MICROBIAL BIOTECHNOLOGY

Microbial Biotechnology AND GENETIC
ENGINEERING
• PANKAJ BHATT
• RESEARCH SCHOLAR
• MICROBIOLOGY

Vector Systems
• A vector is a DNA molecule used as a vehicle to transfer
foreign genetic material into another cell
• An ideal Vector should possess:






An origin of replication (ori)
A selectable marker gene
Unique restriction site(s)/MCS
Small size
Expression control elements

Cloning & Expression vectors
•

Cloning vectors are meant typically to
isolate or multiply the insert in the
target cell.

•

•

Expression vectors specifically are for
the expression of the transgene in
the target cell
Generally have a promoter sequence
that drives expression of the
transgene.

Shuttle Vectors
•
•

Vector containing two origin of replication or a broad host-range ori
Multiplication in two different hosts possible

Plasmids: History, Uses & Types

Plasmids: basic biology
• Circular extrachromosomal DNA molecules found in most of the
prokaryotes; and also in some yeasts, but not in higher eukaryotes
(Helsinki, 1979)
• Provide certain additional/advantageous properties to the bacterial
host viz. antibiotic resistance, degradation of complex organic
compounds , production of toxins etc.
• Not actually the part of bacterial genome as these can mobilize
from one host to another; may sometimes be present or absent
from the cells of a particular host species. Therefore, nonessential
for normal bacterial growth and division
• Size: vary from 1-200 Kb
• Shape: majority are covalently closed circular DNA molecules; linear
plasmids- Borellia, Streptomyces sp.

•

Based on the intrinsic properties the plasmids can be:
A. Conjugative and non-conjugative
– Conjugation is mediated by two sets of plasmid encoded genes
Transfer genes (tra) & mobilising factors (mob)
– Tra comprise a set of atleast 12 different genes which are responsible for
synthesis of pili & other surface components allowing physical contact
– Mob defined by atleast two regions; one coding for a mobilising protein which
binds to other mob region (nic/bom) present on the plasmid DNA
Conjugative plasmids
– have functional transfer and mobility regions (tra+, mob+)
– Mediate their own transfer
– Present in many Gram –ve and some Gram +ve bacteria
– Are large with stringent control of DNA replication
– Are present in low copy number
– E.g. F plasmids
Non-conjugative Plasmids
– That which lack the transfer function (tra-, mob+)
– Can be mobilised if other conjugative plasmid present in the same cell
– E.g. ColE1, CloDF13 can be mobilised by F factor

• Interestingly, plasmids with (tra-, mob-) phenotype are neither
conjugative nor can they be mobilised.
• Yet, if only Mob-protein coding region is lost, such plasmids can still
be mobilised by availability of a functional Mob-protein supplied by
another plasmid; which can act in trans on the Mob- plasmid.
B. Integrative (Those which integrate with the bacterial
chromosome; also called as Episome) and Non-Integrative Plasmids
(do not integrate)
• Based on the functional properties:
– F Plasmids
– R plasmids
– Col Plasmids
– Degradative Plasmids
– Virulence plasmids

Plasmid replication
• The replication strategy that a plasmid uses directly affects its
copy number, host range, and incompatibility group.
• relies on the normal host DNA replication machinery.
• Plasmids will carry distinct origins of replication (ori) and
genes that enable and control the frequency of their
replication.
– Theta mode of replication
• Most of the Gram –ve bacteria e.g. ColE1, RK2

– Rolling circle mode of replication
• Some Gram +ve bacteria

• Plasmid Incompatibility
– Two plasmids are incompatible if they are unable to coexist in the same cell
– Usually these share a common replication system and
common types of pilli, thus compete with each other
during replication
– Based on this, more than 30 incompatibility groups (Inc)
have been defined in E. coli and 13 in S. aureus.

• Plasmid Host Range- determined by its ‘ori’ region
• Narrow host range plasmids:
– most of the naturally occurring plasmids have a restricted host range.
– E.g. ColE1 and its derivatives grow only in E. coli and related organisms
such as Salmonella.

• Broad host range plasmids:
• Possess less specific ori region such that it can function in a number of
bacterial species.
• Most of them require very few of the host-encoded proteins
• Generally plasmids of the incompatibility group P, Q, and W have a
broad host range; also called as promiscuous plasmids e.g. RP4,
RSF1010, RK2 etc.
• Can replicate in a no. of bacteria such as E. coli, Agrobacterium,
Pseudomonas, Rhizobium etc.
• Thus interesting for gene manipulation experiments!!!

Plasmid copy number: the no. of molecules of an individual plasmid that may
normally be found in the single bacteria are referred to as the ‘Copy Number’
•

Low copy no. (STRINGENT PLASMIDS)

– Copy no. hardly ever >1
– Rigid control of replication
– Copy no. either controlled by or
correlated with the replication
of chromosomal DNA molecule
– Thus, pDNA replicates only once
or twice before the cell division
– Single copy plasmids have a
partitioning system; so as to
ensure
segregation
of
duplicated copies to different
daughter cells
– High Mol. Wt. & Conjugative

•

High copy no. (RELAXED PLASMIDS)

– multiple copies per cell
– Relaxed control of replication
– pDNA
replication
not
dependent upon host cell
chromosomal DNA replication
– pDNA replicates repeatedly
until a proper no. is reached
– No such partitioning system
+nt
– Generally Low Mol. Wt and
non-conjugative

Plasmids as Vectors: essential features
•
•
•
•
•
•

Autonomous replication in host: Ori region
Selectable marker(s)
Unique restriction sites/Multiple cloning sites
Low molecular weight
High copy number
Size: small

A more detailed look at plasmids
Promotor
Site
Origin of
Replication

Antibiotic
Resistance
Gene

Multiple
Cloning
Site

Some earlier used plasmids
• pSC101
– the first cloning vector, used in 1973 by Boyer and Cohen.
– 9 kb, low copy no.
– the original pSC101 only contained tetracycline resistance
and a restriction site for EcoRI,
– the commercially available pSC101 gained restriction sites
for several enzymes, including HindIII, in addition to the
EcoRI site.

• ColE1 plasmid
–
–
–
–

Approx 6.4 kb
Exist as multiple copies per cell
Single EcoR1 site present in colicin production (cea) gene;
transformants selected by inactivation of colicin
production; technically difficult and cell resistance to
colicins arises spontaneously at quite high frequency in a
bacterial population.

• Earlier natural plasmids of E. coli were used as cloning
vectors e.g. pSC101, pSF2124, ColE1 etc.
• Disadvantages:
 Generally large sizes – difficult transformation
 Presence of non-essential genes (toxin production etc.)
 Absence of unique restriction sites, desired marker genes
 Conjugative and mobilization properties

Therefore, artificial construction of desired plasmid
vectors
• Advantages:
 Increased efficiency of transformation
 Easier to restriction map
 Higher copy numbers

• pBR322
– an example of an early cloning vector that
replicates in E. coli
– Constructed by Bolivar & Rodriguez
– Approx 4.3kb plasmid composed of sequences from
ColE1, pMB1 and pSC101 plasmids
– ori allows independent replication
– single cleavage sites for various restriction
enzymes (BamHI etc)
– tet resistance gene
– amp resistance gene
Mechanism:
– insertion of foreign DNA at BamHI site
– tet resistance gene inactivated
– transformants carrying foreign DNA are amp
resistant but tetracycline sensitive
– Double selection of transformants required /replica
plating

pUC series
•
•
•
•
•

1982, University of California
Approx. 2.7kb in size; high copy no.
amp resistance gene
ori derived from pBR322
Unique restriction sites clustered
into one short fragment called as
‘the multiple cloning site (MCS)’ or
the polylinker site

Another advancement was the use of blue white screening

•

•

The Lac Z’ gene coding for
beta-galactosidase
was
incorporated as a part of
the MCS region in plasmids
Insertional Inactivation of
the lac Z gene leads to the
selection of transformants

pGEM series
pGEM3Z/ pGEM4Z
 next generation
 introduces RNA expression for
in vitro or in vivo expression

Limitations of Cloning in Plasmids


Upper limit for clone DNA size is 12 kb



Requires the preparation of “competent” host cells



Inefficient for generating genomic libraries as overlapping
regions needed to place in proper sequence
Preference for smaller clones to be transformed
If it is an expression vector there are often limitations regarding
eukaryotic protein expression




Bacteriophage lambda (λ) as cloning vehicles

Phage replication
• λ circles multiply by theta
form and continues for 515 minutes after infection.
• Rolling circles
predominates after 15
minutes and produce
linear concatemers
(genomes linked end to
end)
• cos sites recognised by
endonucleases/terminase
producing individual
phage genomes for
packaging
• Packaging also requires
THF (termination host
factor) provided by the
host cell.

