• REALIZE
  • Hépatite C : virus et marqueurs SPRINT-2—BOC + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : Design de l’Etude S4 S28 S48 S72 48 PR PR PR + placebo Suivi n = 363 Lead-in ARN-VHC indétectable à S8-24 Suivi S24BOC/TGR PR PR + boceprevir ARN-VHC détectable à S8-24 n = 368 Lead-in P/R + placebo SuiviBOC/PR48 PR PR + boceprevir Suivi n = 366 Lead-in *BOC 800 mg q8h; pegIFN alfa-2b 1,5 µg/kg/s; RBV 600-1400 mg/j adaptée au poids.Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
  • Hépatite C : virus et marqueursSPRINT-2—BOC + PegIFN + RBV chez desPatients Naïfs de Génotype 1 : Caractéristiquesdes Patients Cohorte 1 (caucasiens) [n=938] PR48 BOC/RGT BOC/PR48 n=311 n=316 n=311 Sexe masculin [n(%)] 171 (55) 198 (63) 187 (60) Age (années) [moyenne] 48 49 49 IMC (kg/m2) [moyenne (±DS)] 27 (±5) 28 (±5) 27 (±5) ARN du VHC >400,000 UI/mL [n(%)] 286 (92) 287 (91) 289 (93) Type/sous-type du VHC [n(%)]* 1a 186 (60) 196 (62) 196 (63) 1b 112 (36) 110 (35) 102 (33) Fibrose sévère/Cirrhose 22 (7) 25 (8) 37 (12) (METAVIR F3/F4) [n(%)] *La détermination du type et du sous-type a été réalisée par séquençage d’une portion de la région NS5B codant l’ARNpol (méthode de référence)Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
  • Hépatite C : virus et marqueursSPRINT-2—BOC + PegIFN + RBV chez desPatients Naïfs de Génotype 1 : RVS et Taux deRechute p
<0,0001 p
<0,0001 Taux de RVS Proportion
de
patients
(%) Taux de rechutePoordad
et
al.,
AASLD
2010,
Abstract
LB4.
  • Hépatite C : virus et marqueurs SPRINT-2—BOC + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : RVS et Taux de Rechute p
<0,0001 p
<0,0001 Taux de RVS Proportion
de
patients
(%) Taux de rechute➜ Le BOC améliore significativement les chances de guérison par rapport au SOC➜ L’adaptation de la durée du traitement à la réponse (TGR) ne semble pas diminuer les chances de guérison Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
  • Hépatite C : virus et marqueurs ADVANCE—TVR + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : Design de l’Etude S8 S12 S24 S36 S48 S72 PR48 Placebo PR Suivi(n = 361) + P/R eRVR+ Suivi T12PR(n = 363) TVR + PR PR PR Suivi eRVR+ Suivi T8PR Pbo TVR +(n = 364) PR + PR PR PR Suivi eRVR- *TVR 750 mg q8h; pegIFN alfa-2a 180 µg/s; RBV 1000-1200 mg/j adaptée au poids. eRVR : réponse virologique rapide étendue (ARN indétectable à S4 et à S12) Jacobson
et
al.,
AASLD
2010,
Abstract
211.
  • Hépatite C : virus et marqueursADVANCE—TVR + PegIFN + RBV chez desPatients Naïfs de Génotype 1 : Caractéristiquesdes Patients T12PR (n = 363) T8PR (n = 364) PR (n = 361) Sexe masculin [n (%)] 214 (59) 211 (58) 211 (58) Origine ethnique Caucasiens [n (%)] 325 (90) 315 (87) 318 (88) Afro-Américains 26 (7) 40 (11) 28 (8) Hispaniques 35 (10) 44 (12) 38 (11) Âge (années) [médiane (intervalle)] 49 (19-69) 49 (19-68) 49 (18-69) IMC (kg/m2) [médiane (intervalle)] 26 (18-47) 26 (17-46) 26 (17-48) ARN du VHC > 800 000 UI/ml* [n (%)] 281 (77) 279 (77) 279 (77) Type/sous-type du VHC** [n (%)] 1a 213 (59) 210 (58) 208 (58) 1b 149 (41) 151 (41) 151 (42) 1 non sous-typable 1 (< 1) 3 (1) 2 (1) Stade de fibrose, n (%) Fibrose en ponts 52 (14) 59 (16) 52 (14) Cirrhose 21 (6) 26 (7) 21 (6) *La charge virale (ARN du VHC, UI/ml) a été déterminée par PCR en temps réel (TaqMan® Roche), avec une limite de quantification de 25 UI/mL **La détermination du génotype viral a été réalisée par hybridation inverse, INNO-LiPA v1.0Jacobson
et
al.,
AASLD
2010,
Abstract
211.
