Hépatite B

     Fabien Zoulim
Département d’hépatologie
 & INSERM U871, Lyon
Guérison                                                          30-50 ans

VHB                    HCA                ...


    • Hépatites aigues
          – VHA : 40%
          – VHB : 30%

•   1108 habitants de San Francisco
•   159 (14%) anti-HBc +
•   positivité des anti-HBc ass...

Déclaration obligatoire
       de l’hépatite B en France :
 résultats des 12 premiers mois de notification

Denise Antona...
Incidence of acute hepatitis B in France
Sentinel networks 1991-1996 et Lyon (COURLY) 1983-1997
Circuit de l’information
                               Feuillets 2 et 3                    Médecin
    Biologiste        ...

158 acute hepatitis cases

• Hospital doctor in 64% cases

• Sex ratio M/F : 2,95 (118/40)

• Median age: 37 yrs ...
Age distribution: comparison of the different periods
          1991-94 versus 03/2003 - 02/2004

      years 1991- 94
Risk exposure within 6 months preceding the acute case
              Source : obligatory declaration 2003-04

• Source: ob...
Hépatites virales B: épidémiologie

- Vaccin mais 400 millions de porteurs
chroniques dans le monde
- 280 000 porteurs ch...
• FAMILLE : Hepadnaviridae, seul représentant humain

      - 7 jours dans l’...
                                              déterminant a
Ganem & Prince, NEJM 2004
Réplication du génome viral. Implication pour la
        persistance virale et l’intégration du génome viral
Modèles Animaux                    Chimpanzé


Modèles in vitro

• Polymerase virale                       • Culture cellulaire
   – DHBV : lysat réticulocytaire        ...
Cycle de réplication du VHB

Zoulim & Locarnini, Gastroenterology 2009
Comparative dynamics among three viruses
                           HIV              HCV               HBV
Infection à VHB et risque de CHC

• Etude de Beasley à Taiwan
   – risque relatif = 100 chez les porteurs de l'AgHBs
• Etu...
           DE L'HEPATITE B

• Co-incidence de répartition géographique
• Po...
HBV replication and its role in HCC development

                                          Wands, NEJM 2004
VHB                                     ...
Role du VHB dans l’oncogénèse hépatique

Ganem and Prince, NEJM 2004
                                               RÉPONSE IMMUNITAI...

Immune tolerance


  Fulminant hepatitis



Non cytolytic processes                           Turn-over of infected cells
TH1 cytokin...
Non cytolytic clearance of acute
 HBV infection in chimpanzee

                              Wieland S et al, PNAS 2004
Hepatocyte turn-over is required for clearance of
       viral infection in acute infection

Phase de tolérance immunitaire

Hépatocyte                          ...
Phase de clairance immune
                 (hépatite chronique)
Phase de rémission
               portage inactif de l’AgHBs
Clairance de l’AgHBs

Hépatocytes                     HBsAg -
non infectés
cccDNA levels in the different phases of
                                   chronic HBV infection
Histoire Naturelle de l’hépatite B
                             Infection aigue           Seeger, Zoulim, Mason;

• Système AgHBe /anti-HBe
  – distinction virus sauvage / virus muté AgHBe

• Virémie
• Incubation 1 à 6 mois
• Le plus souvent asymptomatique
    – Évolution plus fréquente vers la chronicit...
Laboratory Diagnosis of Acute Hepatitis B

                                                        HBsAg                 ...
• Définition
  – Persistance réplication virale à la 8ème
    semaine d’évolution :
  – AgHBe + ou AD...
• virus sauvage
  – tolérance immunitaire
  – rupture de toléranc...
Laboratory Diagnosis of Chronic Hepatitis B
                                                associated with wild type viru...
Laboratory Diagnosis of Transition of Chronic
                                                 Hepatitis B to The inactive...
Laboratory Diagnosis of HBeAg negative
                                                              Chronic Hepatitis B
             AgHBe +                              anti-HBe +
  1000                             ...
Dynamic ranges of quantification
                          of HBV DNA assays
                        10   102   103   104 ...
Formes cliniques
    – Complexes immuns circulants HBs/anti-HBs
    – Dépots artères moye...

• mère AgHBe +
  – transmission : 90%
• mère anti-HBe +
  – transmission : 10-20%
  – VHB m...
  – ALT normales ou subnormales
  – ADN-VHB > 1000 pg/ml
  – histologie : lé...
Histoire naturelle de l’infection chronique
            par le virus de l’hépatite B
                     en Alaska
• McMa...
Pathophysiologic Cascade of
                 Chronic HBV Infection
         HBV Replication
          HBV Replication     ...
Normal Aminotransferase Levels and
        Risk of Mortality from Liver Diseases
AgHBeAg et risque de CHC
   • 11,893 Taiwanese men; 92,359 person-years
Charge virale et incidence de la cirrhose
Survie chez les patients au stade cirrhose

              Patients Surviving, %
Charge virale et incidence du CHC

                        Chen et al; JAMA 2006
REVEAL-Incidence of HCC
                                  Increases with Increasing HBV DNA
High Baseline Serum HBV DNA Levels are
      Associated with Increased Risk of HCC Mortality
                in HBsAg-Posi...
Relationship Between Persistent Viremia and HCC:
                         Argument For Antiviral Therapy
           •     ...
Impact Clinique de la Variabilité
       du Génome Viral

• Multiplication virale
   » taux d'erreur de la transcriptase inverse
• Pression de sélect...

• SOUS-TYPES : acides aminés et déterminants HBs
   – boucle 139-147 -> det a
   – 122 -> de...
8 genotypes, numerous sub-genotypes, and
           recombinant forms



Génotypes VHB chez les patients atteints
                              d’hépatite chronique en France
Impact du génotype sur la

                                        déterminant a

 • Non nécessaire à la réplication du VHB
      – Culture cellulaire
      – Modèle...
           • codon stop / région pré-C
               TGG -> TAG en pos. 1896

               – géno...
HBeAg and Precore Mutation
                   G 1896A = stop codon, TAG

             ATG              ATG
Core gene

HBeAg and Precore Mutation

              ATG         ATG
Core gene

             1814       1901

              Precore  ...

1762-1764       1896
PROMOTEUR PRE-C                             C

   *        *     *
Main pre-c/core promoter mutations observed in vivo

                                                Basic core promoter
Sélection des mutants pré-core au cours de
 l’histoire naturelle de l’hépatite B chronique
                  AgHBe      An...
Outcome of Chronic Anti-HBe Positive Hepatitis B
                   Biochemical patterns in 164 untreated patients
Augmentation de prévalence des hépatites
     chroniques avec AgHBe négatif en France

                            62% ...
Pre-core mutations

  Both mutations                         No pre-core mutation
  (n = 95; 33.6%)                     ...
HBe serotype and pre-core mutations

                          80         HBe-positive
    • Italie
       – Cirrhose plus fréquente
HBe serotype and liver pathology

       • Lien de causalité :
           – Épidémies hépatites fulminantes

    I. Porteur inactif
    II. Exacerbation
Diagnosis of inactive carrier versus
 HBeAg negative chronic hepatitis
• Inactive Carrier
  – Persistently normal ALT leve...
  • Définition : poussée cytolytique
  ≠ réactivation vi...
Pichoud et al, J hepatol 2000

  HBeAg                  +        +          ...

Variants de l'Ag HBs

• échappement à la réponse humorale anti-HBs

   – naturelle

   – vaccination (transmission mère-e...