Molecular biology of λ genome
•
•
•
•

Mol wt. 31X106 Da, 48.5 Kb long
DNA isolated from virus particles is a ds linear molecule
cos sites: 12 nucleotides long single stranded cohesive termini at each 5’
end
When inside host cell: circularization of phage DNA
Genetic map of λ: almost 40 genes organised in functional clusters

5’ cos sites
5’ cos sites

Head

Tail

Left region

Recombination, Lysogeny

Regulation, Replication, Lysis

Central region
Much of this central region is not
Much of this central region is not
essential for lytic growth and can
essential for lytic growth and can
be deleted or replaced for the
be deleted or replaced for the
construction of suitable vectors
construction of suitable vectors

Right region

Lysis
Replication
ori

cos

Head
Tail

Lysis
Replication
ori

Circularized lambda

Lysogeny

Deletion of non essential region
Deletion of non essential region
makes room for the ‘foreign
makes room for the ‘foreign
insert’
insert’

cos

Head
Tail

Constraints with wild type λ; construction of λ Vectors
• Protein capsule of λ has a tight constraint on the amount of DNA
that will fit inside it
– Molecules <38kb are not packaged efficiently
– However, ~105% of the normal complement of λ DNA can be
packaged into phage heads leading to an upper limit of ~52kb
– Therefore, 38-52Kb packaging limits of phage heads.
– Elimination of non-essential part: vector can accommodate
~14.5Kb of insert. Also λ arms contain some non-essential
regions that can be removed.
Thus a maximum of 24.6 Kb foreign DNA can be inserted
• Presence of multiple restriction sites of same enzyme.

Lambda vectors
• Insertion vectors:

cos

cos
EcoRI

• Replacement vectors:

cos

cos
EcoRI

20Kb

What was the need for replacement vectors!!!

EcoRI

Cloning in λ vectors
Cloning in λ vectors
• Restrict λ vector as
well as genomic DNA
• Ligation: formation of
recombinants
• Introduction into
host: transfection or in
vitro packaging
•
Selection
screening

and

Examples of lambda vectors
λEMBL3

λGEM-11

Screening phage recombinants
•

•

•
•

λ gt10: Insertional inactivation of cI gene : cI product induces lysogeny, so
non-recombinants follow lysogeny and form turbid plaques but
recombinants where cI gets interrupted by insert undergo lytic cycle and
form clear plaques
λ gt11: Interruption of Lac Z’ gene: when plated Lac Z- host on a medium
containing X-gal and IPTG; recombinants form white plaques whereas
non-recombinants give blue plaques.
λEMBL3 and 4: size selection
λGEM11 and 12: spi- phenotype of recombinants
Cloning in E. coli cells containing P2 phage insertion of target makes
the recombinant phage spi- hence grow on E. coli cells with P2 infection

• Advantages
– Efficient cloning of larger fragments (10-24kb)
– Phage vectors suitable for genomic library construction
– Introducing phage DNA into E. coli by phage infection is much more efficient than
transforming E. coli with plasmid DNA
– Replacement vectors offer selection of recombinants on the basis of size itself
– Several 1000s phage plaques can be screened & characterized on a single petri
dish

• Limitations
• Not suitable for whole genome sequencing in eukaryotes.

M13 phages
M13 phages
•
Filamentous non-lytic phages
•
Circular ssDNA; ~6400 nts in length
•
Exist as both dsDNA & ssDNA in different phases of its replication cycle
How M13 infects and reproduces
•
infects through pili
•
Protein coat is stripped and ssDNA is converted to double stranded
replicative form (RF)
•
DNA replicated; switch over to RF-RF  RF-ss
•
New particles assembled with ssDNA & released without lysis
•
~200 particles per infected cell per generation
Uses
•
•
•

Cloning and sub cloning expts.
ssDNA for probes, sequencing
Phage display technology; M13 will produce foreign protein on surface as
part of its protein coat, can use to generate specific antibodies

Obtaining single-stranded DNA by cloning
in M13 phage.

Foreign DNA (red), cut with HindIII, is
inserted into the HindIII site of the
double-stranded phage DNA. The
resulting recombinant DNA is used to
transform E.coli cells, whereupon the
DNA replicates by a rolling circle
mechanism, producing many singlestranded product DNAs. The product
DNAs are called positive (+) strands, by
convention. The template DNA is
therefore the negative (-) strand.

Cosmids
•
•
•
•
•

Barbara Hohn & John Collins, 1979
Plasmids containing lambda cos sites
Cos sites: essential for packaging of nucleic acid into protein coat/heads
Thus, any in vitro packaging reaction could work not only with lambda
genomes but also with any molecule that carries the cos sites separated by
38-52 kb of DNA.
Plasmid features:
– Ori
– Selectable marker
– Unique restriction sites

•
•

DNA (~ 33-48 kb) cloned into restriction site, the cosmid packaged into
viral particles and these phages used to infect E. coli
inside bacterial host, replicate as plasmids and no expression of phage
functions

Examples: pWE15, Homer I, pJC79, c2XB, Supercos-1 etc.

• Advantages
–
–
–
–

High insert capacity; fewer clones to be screened
Useful in genomic library construction
Studying larger genes
Transformation frequency higher due to in vitro packaging

• Limitations
•

Somewhat unstable due to large size, difficult to maintain

Genomic libraries of Drosophila, mouse and several
Genomic libraries of Drosophila, mouse and several
other organisms have been produced with cosmid
other organisms have been produced with cosmid
vectors
vectors

Phagemids
have been engineered to produce single-stranded DNA
in the presence of helper phages.
•Single-stranded;
•Both filamentous phage and plasmid characteristics;
•Helper phage
•Two RNA polymerase promoters (T7and T3)
The f1 replication origin was not sufficient to direct ssDNA
The f1 replication origin was not sufficient to direct ssDNA
production, but if aa bacterium carrying aa phagemid was
production, but if
bacterium carrying
phagemid was
superinfected with aa functional wild type M13 or f1 helper phage,
superinfected with functional wild type M13 or f1 helper phage,
then the production of single stranded phagemid DNA would occur.
then the production of single stranded phagemid DNA would occur.

They are generally small plasmids so that they have the ability to
They are generally small plasmids so that they have the ability to
accept larger DNA inserts than M13 based vectors.
accept larger DNA inserts than M13 based vectors.

Uses:
Uses:
DNA sequencing
DNA sequencing
Oligonucleotide directed mutagenesis
Oligonucleotide directed mutagenesis
Probe synthesis
Probe synthesis

Egs.
• pEMBL vectors
• pBluescript II series
• pGEMZf series

Concept, types & uses of Artificial chromosomes
(YACs, BACs & PACs)

Need to clone larger inserts!!

EUKARYOTIC GENOMIC LIBRARY CONSTRUCTION
EUKARYOTIC GENOMIC LIBRARY CONSTRUCTION

YACs
Yeast artificial chromosomes are shuttle-vectors that
Yeast artificial chromosomes are shuttle-vectors that
can be amplified and modified in bacteria and
can be amplified and modified in bacteria and
employed for the cloning of very large DNA inserts (up
employed for the cloning of very large DNA inserts (up
to 1–2 mega base pairs) in the yeast Saccharomyces
to 1–2 mega base pairs) in the yeast Saccharomyces
cerevisiae
cerevisiae

Introduction
Introduction
• relatively small size (approximately 12 kb)
• Circular form when they are amplified or manipulated in E.
coli, but are rendered linear and of very large size, i.e. several
hundreds of kilobases (kb), when introduced as cloning
vectors in yeast.
• contain all three cis-acting structural elements essential for
behaving like natural yeast chromosomes:
– an autonomously replicating sequence (ARS) necessary for
replication
– a centromere (CEN) for segregation at cell division;
– Two telomeres (TEL) for maintenance.
• Their capacity to accept large DNA inserts enables them to
reach the minimum size (150 kb) required for chromosomelike stability and for fidelity of transmission in yeast cells

• YACs have several advantages over other large capacity
vectors:
– accommodation of DNA segments thousands of kilobases
in size
– stable maintenance of cloned eukaryotic DNA due to the
compatibility with the yeast replication machinery.
– are amenable to large-scale plasmid amplification in E. coli
– creation of specific genetic changes within the exogenous
DNA sequences by using the faithful and efficient yeast
mechanism of homologous recombination.

Overview of Yeast Artificial Chromosomes (pYACs) Plasmids
•
•
•

•
•

Initial pYAC3 and pYAC4 plasmids were constructed by Burke et al. (1987)
The basic structural features of YACs were developed from the yeast
centromere shuttle-plasmids YCp series.
These are composed of double-stranded circular DNA sequences carrying the
– beta-lactamase gene bla and the bacterial pMB1 ori
– yeast ARS1 with its associated CEN4 DNA sequence
– the URA3 selectable marker
• On this basic scaffold plasmid; are present
– the yeast HIS3,
– flanked by a telomere-like DNA sequence (TEL) that are adjacent to two
recognition sites for the BamHI restriction enzyme
Most of these YACs also contain the cloning site in the middle of the SUP4
gene
During Insertional inactivation cloning process, the SUP4 gene is disrupted by
the DNA insert, thus removing the suppression of the ade mutations and
allowing phenotypic expression as red color.