  • Hépatite C : virus et marqueursADVANCE—TVR + PegIFN + RBV chez desPatients Naïfs de Génotype 1 : RVS p
<0,0001 p
<0,0001 Proportion
de
patients
ayant développé
une
RVS
(%)Jacobson
et
al.,
AASLD
2010,
Abstract
211.
  • Hépatite C : virus et marqueursADVANCE—TVR + PegIFN + RBV chez desPatients Naïfs de Génotype 1 : RVS p
<0,0001 p
<0,0001 Proportion
de
patients
ayant développé
une
RVS
(%) ➜ Le TVR améliore significativement les chances de guérison par rapport à la bithérapie standard ➜ Le traitement par TVR 8 ou 12 semaines donne des taux de RVS comparables (différence NS) Jacobson
et
al.,
AASLD
2010,
Abstract
211.
  • Hépatite C : virus et marqueurs RESPOND-2—BOC + PegIFN + RBV chez des Patients en échec Thérapeutique de G1 : Design de l’Etude S4 S28 S48 S72 PR48 PR PR + placebo Suivi n = 80 Lead-in ARN-VHC indétectable à S8 Suivi S24 BOC/TGR PR PR + boceprevir S32 ARN-VHC détectable à S8 n = 162 Lead-in PR + Suivi placeboBOC/PR48 PR PR + boceprevir Suivi n = 162 Lead-in *BOC 800 mg q8h; pegIFN alfa-2b 1,5 µg/kg/s; RBV 600-1400 mg/j adaptée au poids. Bacon
et
al.,
AASLD
2010,
Abstract
216.
  • Hépatite C : virus et marqueursRESPOND-2—BOC + PegIFN + RBV chez desPatients en échec Thérapeutique de G1 : RVS etTaux de Rechute p
<0,0001 p
<0,0001 Taux de RVS Proportion
de
patients
(%) Taux de rechute 17/60 8/25 95/162 17/111 107/161 14/121 Lead‐in
+ 32
BOC/PR
±
PR12Bacon
et
al.,
AASLD
2010,
Abstract
216.
  • Hépatite C : virus et marqueursRESPOND-2—BOC + PegIFN + RBV chez desPatients en échec Thérapeutique de G1 : RVS etTaux de Rechute p
<0,0001 p
<0,0001 Taux de RVS Proportion
de
patients
(%) Taux de rechute 17/60 8/25 95/162 17/111 107/161 14/121 Lead‐in
+ 32
BOC/PR
±
PR12 ➜ Le BOC améliore significativement les chances de guérison par rapport au retraitement par SOCBacon
et
al.,
AASLD
2010,
Abstract
216.
  • Hépatite C : virus et marqueursRESPOND-2—BOC + PegIFN + RBV chez desPatients en échec Thérapeutique de G1 : RVSSelon la Réponse Antérieure Répondeurs partiels RR Proportion
de
patients
(%) 2/29 15/51 23/57 72/105 30/58 77/103 Lead‐in
+ 32
BOC/PR
±
PR12Bacon
et
al.,
AASLD
2010,
Abstract
216.
  • Hépatite C : virus et marqueursRESPOND-2—BOC + PegIFN + RBV chez desPatients en échec Thérapeutique de G1 : RVSSelon la Réponse à S4 p
<0,0001 p
<0,0001 Proportion
de
patients
(%) Diminution de l’ARN <1 Log10 Diminution de l’ARN ≥1 Log10 17/66 15/46 80/110 15/44 17/66 Lead‐in
+ 32
BOC/PR
±
PR12 ➜ Intérêt de la phase de Lead-in comme facteur prédictif de la RVSBacon
et
al.,
AASLD
2010,
Abstract
216.
  • Hépatite C : virus et marqueursREALIZE—TVR + PegIFN + RBV chez desPatients en Echec Thérapeutique de G1 : Designde l’Etude S4 S8 S12 S16 S48 S72 48 PR PR + placebo PR Suivin = 130 PRn = 260 PR + TVR (Ll) PR Suivi PRn = 260 (LI) PR + TVR PR Suivi*TVR 750 mg q8h; pegIFN alfa-2a 180 µg/s; RBV 1000-1200 mg/j adaptée au poids.Press
release,
Sept
2010.
  • Hépatite C : virus et marqueursREALIZE—TVR + PegIFN + RBV chez desPatients en Echec Thérapeutique de G1 : RVS Proportion
de
patients PR48 (n=130) ayant
une
RVS
(%) T12/PR48* (n=520) *Bras
poolésPress
release,
Sept
2010.