• Mutations ponctuelles dans le déterminant a de
 l'AgHBs (124-147)
   – aa 145 : Gly -> Arg
   – aa ...
Occult HBV Infection (OBI)

Presence of HBV DNA in the liver (± serum) of
individuals testing HBsAg negative by currently
How to Detect Occult HBV Infection

     Currently there is no standardized
  diagnostic assay for occult HBV infection
Reported Prevalence of Occult HBV Infection in HIV Positive Patients
Cause(s) for the
        failure of HBsAg detection

      OBI                “false” OBI

  Suppression of
HBV replication

                      HBV cccDNA                        Integrated HBV DNA

          HBV mutants   ...
Schematic representation of HBV serum marker profile in OBI and
                          “false” OBI

Occult hepatitis B
Torbenson M. & Thomas D.L., Lancet Inf Dis, 2002
Occult HBV infections: unresolved issues
  Specific                         ...
   Persistance virale
Resistance aux antiviraux
Monitoring des traitements
Immunotolerant              Immuno-active   Inactive phase                                      Occult infection
Endpoints of therapy

Persistence of high viral load is associated with a significant risk of progression of
Antivirals approved for hepatitis B

Drug Type                            Approved                Phase 3            Phase...
Treatment failure

Primary non response                        Secondary treatment failure
Partial response              ...
Clinical definition of resistance

• Virologic Breakthrough: Rebound in serum HBV DNA levels
  (e.g. 1 log10 above nadir)
Laboratory Definition of HBV Resistance to Antivirals

Laboratory Investigations
• Phenotypic Resistance: Decreased susce...
Kinetics of emergence of HBV drug resistant mutants

Si Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Loca...
Lamivudine Resistance Accelerates
           Progression of Liver Disease
25         Placebo (N=215)
           YMDDm (N=2...
Biochemical and Histologic
              Correlates of HBV Resistance
  • Rise in ALT levels
        – Mild ALT elevations...
ALT flares in patients with lamivudine
        resistance over time

                         Lok et al Gastroenterolog...
Incidence of drug resistance over time

                                          Resistance at year of therapy expressed ...
Zoulim & Locarnini, Gastroenterology, 2009
                   HBV                                                     HBV

   mitochondria                        deaminase

The HBV life cycle
                       receptor ?                                                                 Hepat...
Formation of the recalcitrant cccDNA: a difficult
     target for antiviral therapy

uncoating              CCC DNA       ...
Can we prevent cccDNA formation ?
Nucleoside analogs in monotherapy or
combination therapy cannot prevent the de
novo form...
Kinetics of Viral Loss During Antiviral Therapy with L-
      FMAU (clevudine) in the woodchuck model

ADV Associated Serum HBsAg Reductions are
 Similar in Magnitude to cccDNA Reductions
Immunohistochemical Staining of Patient Biopsies at
        Baseline and After 48 Weeks ADV Therapy

    Baseline      ...
Persistence of cccDNA after HBs seroconversion

                                         Maynard et al, J Hepatol 2005
Clearance of viral infection versus selection of
                escape mutants
The most important factors to consider:
§ ...
Kinetics of emergence of drug resistant virus
during antiviral therapy

  wt   ...
Kinetics of HBV drug resistance emergence
Partial response to adefovir dipivoxil is not due to the
                        selection of DR mutants
•       The top 2...
Amino acid substitutions result in conformation
  changes of the polymerase catalytic site
  Wild-type M204/L180          ...
Polymerase gene mutations may result in decreased
                inhibitory activity of antivirals

          wt polymera...
Definition of fitness

• A parameter that quantifies the adaptation of an
  organism or a virus to a given environment

• ...

Viral replication capacity in the presence of both
            antivirals (LAM + ADV)

Infectivity of the mutants in HepaRG cells
Impact of mutations in the overlapping S gene
            HDV hybrids with HBV ...
Archiving of viral variants
                                                                                   Viral quasi...
Archiving of viral variants
                                                                                    Viral quas...
Archiving of viral variants
                                                                                    Viral quas...
Phenotyping of HBV clinical isolates

Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Zoulim Hbv EpidéMio Marqueurs
Prochain SlideShare
Chargement dans…5

Zoulim Hbv EpidéMio Marqueurs

3 250 vues

Publié le

Publié dans : Santé & Médecine, Business
0 commentaire
0 j’aime
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Nombre de vues
3 250
Sur SlideShare
Issues des intégrations
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