Construction of Yeast Artificial Chromosomes

After plasmid DNA purification, two distinct digestions are performed
first with BamHI; site flanking the HIS3 gene,
HIS3 excised from the plasmid and lost
(The excision of the HIS3 gene is used as negative selective marker for uncut pYAC molecules)
first digestion generates a long linear fragment carrying telomeric sequences
at each end.
second digestion consists of the opening of the cloning site within the SUP4
gene
Two linear fragments are produced as
left and right arms of the future linear YAC
The selective markers are thus separated:
TRP1 adjacent to ARS1 and CEN4 on the left arm and URA3 on the right arm
Large DNA fragments with ends compatible to the cloning site are ligated
with phosphatase-treated YAC arms, to create a single yeasttransforming DNA molecule
• Primary transformants can be selected for complementation of the ura3
mutation in the host, and successively for complementation of the host
trp1 mutation, thereby ensuring the presence of both chromosomal arms.
• Transformant colonies containing the exogenous DNA insert within the
SUP4 gene are detected by their red color

Some biological features of YAC vectors
The stability of YAC vectors in yeast per se is similar to that of natural
The stability of YAC vectors in yeast per se is similar to that of natural
chromosomes provided that all three structural elements (ARS, CEN
chromosomes provided that all three structural elements (ARS, CEN
and TEL) are present and functional and, in addition, that the minimal
and TEL) are present and functional and, in addition, that the minimal
required size is reached by the insertion of enough exogenous DNA
required size is reached by the insertion of enough exogenous DNA
However, the genetic and biochemical background of the
However, the genetic and biochemical background of the
host cell also plays an important role in determining the
host cell also plays an important role in determining the
stability of YACs.
stability of YACs.
Another important consideration is that faithful
Another important consideration is that faithful
duplication of YACs is guaranteed only if other
duplication of YACs is guaranteed only if other
DNA sequences incompatible
DNA sequences incompatible
with ARS do not exist on the construct.
with ARS do not exist on the construct.

•

•
•

Depending upon the experimental systems and the yeast strains, different
selectable markers and restriction sites are appropriate on the YAC
vectors.
These sites can be constructed in vitro by standard techniques and then
used for subcloning DNA fragments
Additionally, existing YAC clones can be modified by homologous
recombination in yeast i.e. transforming YAC-containing yeast cells with a
'disruption cassette carrying the desired genetic marker flanked by short DNA
sequences homologous to one of the markers present on the artificial
chromosome.

Use of Yeast Artificial Chromosomes
• Generating whole DNA libraries of the genomes of higher
organisms
• YAC clones have been used as hybridization probes for the
screening of cDNA libraries, thus simplifying the characterization of
unidentified genes.
• Study of regulation of gene expression by cis-acting, regulatory DNA
elements after the transfer of these YACs from yeast to mammalian
cells.
• YACs are being used for isolation of functionally analogous
mammalian DNA sequences in order to develop mammalian
artificial chromosomes (MACs).
– The main difficulty in constructing mammalian artificial chromosomes by
using YACs is the isolation and maintenance of the mammalian
centromere due to its large size and high instability in the yeast cell

Limitations of YACs

frequent occurrence of chimeric clones
frequent occurrence of chimeric clones

PACs: P1-derived Artificial chromosome
To overcome some of the problems associated with YAC systems
To overcome some of the problems associated with YAC systems

• P1 bacteriophage has a much larger genome than lambda phage
(110-115bp)
• it can exist in E. coli in a prophage state
• P1 phage has two replication regions: one to control lytic DNA
replication and other to maintain the plasmid during non-lytic
growth.
• Low copy no.
• Vectors have been designed with the essential replication
components of P1 incorporated into plasmid
• Insert capacity in the range of 70-100 kb
• Similar to BACs,
– these are also easy to manipulate
– Transformation efficiency is higher than YACs
– PACs are non-chimeric

*sacB confers
sucrose sensitivity
in host

Bacterial Artificial Chromosomes
• BAC vectors are plasmids
constructed with the replication
origin of E. coli F factor, and so
can be maintained in a single
copy per cell.
• These vectors can hold DNA
fragments of up to 300 kb
• Recombinant
BACs
are
introduced into E. coli by
electroportation
• Once in the cell, the rBAC
replicates like an F factor

Example: pBAC108L; the
first BAC vector
• Has a set of
regulatory
genes,
OriS, and repE which
control
F-factor
replication, and parA
and parB which limit
the number of copies
to one or two.
• pBAC108L lacked a
selectable marker for
recombinants. Thus
clones with inserts
had to be identified
by
colony
hybridization.

pBeloBAC11 represents
the second generation
BAC cloning vectors.

•
•
•
•
•
•
•

It introduces the LacZ gene to facilitate recombinant identification
The T7 and SP6 promoters facilitate the Generation of RNA probes
The various restriction sites can be used to excise the inserts of BAC clones.
CMR (chloramphenicol) as selectable marker for transformant selection
The F factor codes for genes that regulate its own replication and controls its
copy number
The genes oriS and repE mediate the unidirectional replication of the F factor
parA and parB maintain copy number at a level of one or two per cell

• Advantages of BACs
• lower levels of chimerism
• stable
• ease of library generation and insert manipulation

Animal virus derived vectors
• Replicons analogous to bacterial plasmids are not found in
animal cells.
• Some viruses are used to develop the vectors for animal cells
• General vector construction involves replacing essential viral
genes with the transgene of interest and using a packaging
line to supply the missing viral functions

Summary of major expression systems used in animal cells

1. Adenovirus Vectors
•
•

~36 kb linear dsDNA genome
There are six early transcription units (E) and a major late transcript (MLT)

Map of the adenovirus genome

•

Vectors were designed by deleting some of the segments of viral
genome

Why used as gene-transfer and expression vectors??
•
•
•
•
•

Stability
High capacity of foreign DNA
Wide host range; including non-dividing cells
Ability to produce high-titre stocks
Suitable for transient expression

•

First generation “E1 replacement vectors”
– Lacked the essential E1a and E1b genes + non-essential E3 gene
– Maximum capacity: ~7kb
– Propagated in “human embryonic kidney line 293” * The human embryonic kidney
line 293 is transformed with leftmost 11% of the adenoviral genome and hence provides these gene
functions in trans

– Problems: cytotoxicity and recovery of replication-competent viruses
•
–
–
–

Higher capacity vectors were also developed
lacked E2 and E4 regions along with E1 and E3
Cloning capacity increased to ~10kb
Also need to be propagated in complementary cell lines

•

E4 gene is responsible for many of the immunological effects of the virus: removal
ensures low level of cytotoxicity

•

Recovery of replication-competent viruses through unwanted recombination was
addressed through use of refined complementary cell lines harboring specific DNA
fragment corresponding exactly to the E1 genes

• If viral genes are deleted then recombinant vector can be
propagated in helper cell lines only
• Most vectors derived from the adenoviral genome are
replication deficient
• Adenovirus can be used as vector for transient expression
– This virus bearing foreign DNA can be used to produce the foreign
protein in many different cell types, but gene expression is usually
transient because the viral DNA does not integrate into the host
genome.

• The lack of integration may, however, be advantageous if
adenoviral vectors are used in gene therapy.

•
•
•
•
•

Advantages
highly efficient at getting DNA into cells
can infect both replicating and differentiating cells.
Attractive as gene-therapy vectors
Since they do not integrate into the host genome, they cannot bring
about mutagenic effects caused by random integration events

•
•
•

Disadvantages
Only transient expression is possible
These vectors are based on an extremely common human pathogen and
in vivo delivery may be hampered by prior host immune response to one
type of virus.

2. Adeno-associated virus vectors
•
•
•

First discovered as a contaminant in an adenoviral isolate (Atchison et al.
1965)
a small ssDNA virus with ~5kb genome
A member of the parvovirus family

The genome comprises aacentral region
The genome comprises central region
containing rep (replicase) and
containing rep (replicase) and
cap (capsid) genes flanked by 145-b
cap (capsid) genes flanked by 145-b
inverted terminal repeats
inverted terminal repeats

AAVs are Naturally replication defective
In the presence of helpers
Replicates lytically and
produces thousands of
progeny virions

In the absence of helpers
AAV DNA integrates into the
host cell’s genome
& remains as a latent
provirus

The dependence of AAV on a heterologous
The dependence of AAV on a heterologous
helper virus (adenovirus or herpes virus)
helper virus (adenovirus or herpes virus)
provides an unusual degree of control over
provides an unusual degree of control over
vector replication
vector replication

• First AAV vectors;
– cap region replaced with transgene
– Expression from an endogenous AAV or a heterologous promoter
– Rep protein interference causes inefficient transgene expression and
cytotoxic effects

• Subsequently vectors were developed with;
– deletions of both rep & cap regions
– Expression from an endogenous AAV or a heterologous promoter
From such experiments, it was demonstrated
From such experiments, it was demonstrated
that the repeats are the only elements required for
that the repeats are the only elements required for
replication, transcription, proviral integration, and
replication, transcription, proviral integration, and
rescue.
rescue.
All current AAV vectors are based on this principle
All current AAV vectors are based on this principle
In vitro manipulation of AAV
facilitated by cloning the inverted terminal repeats in a plasmid
vector and inserting the transgene between them.