  • Hépatite C : virus et marqueursTMC435 Administré en Monothérapie chezdes Patients de Génotype 2, 3, 4, 5 et 6 Diminution
moyenne
de
l’ARN
 du
VHC
(Log
UI/mL) J3 J7Manns
et
al.,
AASLD
2010,
Abstract
82.
  • Nouvelles Hépatite C : virus et marqueurs Protéine NS5B: RdRpLesburg
et
al.,
Nat
struct
Biol
1999,
6:
937‐943;
Bressanelli
et
al.,
Proc
Natl
Acad
Sci
USA
1999,
96:
13034‐13039;
Ago
et
al.,
Srructure
Fold
Des
1999,
7:1417‐1426.
  • Hépatite C : virus et marqueursRéplication Virale – Modèle du poliovirus . Virus à ARN monocaténaire de polarité positive RéplicationDe
Clercq.,
Nature
Review
Drug
Discovery,
2007;
6:
1001‐18

  • Hépatite C : virus et marqueursVariabilité Génétique• Erreurs au cours de la réplication – Fréquentes • 10-4-10-4 mutations par nucléotide copié au cours de la réplication du VHC – Spontanées – Au hasard• Absence d’activité exonucléasique 3’⇒5’ ("proofreading") – Accumulation de mutations• A l’origine de : – La diversification des types et des sous-types – La distribution en quasi-espèces
  • Hépatite C : virus et marqueursDiversification des GénotypesSimmonds
et
al.,
Hepatology
2005,
42(4):962‐73.

  • Hépatite C : virus et marqueursDistribution des Génotypes 1a,Adapted
from
Fang
J.,
et
al.
J.
Clin
Liver
Dis.
1997.

  • Hépatite C : virus et marqueursDistribution en Quasi-espèceWeiner
et
al.,
Virology
1991;
180:842‐848;
Martell
et
al.,
J
Virol
1992;66:3225‐36.
  • Hépatite C : virus et marqueursCibles des Molécules Antivirales Site C (Palm) Site A (Thumb/fingertips) (A-837093) (JTK-109) Mutants: 411, 414, 448 Mutants: 495, 496, 499 A B E C D Site B (Thumb) HCV-371 Site E (Finger, hypothetical)Mutants: 419, 423, 482 GS-9190 Mutants: 445,448,452 Site D (Palm) (HCV796) Site Actif Mutants: 316 (R7128) Mutants: 282Copyright
©
2006
Merck
&
Co.,
Inc.,
Whitehouse
Station,
New
Jersey,
USA
  • Hépatite C : virus et marqueursActivité Antivirale du MK-0608 wt S282R/T/I wt S282 MK-0608 at 1mg.kg-1 orally 7 6 HCV RNA (Log IU/mL) 5 4 3 2 - 4,6 - 4,1 LOQ 1 (20 IU/mL) TMA + + + + - - - - - - - - + + 0 -15 -10 -5 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 Days
  • Hépatite C : virus et marqueurs Cycle ViralAdapted
from
Lindenbach
and
Rice,
Nature
(2005),
436:
933‐938.
  • Hépatite C : virus et marqueursComplexes de RéplicationMoradpour
et
al.,
Nature
Reviews
Microbiology,
2007;
5:
453‐463.
  • HEPATITE CStratégie Diagnostique & Suivi Virologique
  • Stratégie diagnostique & suivi virologiqueMarqueurs Virologiques Marqueurs indirects Anticorps anti-VHC totaux Marqueurs directs Ag de capside (AgC) ARN VHC Génotype VHC Profil de résistance
  • Stratégie diagnostique & suivi virologiqueTests Sérologiques• Détection et quantification de l’Ag de capside• Test “Combo” – Détection simultanée de l’Ag de capside et des anticorps anti-VHC• Détection des anticorps anti-VHC à l’aide d’une trousse de 3ème génération
  • Stratégie diagnostique & suivi virologiqueAntigène de Capside : unMarqueur de la Réplication r = 0.92; p < 0.0001Bouvier‐Alias
et
al.,
Hepatology
2002,
36(1):
211‐218.
  • Stratégie diagnostique & suivi virologiquePerformances Analytiques de laTrousse Architect (Abbott)• Spécificité – 99,2% à 100%• Sensitivité – ≤10 fmol/L (i.e 500 to 3 000 UI/mL d’ARN VHC) – Tous les génotypes (excepté génotype 2)• Intervalle de quantification – 10 à 20 000 fmol/L (≤ 7,8 Log10 UI/mL d’ARN VHC)• Stable à 37°C pendant 96 heuresRoss
et
al.,
J
Clin
Micribiol
2010,
48(4):
1161‐8;
Mederacke
et
al.,
J
Clin
Virol
2009,
46(3):
210‐5;
Miedouge
et
al.,
J
Clin
Virol
2010,
48(1):18‐21.