Zoulim Hbv EpidéMio Marqueurs

  1. 1. Hépatite B Fabien Zoulim Département d’hépatologie & INSERM U871, Lyon
  2. 2. Guérison 30-50 ans VHB HCA cirrhose CHC Vaccin ANTIVIRAUX Antiviraux/IFN? IFN Niederau N Engl J Med 1996 & Liaw N Engl J Med 2004 RESISTANCE VIRALE Lee, N Engl J Med 1997; Lok, Hepatology 2001
  4. 4. EPIDEMIOLOGIE DE L'INFECTION A VHB AUX USA • Hépatites aigues – VHA : 40% – VHB : 30% – VHC : 20% • incidence : 300 000 infections à VHB / an • 30 000 nouveaux porteurs chroniques / an • 3 000 décès / an
  5. 5. MODES DE TRANSMISSION DU VHB • 1108 habitants de San Francisco • 159 (14%) anti-HBc + • positivité des anti-HBc associée avec – âge – éthnie – degré d'éducation – toxicomanie IV – prostitution – nombre de partenaires sexuels – homosexualité – HIV / HSV 2 / syphilis
  6. 6. MODES DE TRANSMISSION DU VIRUS DE L'HÉPATITE B EN EUROPE transfusions contact avec 2% porteur du VHB 4% personnels de santé sexuelle 2% homo hémodialysés 34% 11% 8% hétéro 23% inconnue 31% Asie drogue IV 26% Transmission verticale
  7. 7. Déclaration obligatoire de l’hépatite B en France : résultats des 12 premiers mois de notification Denise Antona, E Delarocque-Astagneau, D Lévy-Bruhl département des maladies infectieuses
  8. 8. Incidence of acute hepatitis B in France Sentinel networks 1991-1996 et Lyon (COURLY) 1983-1997
  9. 9. Circuit de l’information Feuillets 2 et 3 Médecin Biologiste à compléter prescripteur Feuillet 1 : Relance Feuillet 2 : parties 1-2 et parties 3-4-5 6-7 renseignées MISP de DDASS du complétées département d’exercice Feuillets 1 et 2 complétés et validés InVS Fiche de notification autocopiante à 4 feuillets Partie 1 : code d’anonymat irréversible, caractéristiques du patient Partie 2 : information biologique Parties 3-4-5 : information clinique et épidémiologique Parties 6-7 : identification du médecin prescripteur et du biologiste déclarants
  10. 10. Results 158 acute hepatitis cases • Hospital doctor in 64% cases • Sex ratio M/F : 2,95 (118/40) • Median age: 37 yrs for males, 36yrs for females • Jaundice : 69% • Hospitalisation : 46% • Fulminant hepatitis : 3 (2 death)
  11. 11. Age distribution: comparison of the different periods 1991-94 versus 03/2003 - 02/2004 years 1991- 94 n= 151 March 03- February 04 n= 158
  12. 12. Risk exposure within 6 months preceding the acute case Source : obligatory declaration 2003-04 • Source: obligatory declaration march 03- february 2004 N=145 – Sexual 59 40,6% No factor 43 29,6% – IVDU 9 6,2% >1 factor 38 26,3% – Invasive treatment 15 10,3% – Tatoo, piercing 5 3,4% • Sentinel networks 91-96 – Familial 14 9,7% N=195 – Perinatal 2 1,4% – sexual 35% – Live in instiution 11 7,6% – IVDU 19% – « percutaneous » 15% – Travel in endemic 21 14,5% – No factor 35% areas 91/145 patients (63 %) had a vaccine indication (2 vaccinated ≥ 3 doses)
  13. 13. Hépatites virales B: épidémiologie - Vaccin mais 400 millions de porteurs chroniques dans le monde - 280 000 porteurs chroniques en France (INVS) - 45% ignorent leur statut - 1 300 décès par an en France - 60 000 avec hépatite chronique active - Seulement 13 000 patients traités
  14. 14. VIROLOGIE
  15. 15. LE VIRUS DE L ’HEPATITE B • FAMILLE : Hepadnaviridae, seul représentant humain •VIRUS RESISTANT : - 7 jours dans l’environnement - pendant 5 mn à 100° 10 h à 60° C, C - à la congélation.
  16. 16. LE GÉNOME DU VIRUS DE L’HÉPATITE B déterminant a vaccin/IgHBs 8 génotypes A to H Gène pol antiviraux Mt du core Réponse CTL Tiollais Nature 1985 Mt pre-core Günther Adv Virus Res 1999 Réponse anti-HBe ? Norder J Gen Virol 2003
  17. 17. Ganem & Prince, NEJM 2004
  18. 18. Réplication du génome viral. Implication pour la persistance virale et l’intégration du génome viral Membrane cellulaire ARN pg ds DNA 10% virion ss DNA 90% intégration cccDNA illégitime RC DNA noyau virion cccDNA
  19. 19. Modèles Animaux Chimpanzé VHB HUMAIN Souris Transgéniques Souris SCID uPa Tupaia MARMOTTE (WHV) CANARD (DHBV) Summers PNAS 1978, Mason J Virol 1981, Chisari Science 1985, Petersen PNAS 1998
  20. 20. Modèles in vitro • Polymerase virale • Culture cellulaire – DHBV : lysat réticulocytaire – Transfection : lignées d’hépatome – HBV : baculovirus – Infection : hépatocytes primaires, HepaRG – Baculovirus ou adenovirus recombinant RC - L- Polymerase VHB DNA(-) DNA( U SS - ELONGATION CCC - Sells PNAS 1987, Wang Cell 1992, Zoulim J Virol 1994, Lanford J Virol 1995, Gripon PNAS 2002, Sprinzl J Virol 2001
  21. 21. Cycle de réplication du VHB Zoulim & Locarnini, Gastroenterology 2009
  22. 22. Comparative dynamics among three viruses HIV HCV HBV (Ritonav ir) (IFN- ) (Lamivu dine) Plasma virus Half-life 5.8 h 2.7 - 7.2 h 24 h Mea n viral 2.7 d 3.8 - 7.3 d 24.7 d genera tion time Daily t urnover 95% 94% - 99. 8% 50% Daily produ ction 10 10 (1.1 - 10 11 (plasm a) 12.7 )*10 11 Tot al load 1.2*1 0 9 (3.8 - 5.6)*10 10 2*10 11 Infecte d ce lls Half-life 1.6 d 2.4 - 4.9 d 10 - 10 0 d Mea n lifespan 2.3 d 3.5 - 7.1 d 23.3 d Daily t urnover 38% 13% - 25% 1% - 7% (Tsiang et al. Hepatology 1999)
  23. 23. Infection à VHB et risque de CHC • Etude de Beasley à Taiwan – risque relatif = 100 chez les porteurs de l'AgHBs • Etude de Tsukuma – risque cumumatif de CHC à 3 ans • 12,5% chez 240 patients avec cirrhose • 3,8% chez 677 patients avec hépatite chronique – risque x 7 si AgHBs + – risque X 4 si anti-HCV + • Facteurs associés : alcool, tabac, aflatoxine • Diminution incidence avec la vaccination de masse (Chen, NEJM 1995)
  24. 24. CARCINOME HEPATOCELLULAIRE ET VIRUS DE L'HEPATITE B • Co-incidence de répartition géographique VHB / CHC • Porteurs AgHBs : RR x 100 pour le CHC • CHC dans les modèles animaux de l'hépatite B : – marmotte – écureuil • Présence d'ADN viral intégré dans les tumeurs
  25. 25. HBV replication and its role in HCC development Wands, NEJM 2004
  29. 29. Ganem and Prince, NEJM 2004
  31. 31. IMMUNOPATHOLOGY OF HBV INFECTION CD8+ HBV Immune tolerance CD8+ HBV Clairance phase Chronic hepatitis HBV Seroconversion CD8+ Remission
  32. 32. Immunopathology Fulminant hepatitis HBV CD8+
  33. 33. MECHANISMS OF VIRAL CLEARANCE Non cytolytic processes Turn-over of infected cells TH1 cytokines with direct antiviral Immune mediated lysis of infected cells effect Transgenic mice Ducks Chimpanzees Woodchucks (Guidotti Science 1999, (Guo J Virol 1999 Thimme J Virol 2003) Summers PNAS 2003&2004) Antivirals Inhibition of viral DNA synthesis -> inhibition of intracellular recycling of cccDNA (Werle Gastroenterology 2004) Restoration of anti-HBV immune response (Boni Hepatology 2000)
  34. 34. Non cytolytic clearance of acute HBV infection in chimpanzee Wieland S et al, PNAS 2004
  35. 35. Hepatocyte turn-over is required for clearance of viral infection in acute infection Summers et al, PNAS 2003 & 2004