• Advantages
– Proviral Integration increases the persistence of transgene expression
– Also, site specificity of proviral integration theoretically limits the
chances of insertional mutagenesis.
– Wide host range

3. Retroviruses
Retroviruses are RNA viruses that replicate via a dsDNA intermediate

Structure of an integrated provirus, with long terminal repeats (LTRs) comprising three regions
U3, R, and U5, enclosing the three open reading frames gag, pol, and env.

Structure of a packaged RNA genome, which lacks the LTR structure and possesses a poly(A) tail

Generic map of an oncoretrovirus genome

Infection cycle
 Virus envelope interacts with the host-cell’s plasma membrane, delivering the
particle into the cell
 The RNA genome is reverse transcribed to produce a cDNA copy
 The terminal regions of the RNA genome are duplicated in the DNA as long
terminal repeats (LTRs)
 The DNA intermediate then integrates into the genome at an essentially random
site
 The integrated provirus has three genes (gag, pol, and env)
 Viral genomic RNA is synthesized by transcription from a single promoter located
in the left LTR and ends at a polyadenylation site in the right LTR. Thus, the fulllength genomic RNA is shorter than the integrated DNA copy and lacks the duplicated LTR
structure.

 The genomic RNA is capped and polyadenylated, allowing the gag gene to be
translated
 Some of the full-length RNA also undergoes splicing, eliminating the gag and pol
genes and allowing the downstream env gene to be translated.
 Two copies of the full-length RNA genome are incorporated into each capsid,
which requires a specific cis-acting packaging site termed ψ.
 The reverse transcriptase/ integrase is also packaged.

Why Retroviruses used as vectors??
•

•
•
•

•

Most retroviruses do not kill the host, but produce progeny virions over
an indefinite period. Therefore, can be used to make stably transformed
cell lines
Viral gene expression is driven by strong promoters, which can be
subverted to control the expression of transgenes
Some retroviruses have a broad host range allowing the transduction of
many cell types
Retroviruses make efficient and convenient vectors for gene transfer
because the genome is small enough for DNA copies to be manipulated in
vitro in plasmid-cloning vectors
The vectors can be propagated to high titers (up to 108 plaque-forming
units per ml), and the efficiency of infection in vitro can approach 100%.

The major disadvantage of oncoretroviral vectors is that they
only productively infect dividing cells, which limits their use
for gene-therapy applications

Retroviral vectors
• Mostly ‘replication-defective’
• Vectors consist of only the cis-acting sites required for
replication and packaging:
– These include the LTRs (necessary for transcription, polyadenylation
as well as integration), the packaging site ψ and ‘primer-binding sites’
which are used during the complex replication process

• Deleted vectors can be propagated only in the presence of a
replication-competent helper virus or a packaging cell line
• The simplest cloning strategy involves deletion of all coding
sequences and placing the foreign gene between the LTR
promoter and the viral polyadenylation site

• Heterologous promoters can also be used; however LTR promoters
may interfere.
– Therefore, Self-inactivating vectors have been devised; wherein
deletions in the 3’ LTR when copied to the 5 ′ LTR during vector
replication renders the LTR promoter inactive

• Since the viral replication cycle involves transcription and splicing,
an important consideration for vector design is that the foreign
DNA must not contain sequences that interfere with these
processes
• Since retroviral vectors are used for the production of stably
transformed cell lines, it is necessary to co-introduce a selectable
marker gene along with the transgene of interest.

4. The alphaviruses:

Sindbis virus & Semliki forest virus vectors
• Single strand positive-sense RNA genome
• Integration into the host genome is guaranteed never to occur
• Alphavirus replication takes place in the cytoplasm, and produces a
large numbers of daughter genomes, allowing very high-level
expression of any transgene
• Display broad host range
• The wild-type alphavirus comprises two genes;
– 5′ gene encoding viral replicase,
– 3′ gene encoding a polyprotein from which the capsid is derived

• Insertion vectors have been constructed;
–
–
–

–

replication-competent
Additional sub-genomic promoter present either upstream or downstream of
the capsid polyhedrin gene
If foreign DNA is introduced downstream of this promoter, the replicase
protein produces two distinct subgenomic RNAs, one corresponding to the
transgene.
Unstable

• Replacement vectors
• Capsid polyhedrin replaced with transgene

• Both plasmid replicon and viral transduction vectors have
been developed from the alphavirus genome.

5. Pox viral vectors
•
•
•
•

•

•

Pox viruses such as vaccinia, have a very large dsDNA genome (~300kb)
and can accommodate large inserts of upto 35kb
The poxviruses replicate in the cytoplasm of the infected cell
No helper virus is required for propagation
Thus, the virus must encode and package all its own DNA replication and
transcription machinery & recombinant genomes introduced into cells by
transfection are non-infectious
Transgene expression usually needs to be driven by an endogenous
vaccinia promoter, since transcription relies on proteins supplied by the
virus
Since the cytoplasm lacks any transcription & nuclear splicing apparatus,
vaccinia vectors cannot be used to express genes with introns

•

Recombinant viruses are generated by homologous recombination, using
a targeting plasmid transfected into virus-infected cells

•

Direct ligation vectors have also been developed, and these are
transfected into cells containing a helper virus to supply replication and
transcription enzymes in trans

A variety of foreign genes have been cloned in vaccinia
including HTLVIII envelope protein, hepatitis B virus surface
antigen, influenza virus, hemaglutinin, rabies virus
glycoprotein etc.

6. Herpesvirus Vectors
•
•
•
•
•
•
•

The herpesviruses are large dsDNA viruses;
Epstein–Barr virus (EBV) and the herpes simplex viruses (HSV-I, varicella
zoster)
Most herpes simplex viruses are transmitted without symptoms (varicella
zoster virus is exceptional), and cause prolonged infections
Unlike EBV, which is used as a replicon vector, HSV-I has been developed
as a transduction vector
HSV vectors are particularly suitable for gene therapy in the nervous
system because the virus is remarkably neurotropic
Recombinants can be generated in transfected cells by homologous
recombination, and such vectors may be replication-competent or helperdependent
Generally, transgene expression is transient, although prolonged
expression has been observed in some neuronal populations

7. Baculovirus vectors
•
•
•
•

Rod shaped capsids & large dsDNA genome
Productively infect arthropods, particularly insects
Used mainly for high-level transient protein expression in insects and
insect cells
The nuclear polyhedrosis virus group, has an unusual infection cycle that
involves the production of nuclear occlusion bodies.
POLYHEDRIN GENE REPLACEMENT VECTORS
POLYHEDRIN GENE REPLACEMENT VECTORS
The nuclear occlusion stage of the infection cycle is non-essential for the
The nuclear occlusion stage of the infection cycle is non-essential for the
productive infection of cell lines, thus the polyhedrin gene can be
productive infection of cell lines, thus the polyhedrin gene can be
replaced with foreign DNA, which can be expressed at high levels under
replaced with foreign DNA, which can be expressed at high levels under
the control of the endogenous polyhedrin promoter.
the control of the endogenous polyhedrin promoter.
The polyhedrin upstream promoter and 5′ untranslated region are important for
high-level foreign gene expression and these are included in all polyhedrin
replacement vectors

•

Two baculoviruses have been extensively developed as vectors
– the Autographa californica multiple nuclear polyhedrosis virus (AcMNPV)
• used for protein expression in insect cell lines, particularly those derived from
Spodoptera frugiperda (e.g. Sf9, Sf21)

– the Bombyx mori nuclear polyhedrosis virus (BmNPV)
• infects the silkworm, and has been used for the production of recombinant protein
in live silkworm larvae

•

Replacement of the polyhedrin gene also provides a convenient method
to detect recombinant viruses
– The occlusion bodies produced by wild-type viruses cause the microscopic
viral plaques to appear opalescent if viewed under an oblique light source
(OB+), while recombinant plaques appear clear (OB–)

•

many current baculovirus expression systems employ lacZ as a screenable
marker to identify recombinants

USE IN MAMMALIAN SYSTEM
USE IN MAMMALIAN SYSTEM
One limitation of this expression system is that the glycosylation
One limitation of this expression system is that the glycosylation
pathway in insects differs from that in mammals, so recombinant
pathway in insects differs from that in mammals, so recombinant
mammalian proteins may be incorrectly glycosylated and hence
mammalian proteins may be incorrectly glycosylated and hence
immunogenic
immunogenic
 Using insect cell lines chosen specifically for their ability to carry out
mammalian-type post-translational modifications, e.g. those derived from
Estigmene acrea
 Expressing appropriate glycosylation enzymes along with the transgene
of interest

Construction of baculovirus expression vectors
• Inserting the transgene
downstream
of
the
polyhedrin promoter
• achieved by homologous
recombination using a
plasmid vector carrying a
baculovirus
homology
region
• The
proportion
of
recombinants has been
increased by using linear
derivatives of the wild-type
baculovirus
genome
containing large deletions,
which can be repaired only
by
homologous
recombination with the
targeting vector.