  • Stratégie diagnostique & suivi virologiqueTrousse Architect : Monitoringdes Cinétiques Virales RVR (G1b) SVR (G1b) Relapser (G1b) NR (G1a) Core Ag RNARoss
et
al.,
J
Clin
Microbiol

2010,
48(4):
1161‐8.
  • Stratégie diagnostique & suivi virologiqueIntérêts Cliniques de laQuantification de l’AgC• Diagnostic de l’infection – Trousses commerciales – Facile à utiliser, automatisée, peu couteux (20% par rapport à une charge virale VHC)• Décision de traiter et suivi de l’efficacité des traitements antiviraux – Quantitatif (≤20,000 fmol/L*) – Alternative aux techniques de détection quantification de l’ARN du VHC(*Abbott Architect HCV Ag Assay)
  • Stratégie diagnostique & suivi virologique Tests Virologiques Moléculaires Tests qualitatifs Tests quantitatifs Très sensibles Seuil de détection ≥ qualitatifs (≤ 50 IU/mL) Quelle quantité est présente ?Est-ce que le VHC est présent ? Détermination Détection de la résistance du GénotypeQuel est le génotype du virus ? Quel type de VHC est présent ?
  • Stratégie diagnostique & suivi virologique Tests Virologiques Moléculaires Tests Qualitatifs-Quantitatifs Est-ce que le VHC est présent et en quelle quantité ? Détermination Détection de la résistance du GénotypeQuel est le génotype du virus ? Quel type de VHC est présent ?
  • Stratégie diagnostique & suivi virologique Intervalle de Quantification 10 102 103 104 105 106 107 108Cobas AmplicorHCV Monitor v2.0SuperQuantLCx HCV RNAAssayVersant HCV RNA3.0 (bDNA)
  • Stratégie diagnostique & suivi virologiqueAvantages Techniques de la PCRen Temps Réel - Diminution du risque de contamination - Amélioration de la sensibilité - Augmentation de l’intervalle de quantification linéaire - Amélioration précision et reproductibilité - Augmentation de débit à travers l’automatisation
  • Stratégie diagnostique & suivi virologique Intervalle de Quantification 10 102 103 104 105 106 107 108Cobas AmplicorHCV Monitor v2.0SuperQuantLCx HCV RNAAssayVersant HCV RNA3.0 (bDNA)TaqMan 48 HCV(Roche)HCV Quant ASR(Abbott)Versant HCV RNA1.0 (kPCR, Siemens)*Artus HCV QS-RGQ(Qiagen)**in development
  • Stratégie diagnostique & suivi virologiquePlates-formes CAP-CTM96 (ROCHE) kPCR (SIEMENS) m2000SP-m2000RT (ABBOTT)
  • Stratégie diagnostique & suivi virologiqueAvantages Cliniques de la PCRen Temps Réel • Remplace les techniques qualitatives de détection de l’ARN VHC • Quantifie l’ensemble des charges virales observées en pratique clinique – Charges élevées préthérapeutiques – Faibles charges virales au cours du traitement • Surveille efficacement les cinétiques virales (évaluation précoce des réponses virologiques au traitement)
  • Stratégie diagnostique & suivi virologiqueQuantification ARN du VHC(CTM, Roche) 8 HCV RNA level in CAP/CTM48 (Log10 IU/mL) 7 Genotype 1 (n=29) 6 Genotype 2 (n=27) Genotype 3 (n=29) 5 Genotype 4 (n=30) Genotype 5 (n=9) 4 Genotype 6 (n=2) r = 0.889; p < 0.0001 3 3 4 5 6 7 8 HCV RNA level in Versant HCV 3.0 Assay bDNA (Log10 IU/mL)Chevaliez
et
al.,
2007;
Hepatology,
46(1):
22‐31.