  36. 36. Phase de tolérance immunitaire Marqueurs Hépatocyte AgHBe + non infecté HBV DNA +++ ALAT = N Foie = N HBc/e Ag HBV Hépatocyte infecté
  37. 37. Phase de clairance immune (hépatite chronique) Marqueurs Hépatocyte AgHBe+ non infecté HBV DNA + CTL ALAT +++ Foie: Hépatite cytokines chronique perforine Fas HBc/e Ag HBV HLAI Hépatocyte infecté
  38. 38. Phase de rémission portage inactif de l’AgHBs Marqueurs Hépatocyte non infecté AgHBe- anti-HBe + HBV DNA < 104 /mL ALAT = N Foie = rémission HBs Ag Hépatocyte infecté Réactivation Virus sauvage Oncogénèse ou mt pre-core
  39. 39. Clairance de l’AgHBs Marqueurs Hépatocytes HBsAg - non infectés anti-HBc + Anti-HBs +/- HBV DNA - mais PCR + Hépatocytes infectés Mutants d’échappement Oncogénèse Infections occultes
  40. 40. cccDNA levels in the different phases of chronic HBV infection 10 3 10 4 cccDNA (copies/cell) Total HBV DNA 10 3 (copies/cell) 10 2 1 10 2 10 0 10 1 10 -1 10 0 10 -2 10 -1 10 10 -2 -3 10 10 -3 ) ) ) ) ) ) 63 18 10 (7 3) 18) 10 (7 ( ( ( - (6 -( ( - g + g- rs Ag g + g rs Ag eA eA rie BS eA ie B r H eA B rr BS HB H . Ca HB H .C a H ct t a ac In In • HBeAg+ patients had significantly higher cccDNA (90-fold) and total HBV DNA (147- fold) levels compared to HBeAg- patients. (p<0.001, Wilcoxon tests) Werle et al, Gastroenterology 2004
  42. 42. Histoire Naturelle de l’hépatite B Infection aigue Seeger, Zoulim, Mason; Guérison Fields Virology; 2007 5% nx-nés Infection chronique 90% adultes Hépatite chronique Virus sauvage (HBeAg+) Mutant pre-core (HBeAg-) Portage inactif Tolérance immunitaire Réactivation Cirrhose 30-50 ans Carcinome hépatocellulaire
  43. 43. MARQUEURS SEROLOGIQUES • Système AgHBe /anti-HBe – distinction virus sauvage / virus muté AgHBe négatif • Virémie – détection quantitative de l'ADN viral
  44. 44. HEPATITE B AIGUE • Incubation 1 à 6 mois • Le plus souvent asymptomatique – Évolution plus fréquente vers la chronicité • Prodromes: – Maladie sérique : arthralgies, urticaire, acrodermatite etc. .. • Formes ictériques : + graves que VHA et VHC – Durée de l’ictère : jusqu’à 4 mois • Evolution : chronicité 5 à 10% • Hépatites fulminantes
  45. 45. Laboratory Diagnosis of Acute Hepatitis B HBsAg Anti-HBs Ab 1000 IU/L and million copies/ml 900 HBeAg Anti-HBe Ab 800 ALT ALT and HBV DNA 700 Total anti-HBc 600 Symptoms 500 400 HBV DNA IgM anti-HBc 300 200 100 Normal 0 0 1 2 3 4 5 6 12 24 36 48 60 Months After Exposure Seeger, Zoulim, Mason, Fields Virology 2007
  46. 46. HEPATITE B PROLONGEE • Définition – Persistance réplication virale à la 8ème semaine d’évolution : – AgHBe + ou ADN-VHB + • Evolution – Chronicité : 8 cas / 10 • Traitement : IFN – Guérison : 7 à 8 cas / 10
  47. 47. INFECTIONS CHRONIQUES A VHB FORMES CLINIQUES • virus sauvage – tolérance immunitaire – rupture de tolérance -> lésions hépatocytaires : HCA – séroconversion anti-HBe spontanée (portage inactif) : 5-10% /an – > diminution significative réplication virale – > amélioration signes histologiques • virus muté pré-C (-) – sélection au moment de la séroconversion anti-HBe – dépend du génotype viral – immunopathologie ? – sévérité de l'hépatopathie : controversée – association au CHC
  48. 48. Laboratory Diagnosis of Chronic Hepatitis B associated with wild type virus infection HBsAg 800 HBeAg IU/L or million copies/ml 700 ALT and HBV DNA 600 500 HBV DNA 400 300 ALT 200 100 Normal 0 0 1 2 3 4 5 6 12 24 36 48 60 Months After Exposure Seeger, Zoulim, Mason, Fields Virology 2007
  49. 49. Laboratory Diagnosis of Transition of Chronic Hepatitis B to The inactive Carrier State 800 HBsAg `` IU/L and million copies/ml 700 HBeAg Anti-HBe 600 ALT and HBV DNA 500 400 HBV DNA 300 200 ALT 100 Normal 0 0 1 2 3 4 5 6 12 24 36 48 60 72 80 92 104 Months After Exposure Seeger, Zoulim, Mason, Fields Virology 2007
  50. 50. Laboratory Diagnosis of HBeAg negative Chronic Hepatitis B HBsAg HBeAg Anti-HBe IU/L and million copies/ml 450 400 ALT ALT and HBV DNA 350 300 250 200 HBV DNA 150 100 50 Normal ALT levels 0 0 3 6 9 12 15 18 21 24 27 30 33 36 39 42 45 48 Months Seeger, Zoulim, Mason, Fields Virology 2007
  51. 51. AgHBs UI/ml UI/ pg/ml pg/ AgHBe + anti-HBe + 1000 ALAT 9 log ADN- 8 log 100 VHB 7 log 10 6 log 1 hybridation 5 log 4 log 0,1 3 log 0,01 2 log PCR 0,001 1 log Tolérance hép chronique p. inactif mt pré-core VHB occulte
  52. 52. Dynamic ranges of quantification of HBV DNA assays 10 102 103 104 105 106 107 108 109 Amplicor HBV Monitor v2.0 (Roche) HBV Hybrid-Capture II (Digene) Ultra-sensitive HBV Hybrid-Capture II Versant HBV DNA 3.0 (bDNA, Siemens) Cobas Taqman HBV (Roche) RealArt HBV LC PCR (Artus Biotech) Abbot Real-time HBV (Abbott) Versant HBV DNA 1.0 (kPCR, Siemens)* *in development
  53. 53. Formes cliniques
  54. 54. MANIFESTATIONS EXTRAHEPATIQUES DU VHB • PAN – Complexes immuns circulants HBs/anti-HBs – Dépots artères moyens et petit calibre – Traitement : plasmaphéreses, corticoides, antiviraux (vidarabine / IFN / famciclovir / lamivudine) • Glomérulonéphrites • Cryoglobulinémies • Guillain-Barré • Myocardite
  55. 55. TRANSMISSION VERTICALE DU VHB • mère AgHBe + – transmission : 90% • mère anti-HBe + – transmission : 10-20% – VHB muté pré-C (-) : hépatites fulminantes • chronicité chez l’enfant : 90%
  56. 56. PRESENTATION CLINIQUE • INFECTION PERI-NATALE – ALT normales ou subnormales – ADN-VHB > 1000 pg/ml – histologie : lésions minimes • INFECTION POST-NATALE – ALT élevées – ADN-VHB < 1000 pg/ml – histologie : hépatite modérée à sévère • CARCINOME HEPATOCELLULAIRE : 30 ANS
  57. 57. Histoire naturelle de l’infection chronique par le virus de l’hépatite B en Alaska • McMahon BJ, Ann Intern Med 2001;135(9):759-68 • 1536 natifs d’Alaska : 641 AgHBe+, 83 anti-HBe+ • Probabilité d’éliminer l’Ag HBe à 10 ans : 72,5 %. • Elimination de l’Ag HBs chez 106 porteurs chroniques du VHB (7 %) • Incidence des événements cliniques: 2,3/1000 porteurs/année • Incidence du CHC: 1,9/1000 porteurs/année (2,3 chez l’homme; 1,2 chez la femme).
  58. 58. Pathophysiologic Cascade of Chronic HBV Infection HBV Replication HBV Replication Liver Liver (Measured by (Measured by Inflammation Inflammation Serum HBV DNA) Serum HBV DNA) ALT ALT Elevation Elevation Worsening Histology Worsening Histology Disease Progression Disease Progression • Necroinflammation • Necroinflammation • Liver Failure • Liver Failure • Fibrosis • Fibrosis • Liver Cancer • Liver Cancer • Cirrhosis • Cirrhosis • Transplant • Transplant • Death • Death Adapted from: Lavanchy D. Journal of Viral Hepatitis, 2004, 11, 97–107. Chen JC, et al. JAMA. 2006;295:65-73. Iloeje U. H, et al. Gastroenterology. 2006;130:678-86.