‘Plasmids with viral replicons’

Replicon vectors contain origins of replication derived from certain viruses

i) SV40 vectors
•
•
•

The first mammalian cell viral vector to be
developed (Hamer and Leader, 1979)
Circular dsDNA tumor virus; genome: ~5kb in size
The genome has two transcription units

•

During the first stage of the SV40 infection cycle,
the early transcript produces two proteins,
known as the large T and small t tumor antigens

•

T Antigen: binds to the viral origin of replication
and is absolutely required for genome
replication; also acts as an oncoprotein
All vectors based on SV40 must therefore be supplied with functional
All vectors based on SV40 must therefore be supplied with functional
T antigen, or they cannot replicate, even in permissive cells
T antigen, or they cannot replicate, even in permissive cells

•
•

•
•
•

These viruses cause lytic infections, i.e. the viral genome replicates to a very high
copy number
The first SV40 viral vectors involved replacement of either ‘early’ or ‘late’
regions
functions of the replaced region had to be provided in trans initially by a cointroduced helper virus
Development of the COS cell line, containing an integrated partial copy of the SV40
genome, simplified the use of replacement vectors
The integrated fragment included the entire T-antigen coding sequence and
provided this protein in trans to any SV40 recombinant in which the early region
had been replaced with foreign DNA

The major problem with these initial SV40 vectors
The major problem with these initial SV40 vectors
was that the capacity of the viral capsid allowed a
was that the capacity of the viral capsid allowed a
maximum of only about 2.5 kb of foreign DNA to be
maximum of only about 2.5 kb of foreign DNA to be
incorporated.
incorporated.

Plasmids carrying the SV40 origin of replication became
a major breakthrough
•
•
•
•

•

In general, these vectors consisted of a small SV40 DNA fragment
(containing the origin of replication) cloned in an E. coli plasmid vector
Such plasmids behaved in the same way as virus itself i.e. replicating to a
high copy number in permissive monkey cells
Since these SV40 replicons were not packaged into viral capsids, there
were no size constraints on the foreign DNA
Some vectors also contained a T-antigen coding region and could be used
in any permissive cell line, while others contained the origin alone and
could only replicate in COS cells
Permanent cell lines are not established when SV40 replicons are
transfected into COS cells because the massive vector replication
eventually causes cell death

•

Recombinant SV40 vectors (rSV40) are good candidates for gene transfer, as they
display some unique features
– Non-replicative vectors are easy-to make,
– can be produced in titers of 1012 IU/ml.
– They also efficiently transduce both resting and dividing cells,
– deliver persistent transgene expression to a wide range of cell types,
– Non-immunogenic

•

Present disadvantages of rSV40 vectors for gene therapy are a small cloning
capacity and the possible risks related to random integration of the viral genome
into the host genome

ii) BK and BPV replicons
•
•

Designed to facilitate episomal replication
These vectors were based upon viruses which cause latent infections
(where the viral genome is maintained as a low to moderate copy-number replicon that does
not interfere with host-cell growth)

•
•

Plasmids that contain such latent origins behave in a similar manner to
the parental virus, except they are not packaged in a viral capsid
Advantages:
– DNA does not need to integrate in order to be stably maintained
– These episomal vectors are not subject to ‘position effects’

The human BK polyomavirus infects many cell
types and is maintained with a copy number of
about 500 genomes per cell
Plasmid vectors containing the BK origin
replicate in the same manner as the virus
when the BK T-antigen is provided in trans.
BKV-derived vector

The first virus to be developed as an episomal replicon
Bovine papillomavirus (BPV)
•

BPV has been exploited as a stable expression vector because:
– it can infect mouse cells without yielding progeny virions.
– Instead, the viral genome is maintained as an episomal replicon, with a copy
number of about 100

•

Early part of the replication cycle involves production of T antigen for
– viral replication
– oncogenic transformation of the host cell

The early functions of BPV are carried on a 5.5-kb
section of the genome, which is called the 69%
transforming fragment (BPV69T)
This was cloned in the E. coli plasmid pBR322, and
was shown to be sufficient to establish and maintain
episomal replication, as well as induce cell
proliferation
BPV-1-derived vector

iii) Epstein–Barr virus (EBV) Replicons
•
•
•
•

Replicate very stably in mammalian cells and facilitate long-term
transgene stability
Large dsDNA genome ~170kb
EBV predominantly infects primate and canine cells; also infects B cells in
humans
Only two relatively small regions of the genome are required for episomal
maintenance
– The latent origin (oriP);
– a gene encoding a transacting regulator called Epstein Barr nuclear antigen 1
(EBNA1)
These sequences have formed the basis of a series
of latent EBV-based plasmid expression vectors,
which are maintained at a copy number of 2–50
copies per cell

The first EBV vectors comprised the oriP element cloned in a bacterial plasmid, and
could replicate only if EBNA1 was supplied in trans

•
•

•
•

Some examples
pBamC: a shuttle vector; comprising oriP, a
bacterial origin, and ampicillin resistance gene
derived from pBR322, and the neomycin
phosphotransferase marker for selection in animal
cells
pHEBO: a derivative of pBamC; contained a
hygromycin resistance marker instead of neo
P201: construct derived by adding the EBNA-1
gene to pHEBO; it could replicate independently

EBV-derived vector

Unlike BPV replicons; replication in EBV replicons is limited to
Unlike BPV replicons; replication in EBV replicons is limited to
once per cell cycle. This, together with the large genome size,
once per cell cycle. This, together with the large genome size,

allows EBV-derived vectors to carry large DNA fragments,
allows EBV-derived vectors to carry large DNA fragments,
including mammalian cDNAs and genes
including mammalian cDNAs and genes

EBV replicons have been used to express aawide range of proteins
EBV replicons have been used to express wide range of proteins
in mammalian cell lines,
in mammalian cell lines,
including the epidermal growth factor receptor;
including the epidermal growth factor receptor;
the tumor necrosis factor receptor; and Na/K ATPase
the tumor necrosis factor receptor; and Na/K ATPase

Transcriptional & Translational Vectors

•
•
•
•
•
•

The following considerations should apply when high-level
expression is required
The use of a strong and constitutive promoter
The inclusion of an intron
The inclusion of a polyadenylation signal
The removal of unnecessary untranslated sequence
Optimization of the transgene for translational efficiency
The incorporation of a targeting signal

Cloned gene
Prepare RNA
transcripts/probes

Purify gene
products
(proteins)
Translational
vectors

Transcriptiona
l vectors

What are the essential
What are the essential
elements such a expression
elements such a expression
vector must possess??
vector must possess??

Goals
To obtain
as much as possible

/good expression + good cell growth

soluble folded protein

/reduced aggregation

in a form that is easy to purify

/use of secretion and tags

Common problem:
High expression =

danger of aggregation,
decreased cell growth/cell toxicity

Genetic Elements Essential for Expression

Prokaryotic expression systems
• Advantages

– Fast growth
– Cheap medium and equipment for growing
– Good knowledge of the host

• Disadvantages

– Limitations for expression of eukaryotic proteins

– Codon usage: different frequencies with which the
different codons appear in genes of these organisms
E.g. CGT, CGC, CGG, AGG, AGA, CGA code for arginine, but the last 3
(AGG, AGA, CGA) are rarely used in E. coli and it has low amounts of
respective tRNAs

– differences in post-translational modifications (SS bonds,
glycosylation etc)

•

Target gene under control of its own promoter

•

Host promoters / vector specific promoters
•
•
•

•

•

Optimised for binding to host (E.coli) RNA Pol
Regulation of expression is much easier
Basic requirements of a bacterial promoter:
• Mostly require sigma factor 70
• RNA Pol must bind at the consensus sequences present at the -10 and
-35 regions
• Distance between -10 & -35 regions : also decides the strength of
promoter.
In all the cases examined the promoter was weaker when the spacing
was increased or decreased from 17bp
• Upstream elements: increase transcription by interacting with alpha
subunit of RNA Pol
Most frequently used: Plac, Ptrc (Ptac), PBAD

Promoters from phages
T7, T3, SP6, T5, PL
Highly efficient and specific expression

Promoter should be strong and controllable!!
Promoter should be strong and controllable!!