  • Stratégie diagnostique & suivi virologiqueAbsence de Détection de l’ARN Viral depatients Fortement Virémiques Infectés parun Génotype 4 (Log10 IU/mL) CAP/CTM96 m2000SP/m2000RT Versant 3.0 Patient 1 (4h) <1.08 5.4 5.0 Patient 2 (4l) <1.08 6.0 5.7 80 90 100 110 120 130 140 150 160 170 180 |.........|.........|.........|.........|.........|.........|.........|.........|.........|.........|F_7157 (4a): TAGCCATGGCGTTAGTATGAGTGTTGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATCGCCGGPatient 1 (4h): ...........................A.....................................A...................T...............Patient 2 (4l): ...........................A.....................................A...................T............... 190 200 210 220 230 240 250 260 270 .........|.........|......-...|.........| .........|.........|.........|.........| .........|........F_7157 (4a): GATGACCGGGTCCTTTCTTGGATTAA-CCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCPatient 1 (4h): ......................A.T.A..........................................................................Patient 2 (4l): .......................C..-.......................................................C.......T.......... 280 290 300 310 320 330 340 |.........|.........|.........|.........|.........|.........|.F_7157 (4a): TTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACCPatient 1 (4h): .............................................................Patient 2 (4l): .............................................................Chevaliez
et
al.,
2008;
Hepatology,
49(4):
1397‐1398.
  • Stratégie diagnostique & suivi virologiqueQuantification de Transcrits d’ARN Sauvages ouMutés en Position 145 et/ou 165 Measured HCV RNA levels (Log10 IU/mL) HCV 5’NC sequence Real-time PCR assays bDNA assay CTM m2000 Versant 3.0 Wild-type (G145 and 5.73±0.13 6.05±0.10 6.43±0.01 A165) Single mutant (G145A and 4.02±0.13 6.00±0.11 6.69±0.02 A165) Single mutant (G145 and 4.28±0.35 5.88±0.20 6.30±0.02 A165T) Double mutant (G145A <1.08* 5.95±0.25 6.60±0.18 and A165T) *Target not detectedChevaliez
et
al.,
Hepatology,
2009,
50(5):
1681.
  • Stratégie diagnostique & suivi virologiqueQuantification ARN du VHC(m2000, Abbott) HCV RNA level in m2000SP/m2000RT (Log10 IU/mL) 8 7 Genotype 1 (n=55) 6 Genotype 2 (n=21) Genotype 3 (n=29) 5 Genotype 4 (n=24) Genotype 5 (n=9) 4 Genotype 6 (n=3) r = 0.972; p < 0.0001 3 3 4 5 6 7 8 HCV RNA level in Versant HCV 3.0 Assay bDNA (Log10 IU/mL)Chevaliez
et
al.,
J
Clin
Microbiol,
2009,47(6):1726‐32.
  • Stratégie diagnostique & suivi virologiqueQuantification ARN du VHC(kPCR, Siemens) 132 clinical samplesDavid
Sherman.,
Molecular
Symposium,
September
2007
(source:
Siemens
Medical
Solutions
Diagnostics).
  • Stratégie diagnostique & suivi virologiqueRésumé • En pratique clinique, la quantification de l’ARN du VHC doit être réalisée à l’aide d’une technique de PCR en temps réel – Avec une limite de détection de l’ordre de 10 à 15 UI/mL
  • Stratégie diagnostique & suivi virologiqueGénotypes du VHCSimmonds
et
al.
Hepatology
2005.

  • Stratégie diagnostique & suivi virologiqueRépartition des Génotypes 1a,Adapted
from
Fang
J.,
et
al.
J.
Clin
Liver
Dis.,
1997.

  • Stratégie diagnostique & suivi virologiqueDétermination du Génotype • Méthodes moléculaires (genotyping) – Analyse de la séquence après séquençage direct – Hybridation inverse des produits d’amplification sur des supports solides comportant des sondes génotype sépcifique : Line Probe Assay (INNO-LiPA HCV, Innogenetics) – PCR en temps réel à l’aide d’amorces et de sondes génotype spécifique • Méthodes sérologiques (“serotyping”) – ELISA compétitifArens et al., J Clin Virol, 2001; 22:11-29; Davidson et al., J Gen Virol 1995; 76: 1197-204; Lareu et al., 1997; Le Pogam et al., 1998; J ClinMicrobiol; 36: 1461-3; Ilina et al., J Clin Miocrobiol, 2005; 43(6): 2810-15.
  • Stratégie diagnostique & suivi virologiqueDétermination du Génotype • Méthodes moléculaires (genotyping) – Analyse de la séquence après séquençage direct – Hybridation inverse des produits d’amplification sur des supports solides comportant des sondes génotype sépcifique : Line Probe Assay (INNO-LiPA HCV, Innogenetics) – PCR en temps réel à l’aide d’amorces et de sondes génotype spécifique • Méthodes sérologiques (“serotyping”) – ELISA compétitifArens
et
al.,
J
Clin
Virol,
2001;
22:11‐29;
Davidson
et
al.,
J
Gen
Virol
1995;
76:
1197‐204;
Lareu
et
al.,
1997;
Le
Pogam
et
al.,
1998;
J
Clin
Microbiol;
36:1461‐3;
Ilina
et
al.,
J
Clin
Miocrobiol,
2005;
43(6):
2810‐15.