  59. 59. Normal Aminotransferase Levels and Risk of Mortality from Liver Diseases 59.0 >100 30.0 50-99 19.2 Elevated 40-49 9.5 ALT 30-39 2.9 20-29 Normal 1.0 <20 0 10 20 30 40 50 60 70 80 90 • Korea Medical Insurance Corporation Risk ratio (95% CI) – 94,533 men; 47,522 women – 35-59 yrs old – Relative risk for liver mortality compared with AST and ALT <20 IU/l Kim HC et al. BMJ 2004; 328:983 al. 2004;
  60. 60. AgHBeAg et risque de CHC • 11,893 Taiwanese men; 92,359 person-years follow-up 12 Cumulative incidence (%) HBsAg+ 10 HBeAg+ 8 6 4 HBsAg+, HBeAg - 2 0 HBsAg -, HBeAg - 0 2 4 6 8 10 Year Yang et al. N Engl J Med. 2002;347:168-174.
  61. 61. Charge virale et incidence de la cirrhose .4 P <0.001 Incidence cumulative de cirrhose 37.1% 1.0 x 106 n=627 1.0-9.9x105 n=344 n=3774 1.0-9.9x104 n=649 .3 300-9.9x103 n=1210 <300 n=944 23.0% .2 .1 10.0% 6.3% 5.2% 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 Année de suivi R.E.V.E.A.L. – HBV Study Iloeje UH et al. Gastroenterology 2006; 130: 678-686
  62. 62. Survie chez les patients au stade cirrhose 100 Patients Surviving, % 80 60 Cirrhosis1 55% (n = 130) 40 20 Decompensated cirrhosis2 14% (n = 21) 0 0 1 2 3 4 5 Years 1. Weissberg et al. Ann Intern Med. 1984;101:613. 2. De Jongh et al. Gastroenterology. 1992;103:1630.
  63. 63. Charge virale et incidence du CHC Chen et al; JAMA 2006
  64. 64. REVEAL-Incidence of HCC Increases with Increasing HBV DNA 20% Baseline Viral Level % cumulative incidence of HCC 14.9% 15% 12.2% 10% 5% 3.6% 1.3% 1.4% 0% <300 >300 - 103 > 103 - 104 >104 - 106 ≥106 Baseline HBV DNA (copies/mL) Chen JC, et al. JAMA. 2006;295:65-73.
  65. 65. High Baseline Serum HBV DNA Levels are Associated with Increased Risk of HCC Mortality in HBsAg-Positive Patients HBV DNA Negative 100% HBV DNA Low 96% < 105 copies/mL copies/ RR = 1.7 (0.5-5.7) (0.5-5.7) 92% 88% HBV DNA High ≥ 105 copies/mL copies/ p < 0.001 across viral RR = 11.2 (3.6-35.0) (3.6-35.0) 84% categories 80% 0 1 2 3 4 5 6 7 8 9 10 11 12 Survival time (Years) http://www.fccc.edu/docs/sci_report/Evans.pdf#search=%22haimen. Accessed 1/23/07. Chen G, et al. J Hepatology 2005; 42 (suppl 2):477A. Chen G, et al. Hepatology 2005; 40 (suppl 1):594A.
  66. 66. Relationship Between Persistent Viremia and HCC: Argument For Antiviral Therapy • Persistent replication associated with greater risk of HCC • Decreased risk when viral replication declines Rate Per 100,000 HCC Incidence 1.2x104 10,108 1.0x104 8730 8.0x103 5882 6.0x103 4.0x103 1473 2.0x103 0 Baseline HBV DNA, (copies/mL) < 104 ≥105 ≥105 ≥105 Follow-up HBVDNA, copies/mL --- < 104 104 to <105 ≥105 Adjusted RR 1.0 3.6 6.9 9.1 (95% CI) (ref) (1.7-7.6) (3.4-13.8) (5.8-14.1) P Value -- < 0.001 < 0.001 < .001 Chen, et al. JAMA 2006
  67. 67. Impact Clinique de la Variabilité du Génome Viral
  68. 68. VARIABILITE GENETIQUE DU VHB • Multiplication virale » taux d'erreur de la transcriptase inverse • Pression de sélection » réponse immunitaire cellulaire / humorale » antiviraux -> possibilité de variants d'échappement • Conséquences cliniques » diagnostic sérologique » traitements antiviraux
  69. 69. VARIABILITE GENETIQUE DU VHB • SOUS-TYPES : acides aminés et déterminants HBs – boucle 139-147 -> det a – 122 -> det d ou y – 127 -> det w1-4 – 160 -> det w ou r • GENOTYPES : variabilité de séquence génomique – du génome complet : 8% – du gène S : 4% – 8 génotypes A à H • MUTANTS DU VHB – mutations ponctuelles / délétions / insertions
  70. 70. 8 genotypes, numerous sub-genotypes, and recombinant forms B6 D1 World J Gastroenterol 2007; 13: 14-21
  71. 71. Génotypes VHB chez les patients atteints d’hépatite chronique en France 37.4% 100 90 30.2% 80 Number of subjects 70 60 50 40 12.5% 11.3% 30 7.9% 20 10 1.1% 0.4 % 0 A B C D E F G Zoulim et al J Viral Hepatitis 2006
  72. 72. Impact du génotype sur la séroconversion PEG-IFN a-2b PEG-IFN a-2b HBeAg Loss 1 HBsAg Loss 2 47% 50 21 Percentage of patients (%) Percentage of patients (%) 44% 18 40 15% 15 28% 30 25% 12 20 9 8% 6 5% 10 3 0% 0 0 A B C D A B C D n=90 n=23 n=39 n=103 n=90 n=23 n=39 n=103 HBV genotype HBV genotype 1 Janssen, Lancet 2005; 2 Flink, Am J Gastro 2006
  73. 73. LES MUTANTS DU GÉNOME DU VHB déterminant a vaccin/HBIg polymérase antiviraux Mt core Réponse CTL Mt pré-core Réponse anti-e ?
  74. 74. ROLE DE LA RÉGION PRÉ-C ET DE L’AgHBe • Non nécessaire à la réplication du VHB – Culture cellulaire – Modèles in vivo • Marmotte • Canard • Modulation de la réponse immune – Tolérogène : souris transgéniques – Cible de la réponse anti-capside Chang et al, J. Virol 1987; Schlicht et al J. Virol 1987; Chen J. Virol 1992; Millich et al PNAS
  75. 75. LES MUTANTS PRÉ-C (-) • codon stop / région pré-C TGG -> TAG en pos. 1896 – génotypes B à E (A : exceptionnel) – arrêt traduction protéine pré-C/C – AgHBe négatif • mutation dans promoteur pré-C TTAAAGG -> TTAATGA en pos. 1762 /1764 – génotypes A à E – transcrits pré-C/C : – synthèse d'AgHBe : Carman et al Lancet 1989, Okamoto et al J Virol 1990/1994, Tong et al Virology 1990
  76. 76. HBeAg and Precore Mutation G 1896A = stop codon, TAG ATG ATG Core gene 1814 1901 Precore Core region region HBcAg Virion HBeAg Serum
  77. 77. HBeAg and Precore Mutation ATG ATG Core gene 1814 1901 Precore Core region region HBcAg Virion HBeAg Serum
  78. 78. VARIANTS NÉGATIFS POUR L ’AgHBe 1762-1764 1896 PROMOTEUR PRE-C C * * * TAG mRNA Protéine pré-C/C arrêt des synthèses protéiques Diminution de l’expression de l ’AgHBe
  79. 79. Main pre-c/core promoter mutations observed in vivo Basic core promoter LEF Pre-C mRNA AGGTCA HNF4 1762 64 66 68 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCATAAATT TGA TTA GGTTAATNATTA HNF1 TTG HNF3 WTRTTKRY Deletion 63-70 Insertion (RGTTAATYATTA) at 74/75 Insertion (TTG) at 66/67 Mutation AGG to TCA and insertion TA at 65/66
  80. 80. Sélection des mutants pré-core au cours de l’histoire naturelle de l’hépatite B chronique AgHBe Anti-HBe ALAT 2500 ADN-VHB 2000 1500 1000 500 0 temps 100 sauvage 80 60 Mt pré-C 40 20 0 temps
  81. 81. Outcome of Chronic Anti-HBe Positive Hepatitis B Biochemical patterns in 164 untreated patients after 23 months (range 12-36) monthly monitoring 400 With flares and normalization 73 pts 300 ( 44.5% ) 200 100 Asymptomatic flare-up: 0 90% of cases 400 A Without flares 59 pts 300 L ( 36.0% ) 200 Flare-up yearly T 100 frequency: once 57.1% 0 twice 20% < once 22.8% With flares and without normalization 400 32 pts 300 ( 19.5% ) 200 100 0 0 12 24 months Brunetto MR et al, J Hepatol 2002
  82. 82. Augmentation de prévalence des hépatites chroniques avec AgHBe négatif en France 62% 48% HBeAg(+) N=119 HBeAg(-) N=164 Zoulim et al, J Viral Hepatitis 2006