Most of the prokaryotic expression vectors contain one
of the following controllable promoters…

• Ptrc (tac) or BAD
• λ PL
• T7

Ptrc/tac
•
•
•
•

Hybrid promoters
Stronger than parental promoters
Inducible by lactose & IPTG
Vectors also possess lacO operator and lacI gene for repressor
Level of expression
(inductor)

Key features

Plac

Low to medium level
(IPTG)

•Weak,
•regulated
•Suitable for expression of gene products
at
very low intracellular level
•Comparatively expensive induction

Hybrid
promoters
Ptac/Ptrc
(trp-lac)

Moderately high
(IPTG)

•Strong but lower than T7 system
•Regulated expression possible
•Comparatively expensive induction

λ PL
• Tight transcriptional control with high levels of gene
expression
• Trp -> cI gene (cI repressor)-> PL promoter-> cloned gene

pBAD promoters
•
•
•
•
•

Promoter of the araBAD
operon
Extremely tight control similar
to PL
araC : transcriptional regulator
also present
CAP and cAMP also activate
the araC binding to I1 and I2
Glucose: catabolite repression

Phage T7 promoter
pET family of expression vectors
•
•
•

E. coli strain carrying T7 gene 1 cloned downstream of the lac promoter, in the chromosome
Plasmid construct with T7 LysS gene
pET vector carrying T7 promoter+ lacO+ cloned gene

Ribosome Binding Site (RBS) or Shine-Dalgarno (S/D) sequence

RBS
RBS
5-10 n START
GAAGGAATTCAGGAGCCCTTCACCATG ... ...
• START codons:
E. coli uses 77% ATG (AUG), 14% GTG (GUG), 8% TTG (UUG) and a few
others
• STOP codons:
TAG (UAG), TGA (UGA), TAA (UAA)
Codon bias even extends to stop codons: UAA favored in genes
expressed at high levels
• The start codon if already present in the vector then it must be in frame
with the cloned gene

• Prokaryotes may involve factor-dependent and factorindependent transcription termination
• Factor-independent terminators
– Easy to recognise; have similar sequences: an inverted repeat followed by a
string of A residues

• Factor-dependent terminators
– have very little sequence in common with each other
– termination involves interaction with one of the three known E. coli
termination factors, Rho (ρ), Tau (τ), and NusA
Most expression vectors incorporate a factor-independent
Most expression vectors incorporate a factor-independent
termination sequence downstream from the site of
termination sequence downstream from the site of
insertion of the cloned gene.
insertion of the cloned gene.

Insertion into Transcriptional Vectors

Specialist transcriptional vectors have been developed
that facilitate the production of RNA probes and
interfering RNA

Method for preparing RNA probes from a cloned DNA molecule using
phage SP6 promoter and SP6 RNA polymerase.

* No transcription
terminator is required
because the RNA
polymerase will fall off
the end of the linearized
plasmid.

To prepare RNA probes corresponding to both strands of the insert
•

Either prepare two different clones corresponding to the two orientations
of the insert

•

Or use a cloning vector in which the insert is placed between two
different, opposing phage promoters (e.g. T7/T3 or T7/SP6) flanking a
MCS

•

A further improvement has been introduced by Evans et al. (1995) in
their LITMUS vectors
– Polylinker regions flanked by two modified T7 RNA polymerase promoters
– Unique restriction site (SpeI or AflII) engineered into the T7 promoter
consensus sequences such that cleavage with the corresponding
endonuclease inactivates that promoter
– Selective unidirectional transcription is achieved by simply inactivating the
other promoter by digestion with SpeI or AflII prior to in vitro transcription

To make dsRNA: If the single stranded templates
thus generated, are mixed and used for in vitro
transcription then double-stranded RNA will be
produced

Insertion into Translational Vectors

Cloning Using Restriction Enzymes
NcoI
HindIII

Prokaryotic expression vectors

E. Coli Expression vectors: The pTrcHis vectors
• pBR322-derived
• three different versions pTrcHis A, pTrcHis B pTrcHis C that differ only in the spacing
between the sequences that
code for the N-terminal peptide
and the MCS
• For proper expression, first
determine which restriction site
is appropriate for ligation and
then which vector will preserve
the reading frame between the
5΄ sequences and the insert
when ligated into that site

E. Coli Expression vectors: The pQE-30 series

E. Coli Expression vectors: The pET series
The most powerful system yet developed for the cloning and expression of
recombinant proteins in E. coli.

pRSET vectors: pUC-derived expression vectors for high-level
expression of recombinant proteins in E. coli

Problems with the
production of
Recombinant protein in
E. Coli

These problems can usually be solved, although the necessary
manipulations may be time-consuming and costly!!!

Problems caused by E. coli

•
•
•

Correct processing and folding of recombinant protein
Unable to synthesize the disulphide bonds present in many animal
proteins
E. coli might degrade the recombinant protein
These problems are less easy to solve than
the sequence related problems

But the main problem is the absence of glycosylation
But the main problem is the absence of glycosylation
So far this has proved insurmountable, limiting E. coli to the
So far this has proved insurmountable, limiting E. coli to the
synthesis of animal proteins that do not need to be processed
synthesis of animal proteins that do not need to be processed
in this way.
in this way.

The Eukaryotic expression systems:
Production of recombinant proteins by eukaryotic cells
• Yeast
- Saccharomyces cerevisiae (baker’s yeast)
- Pichia pastoris

• Insect Cells – Baculovirus
• Mammalian Cells

Expression in S.cerevisiae

Autonomous replicating systems: YEps; YRps; YCps

YEps can replicate as an independent plasmid,
but integration into one of the yeast chromosomes can also occur

Yeast replicative plasmids (YRps)
Yeast centromere plasmids (YCps)

Expression in S. cerevisiae
Integrative systems

Yeast integrative plasmids (YIps) are basically bacterial plasmids carrying a yeast gene
•An example is YIp5, which is pBR322 with an inserted URA3 gene
•cannot replicate as a plasmid; survives only through integration

YIp

Three factors come into play when deciding which type of yeast vector is
most suitable for a particular experiment

• Transformation frequency (YEps ≈ YRps > YIps)
• Copy number(YRps>YEps>YIps)
• Stability of recombinants
– YIp: loss of a YIp that has become integrated into a chromosome occurs at
only a very low frequency
– YRp recombinants are extremely unstable, the plasmids tending to congregate
in the mother cell when a daughter cell buds off
– YEp recombinants suffer from similar problems as YRp

A YIp is the vector of choice if the experiment requires the
recombinant yeast cells to retain the cloned gene for long
periods in culture
Efficient integrative vectors are now available for aanumber of species, including
Efficient integrative vectors are now available for number of species, including
yeasts such as Pichia pastoris and Kluveromyces lactis, and the filamentous fungi
yeasts such as Pichia pastoris and Kluveromyces lactis, and the filamentous fungi
such as Aspergillus nidulans and Neurospora crassa
such as Aspergillus nidulans and Neurospora crassa

Expression in Saccharomyces cerevisiae

S. cerevisiae as the host for recombinant protein synthesis
•
•
•
•
•

Promoters : mostly GAL promoter
Most yeast expression vectors also carry a termination sequence from an
S. cerevisiae gene, because animal termination signals do not work
effectively in yeast
Yields of recombinant protein are relatively high
“Hyperglycosylated” proteins
S. cerevisiae also lacks an efficient system for secreting proteins into the
growth medium

Other yeasts and fungi

•
•
•
•
•

Pichia pastoris, glycosylation abilities are very similar to those of animal
cells
Expression vectors for P. pastoris make use of the alcohol oxidase (AOX)
promoter
The two most popular filamentous fungi are Aspergillus nidulans and
Trichoderma reesei
The advantages of these organisms are their good glycosylation &
secretion properties
Expression vectors for A. nidulans usually carry the glucoamylase
promoter; those for T. reesei make use of the cellobiohydrolase
promoter

Four promoters frequently used in expression vectors
for microbial eukaryotes

Yeast promoters are more complex than bacterial
promoters
positivecontrol
proteins

negative
-control
proteins

The level of transcription can also be affected by sequences located
within the gene itself and which are referred to as downstream
activating sequences (DASs)

• Why P. pastoris system ??
– alcohol oxidase (AOX1) promoter is one of the strongest and most
regulatable promoters known
– it is possible to stably integrate expression plasmids at specific sites in
the genome in either single or multiple copies
– the strains can be cultivated to very high density

Two specialized vectors for use in Saccharomyces (YES vectors) and Pichia (pPICZ)
*The YES vectors offer a choice of
2 μm origin for high copy or
CEN6/ARSH4 origin for low copy in yeast

In pPICZ vectors, the zeocin-resistance
gene is driven by the EM-7 promoter for
selection in E. coli and the TEF1 promoter
for selection in Pichia

Construct design for high-level transgene expression in animal cells
1. The use of a strong and constitutive promoter
• In viral vectors, transgenes are often expressed under the control of the
strongest endogenous promoters
• The elements most commonly used in mammalian cells are the SV40 early
promoter and enhancer, the Rous sarcoma virus long-terminal-repeat
promoter and enhancer and the human cytomegalovirus immediate
early promoter
2. The inclusion of an intron
• usually enhances expression
• most mammalian expression vectors in current use incorporate a
heterologous intron, such as the SV40 small t-antigen intron or the human
growth-hormone intron
• Introns may not be used in some expression systems, such as vaccinia
virus

3. The inclusion of a polyadenylation signal
• to generate a defined 3′ end to the mRNA
• In most cases, this defined end is extended by the addition of several
hundred adenosine residues to generate a poly(A) (polyadenylate) tail
• Required for the export of mRNA into the cytoplasm, and also increases
its stability
• Poly(A) sites from the SV40 early transcription unit or mouse beta-globin
gene are often incorporated into mammalian expression vectors
4. The removal of unnecessary untranslated sequence
• Both the 5′ and 3′ UTRs can influence gene expression in a number of
ways

– For example, the 5′ UTR may contain one or more AUG codons upstream of
the authentic translational start site, and these are often detrimental to
translational initiation
– The 3′ UTR may contain regulatory elements that control mRNA stability