  • Stratégie diagnostique & suivi virologiqueVersant® HCV Genotype 2.0Assay (INNO-LiPA)
  • Stratégie diagnostique & suivi virologiqueIntérêt de la Détermination duSous-Type ? • Direct Acting Antivirals (DAAs) pourraient avoir des efficacités antivirales différentes selon les sous-types de VHC de génotype 1 in vitro et in vivo • Le traitement par DAAs pourrait être associé à des profiles de résistance différents selon les sous-types de VHV de génotype 1 in vitro et in vivo
  • Stratégie diagnostique & suivi virologiqueProfils de Résistance du BMS-70052, in vitroSubstitution amino Niveau de EC50 fold-changeacidique Replication (%)Génotype 1bL31F/V 5-23 146±44P32L 17 18±6Y93H/N 19-28 20 ±7Génotype 1aM28T 683 31±23Q30E/H/R 1 450-24 933 130±56L31M/V 350-3 350 117±29P32L 233 18±5Y93C/H/N 1 850-47 017 18±11Fridell
et
al.
Antimicrob
Agents
Chemother.
2010;
54(9):
3641‐50
  • Stratégie diagnostique & suivi virologiqueProfils de Résistance du Telaprevir(PROVE-2 trial), in vivo Génotype 1a Génotype 1b Pt-1 Pt-2 Pt-3 Pt-4 Pt-5 Pt-6 R26K V36L/M V36A V36A T42S A40T A40T T54S T54S T54A Y56F T91A R155K R155K R155K/E R155T/A G174SChevaliez
et
al.
International
HIV&HEPATITIS
VIRUS
Drug
Resistance
Workshop
and
Curative
Strategies
2010.
  • Stratégie diagnostique & suivi virologiqueDétermination du Sous-Type parune Méthode de Référence* *HCV genotype determination by means of phylogenetic analysis of a portion of the gene encoding the NS5B region was used as the reference methodChevaliez
et
al.,
PLoS
One
2009,
4(12):
e820.
  • Stratégie diagnostique & suivi virologique Détermination du Sous-Type 1st Generation of Line 2nd Generation of Line Sequence Analysis of RealTime HCV Probe Assay Probe Assay the 5’NCR Genotype II (LiPA 1.0) (LiPA 2.0) GT 1a 77.6% 70.5% 97.5% 93.2%(n=237) (n=184) (n=167) (n=231) (n=220) GT 1b 90.5% 91.3% 96.2% 88.6%(n=263) (n=238) (n=240) (n=253) (n=233) Chevaliez
et
al.,
PLoS
One
2009,
4(12):
e820.
  • Stratégie diagnostique & suivi virologiqueRésumé- Dans les essais cliniques évaluant les DAAs et probablement en pratique clinique, le détermination du sous-type des souches de génotype 1 est nécessaire pour la stratification et l’interprétation des profils de résistance- La détermination du génotype sur la seule région 5’NC doit être proscrite- La 2nd génération de Line Probe Assay qui utilise des sondes dirigées contre la région core en plus de la région 5’NC est la meilleure méthode permettant de distinguer les sous-types 1a et 1b
  • Stratégie diagnostique & suivi virologiqueIL28B “Single NucleotidePolymorphism” (SNP) En amont du géne de l’IL28B, codant l’IFN-λ3 rs12979860 Ge
et
al.,
Nature
2009;
461:
399‐401.
  • Stratégie diagnostique & suivi virologiqueRVS à la Bithérapie Standard enFonction du Génotype IL28B Réponse virologique soutenue (%) Caucasians African-Americans Hispanics Combined (n=1171) (n=300) (n=116) (n=1587) 12 14 37% 37% 22% 29% 51% 49% 48% Thompson
et
al.,
Gastroenterology
2010;
139(1):
120‐129.
  • Stratégie diagnostique & suivi virologiqueRésumé- En pratique clinique, SNPs en amont du gène de l’IL28B (rs12979860 et rs8099917) sont les facteurs prédictifs les plus robustes de la RVS à la bithérapie- Cependant, leur valeur prédictive à l’échelon individuel n’est pas suffisante pour la prise en compte dans les décisions thérapeutiques- La détermination du génotype IL28B en association à d’autre paramètres, comme la réponse virologique à S4, pourrait être utile pour adapter le traitement, éventuellement des patients sous triple combinaison Ge
et
al.,
Nature
2009;
461:
399‐401;
Tanaka
et
al.,
Nat
Genet
2009;
41(10):
1105‐9;
Afdhal
et
al,
Hepatology
in
press.