  83. 83. Pre-core mutations Both mutations No pre-core mutation (n = 95; 33.6%) (n = 42; 14.8%) Data unavailable (n = 12; 4.2%) Stop codon mutation (n = 55; 19.4%) Promoter mutation (n = 99; 27.9%) Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
  84. 84. HBe serotype and pre-core mutations 90 80 HBe-positive Number of subjects 70 HBe-negative 60 50 40 30 20 10 0 No pre-core Stop codon Promoter Both mutation mutation mutation mutations Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
  85. 85. MUTANTS PRÉ-C ET SÉVÉRITÉ HISTOLOGIQUE LA CONTROVERSE • Italie – Cirrhose plus fréquente • Bonino Gastroenterology 1986, Fattovich Hepatology 1988 • France – Activité idem / cirrhose plus fréquente • Zarski et al, J Hepatol 1993 • Grandjacques et al, J Hepatol 2000 • Zoulim et al, J Viral Hepatitis 2006 • Asie – Mt promoteur : activité histologique et fibrose plus importante – Mt pré-C : activité histologique moins importante • Lindh et al, J Infect Dis 1999 – Rémission histologique • Chan et al, Hepatology 1999 • Afrique – Mt promoteur : plus fréquents dans le CHC • Baptista et al, Hepatology 1999
  86. 86. HBe serotype and liver pathology HBe-positive HBe-negative 70 70 Number of subjects 60 60 50 50 40 40 30 30 20 20 10 10 0 0 0-4 5-9 10-14 15-22 ≤ F2 F3 F4 Knodell score Metavir score Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
  87. 87. HÉPATITES FULMINANTES ET MUTANTS PRE-C • Lien de causalité : – Épidémies hépatites fulminantes – Transmission souche mutée pré-C (-) – Rôle immunomodulateur de l ’AgHBe • Pas de lien de causalité – Séquençage génome complet – Pas de profil commun de mutation • Sélection des mutants par la réponse immunitaire cytotoxique dirigée contre la souche à l ’origine de l ’HF Stuyver et al, Hepatology 1999, Sternbeck et al Hepatology 1996, Liang et al, NEJM 1991
  88. 88. DIAGNOSTICS DIFFICILES I. Porteur inactif II. Exacerbation
  89. 89. Diagnosis of inactive carrier versus HBeAg negative chronic hepatitis • Inactive Carrier – Persistently normal ALT levels – Persistently low levels of serum HBV DNA • Threshold : 2,000 IU/ mL ? • HBeAg negative chronic hepatitis – Fluctuation / exacerbation of ALT – Fluctuations of HBV DNA levels usually below 6 log IU/ mL – Presence of pre-core / core promoter mutations
  90. 90. DIAGNOSTIC D'UNE EXACERBATION AIGUE SUR HEPATITE B CHRONIQUE • Définition : poussée cytolytique ≠ réactivation virale • Ag HBe + initialement – rupture de tolérance immunitaire – séroconversion anti-HBe – très fréquent chez patients asiatiques • Anti-HBe + initialement – réactivation virus sauvage : -> AgHBe + – réactivation virus muté pré-C (-) – corticothérapie – surinfection delta / VHC
  91. 91. Pichoud et al, J hepatol 2000 interferon HBeAg + + - - - - + - Anti-HBe Ab - + + + + + - + 25 10000000000 1000000000 20 100000000 10000000 15 1000000 case#6 10 100000 10000 ALT Genotype A 1000 pre-S1 5 100 bDNA 10 PCR 0 1 months 0 1 2 5 9 12 13 16 pre-C promoter WT - - + + - + MT + + + - + - pre-C region WT + + + + + + M2 - - - - - - M4 - - - - - - M2+M4 - - - - - -
  92. 92. PreS2 PreS1 Pol S HBs Ag 0/3221 GR E Brin(-) 3,2kb Brin(+) 2,4kb SHBs (S) TATAA MHBs (preS2+S) « a » determinant U5-like DR1 Enh2 Enh1 C DR2 LHBs (preS2+preS2+S) S-S sP120T Pré-C X 137 S- S 138 149 107 S-S S-S 147 139 sG145R sD144H/A/E 99 NH2 S-S COOH « a » determinant induces the synthesis of anti-HBs neutralizing antibodies Tiollais P. et al., Nature 1985. Torresi J., J. Clin Virol 2002; Dryden KA. et al., Mol Cell 2006
  93. 93. Variants de l'Ag HBs • échappement à la réponse humorale anti-HBs – naturelle – vaccination (transmission mère-enfant) – immunoprophylaxie (transplantation hépatique) • infection active malgré Ac anti-HBs • sérologie AgHBs faussement négative á Risques : transmission virale + infections occultes
  94. 94. VARIANTS DE L'AgHBs • Mutations ponctuelles dans le déterminant a de l'AgHBs (124-147) – aa 145 : Gly -> Arg – aa 126 : Ile -> Ser / Thr -> Asn • transmission mère-enfant malgré la serovaccination (3%) • infection du greffon hépatique malgré Immunoglobulines anti-HBs • hépatites chroniques avec anti-HBc et anti-HBs +
  95. 95. Occult HBV Infection (OBI) Presence of HBV DNA in the liver (± serum) of individuals testing HBsAg negative by currently available assays Raimondo et al, J Hepatol 2008
  96. 96. How to Detect Occult HBV Infection Currently there is no standardized diagnostic assay for occult HBV infection
  97. 97. Reported Prevalence of Occult HBV Infection in HIV Positive Patients Occult Study Country N° of HBV Methods patients N° (%) Hofer, 1998 Switzerland 57 51 (89%) “nested” PCR (serial evaluation) Torres-Baranda, 2006 Mexico 35 7 (20%) “nested” PCR Filippini, 2006 Italy 86 17 (20%) single step PCR Mphahlele, 2006 South Africa 140 31 (22.%) “nested” PCR Pogany, 2005 Netherlands 93 4 (4%) single step PCR Neau, 2005 France 160 1 (0.6%) Cobas Amplicor HBV Monitor (Roche) Santos, 2003 Brazil 101 16 (16%) single step PCR Wagner, 2004 France 30 11 (37%) “nested” PCR Goncales, 2003 Brazil 159 8 (5%) “nested” PCR Nunez, 2002 Spain 85 0 Cobas Amplicor HBV Monitor (Roche) Piroth, 2000 France 37 13 (35%) single step PCR Raffa, 2007 Italy 101 42 (41%) “nested” PCR (liver) Raimondo et al, J Hepaol 2007, modified
  98. 98. Cause(s) for the failure of HBsAg detection OBI “false” OBI Suppression of Infection by HBV replication and S gene Variants gene expression
  99. 99. HBV replication HBV cccDNA Integrated HBV DNA HBV mutants Epigenetic control Immune surveillance Viral co-infections Occult HBV infection
  100. 100. Schematic representation of HBV serum marker profile in OBI and “false” OBI OBI „false“ OBI HBV DNA levels < 200 UI/ml Seropositive S gene S gene Seropositive Seronegative Seronegative escape mutants escape mutants Primary occult HBV DNA levels HBsAg lost HBsAg lost Primary occult comparable to after AH after AH overt infection HBsAg lost HBsAg lost Progressive antibody Progressive antibody during CH during CH disappearence disappearence
  101. 101. Occult hepatitis B Torbenson M. & Thomas D.L., Lancet Inf Dis, 2002
  102. 102. Occult HBV infections: unresolved issues Diagnostic Specific To be treatments ? improved High Tools ? prevalence Co-infections ? Therapy? ROLE Worsen HCV in infection ? HCC Not fully understood ?
  103. 103. Antiviraux Persistance virale Resistance aux antiviraux Monitoring des traitements
  104. 104. HBsAg Immunotolerant Immuno-active Inactive phase Occult infection Reactivation phase phase phase Low replication HBeAg(+) HBeAg(-) / anti-HBe(+) HBV DNA 109-1012 IU/mL >2000-<109 IU/mL <2000 IU/mL >2000 IU/mL ALAT Minimal CH Moderate to severe CH Remission Moderate to severe CH Cirrhosis Inactive cirrhosis Cirrhosis Treatment indicated Treatment indicated Adapted from Fattovich G. Sem Liver Dis. 2003