•
•

both the UTRs may be rich in secondary structure, which prevents
efficient translation
These are generally removed from transgene constructs to maximize
expression

5. Optimization of the transgene for translational efficiency
• The sequence around the translational initiation site should conform to
Kozak’s consensus, which is defined as 5′-CCRCCAUGG-3′
• The expression of foreign genes in animals can also be inefficient in some
cases due to suboptimal codon choice
• translation may pause at rare codons due to the scarcity of the
corresponding transfer RNA (tRNA)
• It may therefore be beneficial to “codon-optimize” transgenes for the
expression host
6. The incorporation of a targeting signal
• Since specific types of modification occur in particular cell compartments,
it is necessary to consider strategies for targeting the recombinant protein
to the correct compartment to ensure that it is appropriately modified
• Many mammalian expression vectors are available for this purpose, and
they incorporate heterologous signal peptides

The Invitrogen vector pSecTag2
Incorporates a sequence encoding the murine immunoglobulin light chain
signal peptide for high-efficiency targeting to the secretory pathway

The SV40 origin for high-level expression in COS cells,
a neo selection cassette,
ColE1 and f1 origins for manipulation in bacteria,
and an expression cassette driven by the human cytomegalovirus promoter
two epitope tags to facilitate protein purification
an EK site to remove the epitope tags after purification

Using animal cells for recombinant protein production
• Mammalian cells
– Most widely used hosts for gene delivery,
– Allow the production of recombinant human proteins with authentic
post-translational modifications that are not carried out by bacteria,
yeast, or plants
– Promoters most frequently used are from viruses such as SV40 (p.
123), cytomegalovirus (CMV), or Rous sarcoma virus (RSV)
– Mammalian cell lines derived from humans or hamsters have been
used in synthesis of several recombinant proteins; these can be
transient or stable
– expensive approach
– Possible co-purification of viruses may render the product unsafe

• Insect cells
•
•
•

provide an alternative to mammalian cells for animal protein production
High yields of recombinant protein can be obtained
The expression system is based on the baculoviruses

•

To overcome the problem of glycosylation, BacMam vectors have been
devised
a modified baculovirus that carries a mammalian promoter to express
genes directly in mammalian cells
Hence, expression is accompanied by the mammalian cell’s own
posttranslational processing activities, so the recombinant protein is
correctly glycosylated and therefore should be fully active

•
•

Plant based vector systems

Reference:
Plant Transformation Technologies
Edited by C. Neal Stewart, Alisher Touraev, Vitaly
Citovsky and Tzvi Tzfira
© 2011 Blackwell Publishing Ltd.

Schematic comparison between an intermediate vector
method and a binary vector method

• Although the cointegrate method worked with a reasonably
high efficiency, one limitation was that the cointegrate
plasmid was larger than 150 kb, which made it complicated to
confirm the genetic structure of the plasmid
• To increase the plasmid stability during a long co-cultivation
period of A. tumefaciens with the target host plant tissues
• To understand the molecular mechanism of broad host-range
replication, and to use it to reduce the size of plasmid for
ease in cloning and for higher plasmid yield in E. Coli

Commonly Used Binary Vectors

The progress in DNA technology has made it possible to design binary
vectors in a more sophisticated fashion!!

• A series of pPZP vectors provide many user-friendly features
such as,
– a wide selection of cloning sites
– high copy number in E. coli for a high plasmid yield owing to the employment of
the ColE1 replication origin from pBR322,
– high stability in A. tumefaciens

• The pCAMBIA series (www.cambia.org) was later created from
the pPZP vectors
• The pPZP and pCAMBIA series are widely used together with
the other classic vectors

Basic structure of binary vectors

•

Because the transfer intermediate of the T-DNA is created in the direction
from the RB to the LB, placing a selectable marker gene for plants
adjacent to the LB is generally preferred for the complete introduction of
the T-DNA into plants

•

It is an important issue to choose an adequate plant selectable marker
gene in a particular study
– affects the efficiency of the transformation experiment
– restrictive or permissive concentrations of selective agents vary considerably
among plant species

•

kanamycin: dicots; Hygromycin: rice; Phosphoinothricin: maize
– Usually driven by constitutive promoters
– CaMV35S, nos: dicots
– Ubi of maize; Act of rice: monocots

•

Selectable marker genes are followed by a DNA fragment, the so-called 3’
signal

• Genes for β-glucuronidase (gusA or uidA), green fluorescent
protein (gfp), and luciferase (luc) are widely used as reporter
genes
– Analysing Expression profiles & Subcellular localisation of their fused protein
pair

• Expression of such reporter genes immediately after the
inoculation of plant cells with A. tumefaciens, which is
referred to as “transient expression,” indicates transfer of the
T-DNA into the nuclei of plant cells
• The later expression in a cluster of cells growing on selection
media provides evidence of transgene integration

•
•

•

•

Binary vectors need to replicate in both E. coli and A. tumefaciens
Either a broad host range replication function is used or two replication
functions, one for E. coli and the other for A. tumefaciens, can be
combined
Broad host range Replication functions of the plasmid incompatibility
group P (IncP) or W (IncW) are frequently used in binary vectors
In the binary vector system, there are two important considerations in
compatibility and utility of selectable marker genes:
– Whether the bacterial strain has any intrinsic antibiotic resistance
– Secondly, the ampicillin-resistance gene in binary vectors should be avoided because
penicillin-based antibiotics (e.g., carbenicillin), which are detoxified by the product of
the ampicillin-resistance gene, are used to remove residual A. tumefaciens from plant
cells after cocultivation

•

The introduction of binary vectors into A. tumefaciens can be achieved by
three methods:
– triparental mating, electroporation and freeze thaw
– If the triparental mating method is used, binary vectors need to carry a specific
sequence for mobility

Advanced features
• Introduction of sites for rare cutters: Such sites are rarely
present in the conventional vector backbones and fragments
to be inserted
• Gateway® system (Invitrogen) based cloning system being
used
• Strategies for efficient transformation have been devised
– E.g. The Superbinary vector system : these carry additional virulence

genes to enhance the efficiency

• BIBAC & TAC vectors: able to transfer large fragments to
higher plants
• Removal or Suppression of Transfer of Unnecessary DNA
– Cotransformation with two separate T-DNAs
– Site-specific recombinases

• Control of integration sites

Diagram of construction of
superbinary vectors.
Because the total size of the vector
components is relatively large in the
superbinary system,
Therefore, cointegration of an
intermediate vector, such as pSB11
and an acceptor vector, such as
pSB1,
via
homologous
recombination between the shared
DNA segments in A. tumefaciens is
employed during the final step of
construction of a superbinary vector
Unlike the intermediate vector
system, however, the final product
in the superbinary vector system is a
plasmid that can be confirmed by
routine restriction analysis of a
miniscale DNA preparation from A.
tumefaciens

Purification Tags
Tags can be a short peptide that specifically interacts with an immobilized
antibody or metal ion, or larger binding domains that interact with specific
immobilized ligands

•

To improve solubility and for affinity purification and hence roughly
divided as ‘Purification’ & ‘Solubility’ tags

•

The term ‘‘fusion protein’’ is also often used instead of the term ‘tag’.

•

Multiple tags can be added together in different combinations

•

Tags can be fused to proteins for a broad range of applications—
– labeling for imaging and localization studies,
– protein detection and quantification,
– protein–protein interaction studies,
– subcellular localization or transduction etc.

fusion sometimes refers to the simpler end-to-end joining of two proteins while
tags are typically shorter and include linker regions

Some Considerations When Designing
a Tagged Protein
•
•
•
•
•

Affinity and/or solubility?
Which tag(s) to use?
Tandem tags?
N- or C-terminal?
Cleavage sites to remove tags?