  • Stratégie diagnostique & suivi virologiqueIntérêts des Tests Virologiquesen Thérapeutique • Décision de traiter • Optimisation du schéma thérapeutique • Etude de la réponse virologique au traitementConsensus
conference:
treatment
of
hepatitis
C;
2002,
Gastroenterol
Clin
Biol,
26(2):
B303‐20
  • Stratégie diagnostique & suivi virologiqueTraitement de l’HépatiteChronique C• Traitement standard – Interféron pégylé alpha-2a or alpha-2b et ribavirine à doses fixe ou adaptée au poids• Durée de traitement – 16 à 72 semaines en fonction du génotype et de la réponse virologique
  • Stratégie diagnostique & suivi virologiqueIntérêts de la Détermination duGénotype • Détermination systématique du génotype – Facteur prédictif de la réponse au traitement – Conditionne . La dose de ribavirine . La durée du traitement
  • Stratégie diagnostique & suivi virologique Dose de Ribavirine Proportion
de
patients
avec
RVS
(%) Ribavirine
0,8
g/j Ribavirin
1,0
–
1,2
g/jHadziyannis et al., Ann Intern Med 2004;140: 346-355.
  • Stratégie diagnostique & suivi virologique Durée de Traitement Proportion
de
patients
avec
RVS
(%) 24
semaines 48
semainesHadziyannis
et
al.,
Ann
Intern
Med
2004;140:
346‐355.
  • Stratégie diagnostique & suivi virologiqueIntérêts de la Détection -Quantification de l’ARN VHC • Evaluation de la réplication virale chez des patients anticorps anti-VHC positifs • Evaluation de la réponse virologique au cours du traitement pegIFN - RBV – Réponse virologique rapide (semaine 4) – Réponse virologique précoce (semaine 12) – Réponse fin de traitement (EoT) – Réponse virologique soutenue (semaine 24 post-Rx)
  • Stratégie diagnostique & suivi virologique Réponses au Traitement en Fonction des Cinétiques Virales SOC +1 0HCV RNA reduction from baseline (Log10 IU/mL) -1 -2 Diminution ≥ 2 Log -3 -4 -5 Detection cut-off -6 (10-15 IU/mL) 0 4 8 12 Semaines
  • Stratégie diagnostique & suivi virologiqueRéponse Virologique Précoce :Facteur Prédictif de la RVS EoT RVS Rechute Diminution >2 Log ou Diminution <2 Log à S12 ARN indétectable à S12Adapted
from
Ferenci
et
al.,
J
Hepatol
2005,
43:
425‐433.
  • Stratégie diagnostique & suivi virologique Réponses au Traitement en Fonction des Cinétiques Virales SOC +1 0HCV RNA reduction from baseline (Log10 IU/mL) -1 -2 Diminution ≥ 2 Log -3 -4 Slow VR -5 RVR RVP Detection cut-off -6 (10-15 IU/mL) 0 2 4 8 12 Semaines
  • Stratégie diagnostique & suivi virologique Taux de RVS ViraferonPeg 1.5µg/kg/w + RBV 1000-1400 mg/d ViraferonPeg 1.0µg/kg/w + RBV 1000-1400 mg/d PegIFN alpha-2a 180µg/w + RBV 1000-1200 mg/dSVR 542/1019 667/1035 406/1019 386/1016 500/1016 423/1035 227/300 234/292 250/355 68/156 72/203 77/157 38/42 33/41 62/83 43/45 37/44 64/72 Week to first undetectable HCV RNA Semaines avec un ARN du VHC indétectable McHutchinson
et
al.,
New
Engl
J
Med
2009,
361(6):
580‐593.
  • Stratégie diagnostique & suivi virologique Longer Treatment Duration Genotype 1, Slow virological responders >2 Log drop at week 12, but detectable HCV RNA 48 weeks 72 weeks Rate of SVR (%) p=0.040 34/51 27/35 104/130 90/119 78/179 94/190 17/100 31/106 121/230121/225 HCV RNA <50 IU/mL HCV RNA >50 IU/mLBerg
et
al.,
Gastroenterology
2006,
130:
1086‐97.