  105. 105. Endpoints of therapy Persistence of high viral load is associated with a significant risk of progression of the liver disease and of HCC Aim of antiviral therapy: HBV DNA < 10-15 IU/mL by real-time PCR assays Viral suppression No replication = Histological and clinical No resistance improvement Chen CJ, et al. JAMA 2006. Iloeje UH, et al. Gastroenterology 2006. Chen C, et al. Am J Gastroenterol 2006. Zoulim & Perrillo J Hepatol 2008. Zoulim & Locarnini Gastroenterology 2009
  106. 106. Antivirals approved for hepatitis B Drug Type Approved Phase 3 Phase 2 Nucleoside analogs • Lamivudine* • Emtricitabine* • Elvucitabine • Entecavir • Clevudine** • Valtorcitabine • Telbivudine • Amdoxovir • Racivir • LB80380 Nucleotide analogs • Adefovir dipivoxil • Alamifovir • Tenofovir* • Pradefovir Cytokines • Interferon alfa • Pegylated Interferon alfa-2a *Currently approved for HIV **development on hold
  107. 107. Treatment failure Primary non response Secondary treatment failure Partial response Antiviral drug resistance Host factors Drug factors Drug metabolism Barrier to resistance Patient’s compliance Viral factors Drug factors Resistant mutants Antiviral potency Zoulim & Perrillo J Hepatol 2008; EASL CPG J Hepatol 2009
  108. 108. Clinical definition of resistance • Virologic Breakthrough: Rebound in serum HBV DNA levels (e.g. 1 log10 above nadir) • Genotypic Resistance: Detection of mutations known to confer resistance while on therapy • Virologic Breakthrough with Genotypic Resistance: Viral rebound associated with a mutation(s) known to cause resistance. • Primary non response: <1log10 decrease of viral load after 3 months • Partial response: detectable HBV DNA levels during therapy Zoulim & Perrillo, J Hepatol 2008; EASL CPG, J Hepatol 2009
  109. 109. Laboratory Definition of HBV Resistance to Antivirals Laboratory Investigations • Phenotypic Resistance: Decreased susceptibility (in vitro testing) to inhibition by anti-viral drugs associated with genotypic resistance. • Cross Resistance: Mutants selected by one agent that also confer resistance to other antiviral agents Zoulim et al; Future Virology 2006
  110. 110. Kinetics of emergence of HBV drug resistant mutants Si Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Locarnini et al Antiviral Therapy 2004; Villet et al Gastroenterology 2006 J Hepatol 2007 & 2008; Pallier et al J Virol 2007; Yim et al Hepatology 2006.
  111. 111. Lamivudine Resistance Accelerates Progression of Liver Disease 25 Placebo (N=215) YMDDm (N=209) (49%) Placebo 21% 20 Wild Type (N=221) 15 YMDDm 13% 10 WT 5% 5 0 0 6 12 18 24 30 36 Time after randomization (Months) Liaw YF et al. N Engl J Med. 2004;351:1521-1531
  112. 112. Biochemical and Histologic Correlates of HBV Resistance • Rise in ALT levels – Mild ALT elevations in most cases – ALT flares with acute exacerbations and liver failure: especially patients with liver cirrhosis and/or pre-core mutant infection • Progression of liver disease – Progressive worsening of liver histology – Clinical deterioration, liver decompensation, HCC development Lai et al Clin Infect Dis 2003; 36: 687-696; Dienstag et al Gastroenterology 2003;124:105-117 ; Lok et al Gastroenterology 2003; 125 : 1714-1722; Hadziyannis et al Hepatology 2000;32:847-851; Si Ahmed et al Hepatology 2000; Zoulim et al J Viral Hepatitis 2006;13:278-288 ; Fung et al J Hepatol 2005;43:937-943; Liaw et al NEJM 2004;351:1521-1531.
  113. 113. ALT flares in patients with lamivudine resistance over time Lok et al Gastroenterology 2003; 125 : 1714-1722
  114. 114. Incidence of drug resistance over time Resistance at year of therapy expressed as percentage of patients Drug and patient population 1 2 3 4 5 6 Lamivudine 23 46 55 71 80 - Telbivudine HBeAg-Pos 4.4 21 - - - - Telbivudine HBeAg-Neg 2.7 8.6 - - - - Adefovir HBeAg-Neg 0 3 6 18 29 - Adefovir (LAM-resistant) Up to 20% - - - - - Tenofovir 0 0 0 - - - Entecavir (naïve) 0.2 0.5 1.2 1.2 1.2 1.2 Entecavir (LAM resistant) 6 15 36 46 51 57 CL Lai Clin Infect Dis 2003; CL Lai NEJM 2007; Hadzyiannis Gastroenterology 2006; Marcellin NEJM 2008; CL Lai & Chang NEJM 2006; Zoulim & Locarnini Gastroenterology 2009
  115. 115. Zoulim & Locarnini, Gastroenterology, 2009
  116. 116. HBV HBV HBV HBV hepatocytes hepatocytes viral polymerase spontaneous cccDNA long half-life infected cells long mutant archiving error rate half-life mutant wild type defective immune response viral quasi- viral species persistence host host selective pressure selection of selection of antivirals or others escape mutants escape mutants replication fitness replication space immune response drug pharmacodynamics Virus spread in the treatment failure liver + Zoulim et al., Gastroenterology 2009 Disease progression / HCC development
  117. 117. L(-)-SddU mitochondria deaminase L(-)-SddC, 3TC Mt DNA L(-)-SddC-TP L(-)-SddC Lamivudine kinase L(-)-SddC-TP HBV DNA nucleus L(-)-SddC-TP cytoplasm Nuclear DNA Bridges; Progress in Liver Disease 1995
  118. 118. The HBV life cycle receptor ? Hepatocyte Virion polymerase interaction entry Nucleus cccDNA formation transcription pgRNA AAA AAA AAA AAA RC DNA cccDNA mRNA cccDNA amplification translation DNA (+) DNA (-) pgRNA ER (+) strand encapsidation synthesis reverse transcription ER virion secretion viral proteins secretion HBsAg Nucleoside analogs HBeAg Zoulim et al Future Virology 2006
  119. 119. Formation of the recalcitrant cccDNA: a difficult target for antiviral therapy uncoating CCC DNA supercoiled DNA minichromosome topoisomerase? removal of protein primer Acetyl transferase ? Histones removal of RNA primer completion of viral (+) strand DNA ligation of DNA strands extremities Antivirals ? viral polymerase? Tuttleman et al Cell 1986 DNA repair protein? Le Guerhier et al AAC 2000 other cellular enzymes? Delmas et al AAC 2002 Kock et al Hepatology 2003
  120. 120. Can we prevent cccDNA formation ? Nucleoside analogs in monotherapy or combination therapy cannot prevent the de novo formation of cccDNA in hepatocyte culture and in vivo in animal experiments (Delmas et al AAC 2000; Seigneres et al AAC 2002) Can we clear cccDNA from a chronically infected cell ? The decrease of intrahepatic cccDNA during nucleoside analog requires hepatocyte turn over in animal experiments (Zhu et al J Virol 2001; Litwin et al J Clin Virol 2005)
  121. 121. Kinetics of Viral Loss During Antiviral Therapy with L- FMAU (clevudine) in the woodchuck model Zhu et al, J Virol 2001
  122. 122. ADV Associated Serum HBsAg Reductions are Similar in Magnitude to cccDNA Reductions Serum Total 0 HBV Intracellular cccDNA Serum Changes in HBV Markers (log 10 copies/cell(ml)) DNA DNA HBsAg -1 from Baseline -2 -3 -4 -5 -6 48 weeks of ADV resulted in significant reductions in : serum HBV DNA > total intrahepatic HBV DNA > cccDNA Changes in HBsAg levels correlated with cccDNA changes -> 14 years of therapy to clear completely viral cccDNA Werle et al, Gastroenterology 2004