Affinity and/or solubility?
• The basis of solubility tags:
Attaching a highly translated native gene as a fusion on the Nterminal end of the heterologous target protein improves yield and
has the added benefit of increasing the solubility of the target
protein

• The basis of Affinity tags:
Crucial during protein purification and allow the use of a variety of
strategies to bind the target protein on an affinity matrix
*Some protein tags can function in both affinity and solubility roles

Which tag(s) to use?
• Vary in size; varying metabolic load on cells
• Also vary in the cost of purification
• The choice between different affinity tags often depends on finding
purification buffer conditions suitable for the target protein. For
e.g.
– For proteins susceptible to oxidation or proteolytic damage, the His-tag
may not be very suitable since immobilized metal affinity
chromatographic (IMAC) media cannot tolerate reducing agents or EDTA
– Conversely, for target proteins requiring denaturing conditions or
refolding, the His-tag and IMAC purification is an excellent choice

• Expression levels can dictate the choice of tags in some cases; for
e.g.
– solubility tags have strong translational initiation signals and can drive
expression levels higher

– when low expression levels are desirable, such as when studying
complexes or physiological interactions, more stringent epitope tags
or tandem tagging may be more appropriate

Tandem tags?
• Multiple tags can be attached on target proteins, allowing for
improved purification, expression, or tracking
• Solubility tags such as Trx or NusA can also be linked with affinity
tags such as His-tags for efficient purification of the fusion protein
• Affinity tags can also be attached at both ends of a target protein

N- or C-terminal?
• Tags can be placed at either the N- or C-terminus of a target
protein
• N –terminal:
– the construct can take advantage of efficient translation initiation
sites on the tag
– the tag can be removed more cleanly, since most endoproteases cut
at or near the C-terminus of their recognition sites
– Expression efficiency is more

• Care should be taken to preserve the positioning of any signal
sequences or modification sites
Solubility tags based on highly expressing proteins such as
MBP, Trx, are also more efficient at solubilizing target
proteins when positioned at the N-terminal end

Cleavage of Tags
• Tags can interfere with the structure and function of the
target protein
• Provision must be made to remove tags after the expression
and purifications steps
• Multiple cleavage sites can be engineered into the expression
construct to remove individual tags at different stages of
purification

Protein Affinity Tags
• His-tag
• GST tag
• Epitope tags

The His-tag (6xHis-tag)

One of the simplest and most widely used purification tags
•

SIZE:
– Six or more consecutive histidine residues which readily coordinate with
transition metal ions such as Ni2+ or Co2+

•

BINDING CHEMISTRY/CONDITIONS OF BINDING:
– Metal ions are immobilized using linkages on resins and beads (such as Ni(II)nitrilotriacetic acid (Ni-NTA) or Co+2-carboxymethyl-aspartate)
– His-tags bind the immobilized metal via the histidine imidazole ring
– Binding to IMAC (immobilized metal ion affinity chromatography) resins is
stronger under denaturing conditions as the His-tag becomes more exposed
•
–
–
–

ELUTION:
elution buffers with imidazole (100–250 mM) or low pH (4.5–6)
Care has to be taken to avoid EDTA (or EGTA) in any of the buffers
TRIS salts weakly chelate metal ions as well, and the use of TRIS buffers should
be minimized (50 mM or less)
– Most IMAC media very sensitive to reducing agents such as DTT, low levels of
beta-mercaptoethanol (<10 mM) should be used instead

•

The small size of the His-tag
minimizes interference with the
folding and structure of the target
protein

•

The His-tag can also be used with
commercially available His-tagspecific antibodies for protein
detection

•

The tag can be removed by
introducing a protease cleavage
site

GST tag
•

GST cloned from Schistosoma japonicum was shown to promote solubility
and expression as an N-terminal fusion (Smith and Johnson, 1988)

•

SIZE:
– an abundantly expressed 26 kDa eukaryotic protein

•

BINDING CHEMISTRY/CONDITIONS OF BINDING:
– GST binds to resin immobilized glutathione
– Resins: such as Glutathione-Sepharose beads, are relatively cheap, have high
binding capacity and can be regenerated and reused multiple times
– The GST tag has to be properly folded to bind glutathione, and thus the fusion
protein needs to be soluble and in non-denaturing conditions for efficient
purification
– Unlike for His-tagged proteins, EDTA can be used in buffers during sample
preparation to reduce proteolytic damage
– Care should also be taken to use reducing conditions since GST has four
solvent exposed cysteines that can be involved in oxidative aggregation

ELUTION:

under rather mild conditions
using free reduced glutathione
(10–40 mM) at neutral pH

•

Commercial anti-GST antibodies are also available for detecting

•

The kinetics of GST binding to glutathione and its elution are relatively
slow, and so GST fusion proteins need to be loaded and eluted from GST
columns at slow flow rates

When positioned at the C-terminal end, GST is less efficient at improving
protein solubility but still functions well as an affinity tag

Epitope tags
•

•
•

A number of short amino acid (aa) sequences, recognized by commercially
available antibodies, can be used as tags for detection and purification of
proteins
Can also be placed within a target protein (in loops or between structural
domains in a solvent exposed region)
Advantage:
– High specificity
– Use of short tags minimizes deleterious effects on the structure and
function of the target protein

•
•

Epitope tags are usually sequences absent in the host cell, making the
detection of the target protein straightforward
Epitope tag binding media typically involves monoclonal antibodies
immobilized on chromatographic resins; is expensive and less suitable for
large-scale preparations than other affinity media

•

Examples

•

The FLAG tag: short, eight-residue (DYKDDDDK) hydrophilic peptide tag that can
be used for detection and purification of target proteins

•

The HA-tag : Human influenza hemagglutinin (HA) is a surface glycoprotein
required for the infectivity of the human virus. The HA tag is derived from
the HA-molecule corresponding to amino acids 98-106

•

The c-Myc: A myc tag is a polypeptide protein tag derived from the c-myc
gene product that allows one to follow the protein with an antibody against
the Myc epitope

•

V5 epitope tag: Derived from a small epitope (Pk) present on the P and V proteins

of the paramyxovirus of simian virus 5 (SV5)
– The V5 tag is usually used with all 14 amino acids GKPIPNPLLGLDST), although it
has also been used with a shorter 9 amino acid sequence (IPNPLLGLD)

Solubility Tags
Several soluble proteins are used as tags to improve folding of the target protein;
These act as passive partners in the folding of target proteins
These tags should be used in conjunction with other approaches to improve
protein folding such as lowering temperature after protein induction or
coexpression of chaperones
None of these tags work universally with every partner protein.
Each solubility tag also has different effects, and several tags may need to be
tried for recalcitrant proteins
Studies have suggested that after removal of the tag solubility of aggregationprone target proteins appears to depend on the characteristics of the target
protein rather than the tag used

•
•
•

MBP tag
Trx tag
Other solubility tags

Maltose Binding Protein Tag

ranks as one of the best tags for making soluble fusions
•

MBP is a large 43 kDa secreted E. coli protein that can be expressed at
very high levels, and helps keep proteins fused at its C-terminal end
soluble

•

Can also be used for effective affinity purification, since it binds
specifically to maltose or amylose

•

Cross-linked amylose resin is used to bind MBP tagged proteins, and the
bound fusion protein can be easily eluted by adding 10 mM maltose to
the wash buffers

•

However, amylose affinity purification cannot be carried out with
reducing agents or under denaturing conditions

•

Amylose resins can be regenerated and reused several times.

Trx tag
•

Thioredoxin (Trx) is a thermostable, 12-kDa intracellular E. coli protein
that is easily overexpressed

•

Soluble even when overexpressed up to 40% of the total cellular protein
(LaVallie et al., 1993)

•

Very useful as a tag in avoiding inclusion body formation in recombinant
protein production

•

Thioredoxin accumulates at cytoplasmic membrane adhesion sites, which
allows Trx fusion proteins to be released by simple osmotic shock or
freeze/thaw treatments, providing a simple initial purification step

•

Tests by Dyson et al. (2004) indicate that the Trx tag is more effective
when placed on the N-terminal end of the target protein

Removal of Tags
•

It is often useful to remove it for biological and functional studies since
the tag can potentially interfere with the proper functioning of the target
protein

•

Most commercial expression vectors that are used to add tags on target
proteins also include cleavage sites with specific sequences that allow the
tag to be removed using recombinant endoproteases

•

After the initial affinity purification step, the sample can be treated with
the endoprotease to cleave off the tag, which can subsequently be
separated from the target protein by passing the sample back on the
affinity column and collecting the flow through

•

The recombinant endoprotease usually also comes with an affinity tag,
allowing for its easy removal after the cleavage reaction

•

Complete removal of C-terminal tags is more problematic, since most
endoproteases cut toward the C-terminal end of their recognition
sequence

•

Specialized cleavage sites can also be designed that take advantage of
structure-based recognition (such as with the SUMO protease; Malakhov
et al., 2004) or an autocatalytic protein self-splicing element (Inteins;
Saleh and Perler, 2006)

•

Both of these cleavage systems have been coupled with affinity
purification tags—
– the SUMO fusion system
– Intein-chitin-binding domain
– Intein-polyhydroxybutyrate-binding (PHB)

•

Tags can also be cleaved chemically
– Cyanogen bromide (CNBr): cleaves at methionines
– Hydroxylamine: cleaves the peptide bond between Asn and Gly

The IMPACT system
(Intein Mediated Purification with
an Affinity Chitin-binding Tag)

Some practical considerations during Tag removal…
•

Each construct has to be experimentally tested both for cleavage
efficiency, and for any secondary cleavages that may occur when
promiscuous proteases are used

•

Often, the level of the protease and the duration of incubation have to be
optimized

•

Optimization esp. becomes essential in the case of oligomeric proteins,
where tags have to be removed for each monomer for productive yields
of the target protein

•

The cleavage sequence also has to be sterically accessible to the protease
and relatively unstructured

•

poor cleavage can sometimes be alleviated by
– introducing a spacer or linker between the recognition site and the target protein,
– by using sequences around the cleavage site that are unlikely to form secondary
structures

MICROBIAL BIOTECHNOLOGY

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Similar to MICROBIAL BIOTECHNOLOGY

Similar to MICROBIAL BIOTECHNOLOGY (20)

Recently uploaded

Recently uploaded (20)

MICROBIAL BIOTECHNOLOGY

Editor's Notes