  • Stratégie diagnostique & suivi virologique Longer Treatment Duration Genotype 1 and 4, Slow virological responders >2 Log drop at week 12, but detectable HCV RNA 48 weeks 72 weeks Rate of relapse (%) p<0.01 p<0.05 16/72 11/81 20/35 9/29 HCV RNA <50 IU/mL HCV RNA >50 IU/mLFerenci
et
al.,
Gastroenterology
2010,
138:
503‐512.
  • Stratégie diagnostique & suivi virologiqueShorter Treatment Duration• A recent meta-analysis suggested that – In patients infected with HCV genotype 1 with an RVR, 24 weeks of therapy with SOC should be considered only in subjects with low baseline viral loads – The optimal cut-off defining low baseline HCV RNA level (400,000-800,000 IU/mL) is not clearly definedMoreno
et
al.,
J
Hepatol
2010;
52:
25‐31.



  • Stratégie diagnostique & suivi virologiqueShorter Treatment Duration Genotype 2 and 3, Rapid virological responders (<50 IU/mL at week 4) 16
weeks p<0.001 p<0.001 24
weeks Rate of SVR (%) 375/458 368/405 197/243 115/212 181/215 174/193Diago
et
al.,
Hepatology.
2010;
51(6):
1897‐903.
  • Stratégie diagnostique & suivi virologiqueShorter Treatment Duration Genotype 2 and 3, Rapid virological responders with a low baseline viral load (<400,000 IU/mL) 16
weeks p=0.20 24
weeks Rate of SVR (%) 111/122 95/100Diago
et
al.,
Hepatology.
2010;
51(6):
1897‐903.
  • HCV genotype HCV-1 (4,5,6) HCV-2,3 RNA quantification SOC SOC 48 weeks 24 weeks Ribavirin (1000-1400 mg.d-1) Ribavirin (800 mg.d-1) RNA quantification at W4 HCV RNA HCV RNA RNA quantification at W4 undetectable detectable Consider HCV RNA HCV RNA 24 weeks RNA quantification at undetectable detectableof therapy1 W12 Decrease ≥ 2 Log Decrease ≥ 2 Log Decrease < 2 Log HCV RNA detectable HCV RNA undetectable Continue Rx until W24 If HCV RNA Consider Stop antiviral undetetectable Continue Rx Continue Rx until 16 weeks treatment Continue Rx Until until W24 W48 of therapy2 W721In patients with a low viral load at baseline (<400,000 IU/mL); 2In patients with a low viral load at baseline (400,000-600,000 IU/mL)
  • Stratégie diagnostique & suivi virologiqueFuture HCV Therapy• Future standard treatment – Pegylated interferon alpha-2a or alpha-2b – Ribavirin – Specific inhibitor of the NS3/4A protease . Telaprevir . Boceprevir
  • Stratégie diagnostique & suivi virologique ADVANCE Trial Telaprevir, Naïve, Genotype 1T12PR Follow‐up TVR+PR PR no
eRVRN
=
363 PR Follow‐up T8PR TVR Follow‐up PR no
eRVRN
=
364 +PR PR Follow‐up PR48 PR Follow‐upN
=
350 *eRVR
=
undetectable
HCV
RNA
at
week
4
and
week
12 0 8 12 24 36 48 60 72 Jacobson
et
al.,
AASLD
2010,
Abstract
211. Weeks
on
therapy
  • Stratégie diagnostique & suivi virologiqueSVR Rates p
<0.0001 p
<0.0001 Proportion
of
Patients 
with
SVR
(%)Jacobson
et
al.,
AASLD
2010,
Abstract
211.
  • Stratégie diagnostique & suivi virologique SPRINT-2 Trial Boceprevir, Naïve, Genotype 1BOC/RGT Follow‐up VR LI BOC+
PR N
=
368 PR Follow‐up no
VRBOC/PR48 LI BOC
+
PR Follow‐up N
=
366 PR48 PR Follow‐up N
=
363 *VR
=
HCV
RNA
undetectable
between
weeks
8
and
24 0 4 12 24 28 36 48 60 72 Poordad
et
al.,
AASLD
2010,
Abstract
LB‐4. Weeks
on
therapy
  • How to use molecular techniques to optimize management of chronic heptitis CTaux de RVS p
<0.0001 p
<0.0001 Proportion
of
Patients 
with
SVR
(%)Poordad et al., AASLD 2010, Abstract LB-4.
  • Stratégie diagnostique & suivi virologiqueRésumé- Duration of triple therapy with pegylated IFN, ribavirin and a protease inhibitor will be tailored to the virological response at week 4 or earlier- Response-guided therapy is associated with high rates of SVR in genotype-1 treatment naïve patients- The ideal time points, frequency, and the feasibility in real-life practice need to be further evaluated