  123. 123. Immunohistochemical Staining of Patient Biopsies at Baseline and After 48 Weeks ADV Therapy Baseline Week 48 • 0.8 log10 (84%) decline in cccDNA, not paralleled by a similar decline in the number of HBcAg+ cells • Suggests cccDNA depleted primarily by non-cytopathic mechanisms or that cell turn-over occurred but was associated with infection of new cells during therapy
  124. 124. Persistence of cccDNA after HBs seroconversion Maynard et al, J Hepatol 2005
  125. 125. Clearance of viral infection versus selection of escape mutants The most important factors to consider: § The rate of immune killing of infected hepatocytes § The rate of replication and spread of mutant virus in the chronically infected liver (I.e. fitness of the virus: the rate of spread to uninfected hepatocytes) § Small changes in these factors may have profound effect on whether treatment response is durable or subject to rapid rebound (Litwin et al J Clin Virol 2005) § These factors may be subject to therapeutic intervention
  126. 126. Kinetics of emergence of drug resistant virus during antiviral therapy Lamivudine wt mt X X X X X • Free liver space X • Mutant fitness X ni I II III IV INHIBITION OF WILD TYPE VIRUS REPLICATION DELAYED EMERGENCE OF DRUG RESISTANT VIRUS Zhou et al AAC 1999
  127. 127. Kinetics of HBV drug resistance emergence Drug-susceptible virus Treatment begins Naturally—occurring viral variants Drug-resistant variant Secondary resistance mutations HBV replication / compensatory resistance mutations Primary resistance mutations Time Si Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Locarnini et al Antiviral Therapy 2004; Villet et al Gastroenterology 2006 J Hepatol 2007 & 2008; Pallier et al J Virol 2007; Yim et al Hepatology 2006.
  128. 128. Partial response to adefovir dipivoxil is not due to the selection of DR mutants • The top 25% patients (quartile 1): > 4.91 log10 reduction in serum HBV DNA at week 48. • In Q2: 3.52 to 4.90 log10 reduction of viral load. • In Q3: 2.22 to 3.51 log10 reduction in viral load. • The bottom 25% of patients (Q4):< 2.22 log10 reduction in HBV DNA levels at week 48. • Phenotypic analysis of viral strains: Q4 as sensitive to ADV as Q1 strains • Documented Drug Compliance (% of days without taking ADV) Virological Response Virological Response Virological Response Virological Response Q1 (best response) Q2 Q3 Q4 (worse response) (n=38) (n=38) (n=38) (n=38) Median 99% 99% 99% 97% a range 86-100% 41*-100% 91-100% 70-100% • Wilcoxon rank sum test, P=0.01 Durantel et al, Antiviral Therapy, 2008
  129. 129. Amino acid substitutions result in conformation changes of the polymerase catalytic site Wild-type M204/L180 LVDr M204V/L180M L180 L180M M204 M204V LVD-TP LVD-TP LVDr M204V/L180M M204V reduces pocket size L180M Steric clash between lamivudine and V204 M204V Minimal steric clash between entecavir and ETV-TP V204 Langley DR, et al. J Virol. 2007;81:3992-4001.
  130. 130. Polymerase gene mutations may result in decreased inhibitory activity of antivirals wt polymerase 3TC-R polymerase PMEA-R polymerase 3TC+PMEA-R polymerase Drug IC50 (µM) P IC50 (µM) P IC50 (µM) P IC50 (µM) P Elongation FLG-TP 4 ± 0.9 5.43 ± 0.6 7.8 ± 1.9 6.33 ± 1.3 3TC-TP 10.75 ± 4.8 <0.05 >100 <0.05 14 ± 5.7 <0.05 >100 <0.05 PMEA-DP 2.8 ± 0.3 >0.05 0.9 ± 0.1 <0.05 49.5 ± 3.4 <0.05 16.5 ± 7.2 <0.05 Jacquard et al, Antimicrob Agents Chemother 2006
  131. 131. Definition of fitness • A parameter that quantifies the adaptation of an organism or a virus to a given environment • For a virus, ability to produce infectious progeny relative to a reference viral clone, in a defined environment Esteban Domingo, In Fields Virology 2007
  132. 132. HBIg adefovir lamivudine wt Mutant #1 Mutant #2 Mutant #3 Mutant #4 Polymerase clonal genetic analysis Polymerase gene mutations Surface gene mutations wt none none mutant #1 T128I; V173L; L180M; A181V; N236T F20S; P120S; E164D; L173F mutant #2 T128I; V173L; L180M; A181V; M204V R79H; P120S; E164D; L173F; I195M; Y206F mutant #3 ∆111-120; T128I; V173L; L180M; A181V F20S; ∆102-111; P120S; E164D; L173F mutant #4 T128I; V173L; L180M; A181V; M204V; L220I; N236T P120S; E164D; L173F; I195M Villet et al, Gastroenterology 2006
  133. 133. Viral replication capacity in the presence of both antivirals (LAM + ADV) 400 Mutant replication capacity / wt (%) 350 300 250 200 150 100 50 0 wt #1 #2 #3 #4 Mutant Villet, Billioud et al, Gastroenterology 2008
  134. 134. Infectivity of the mutants in HepaRG cells Impact of mutations in the overlapping S gene HDV hybrids with HBV mutant envelopes HDV replication in HepaRG cells as a reporter of infection Mutant A wt #1 #2 #3 #4 1,7 kb B Mutant infectivity / wt (%) 120 100 80 60 40 20 0 wt #1 #2 #3 #4 Mutant Villet, Billioud et al, Gastroenterology 2008
  135. 135. Archiving of viral variants Viral quasispecies Liver Majority population Minority variants Resistant variants cccDNA variants • cccDNA in the liver: – Is propagated during the normal replication cycle of HBV – Can serve as a template for the production of new virus Blood circulation Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
  136. 136. Archiving of viral variants Viral quasispecies Liver Majority population Minority variants Resistant variants cccDNA variants • cccDNA in the liver: – Is propagated during the normal replication cycle of HBV – Can serve as a template for the production of new virus • It is believed that viral variants with antiviral resistance may be archived in this way Blood circulation Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
  137. 137. Archiving of viral variants Viral quasispecies Liver Majority population Minority variants Resistant variants cccDNA variants • cccDNA in the liver: – Is propagated during the normal replication cycle of HBV – Can serve as a template for the production of new virus • It is believed that viral variants with antiviral resistance may be archived in this way Blood circulation Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
  138. 138. Phenotyping of HBV clinical isolates Cl ne A in o ra Southern blot Cl e D Cl e C eE Cl A Cl b St e on on on on analysis La Whole genome HBV clones PCR Transfection cloning Patient HepG2 serum Huh7 lamivudine adefovir Cell culture plate RC - Wild-type virus SS - Patient’s Fold resistance virus IC50 mutant = IC50 reference strain Increasing antiviral concentration 1. Durantel D, et al., Hepatology, 2004;40:855-64. 2. Yang H, et al., Antiv Ther, 2005;10:625-33.
