Jonathan Eisen talk on "Phylogenomics of Microbes" at Lake Arrowhead Small Genomes Meeting 2004
•Télécharger en tant que PPT, PDF•
1 j'aime•4,308 vues
Talk by Jonathan Eisen on Phylogenomics of microbes at Lake Arrowhead Small Genomes meeting in 2004.
Recommandé
Recommandé
Contenu connexe
Tendances
Tendances (20)
En vedette
En vedette (6)
Similaire à Jonathan Eisen talk on "Phylogenomics of Microbes" at Lake Arrowhead Small Genomes Meeting 2004
Similaire à Jonathan Eisen talk on "Phylogenomics of Microbes" at Lake Arrowhead Small Genomes Meeting 2004 (20)
Plus de Jonathan Eisen
Plus de Jonathan Eisen (20)
Dernier
Dernier (20)
Jonathan Eisen talk on "Phylogenomics of Microbes" at Lake Arrowhead Small Genomes Meeting 2004
- 1. The Axis of Evol: Uncultured Organisms, Phylogenetic Anchors and the Tree of Life TIGR
- 2. Famous Arrowhead 2004 Quotes • Space-time continuum of genes and genomes • Gene sequences are the wormhole that allows one to tunnel into the past • The human mind can conceive of things with no basis in physical reality • Thoughts can go faster than the speed of light QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. TIGR
- 3. TIGR
- 4. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. TIGR
- 5. Outline • Three phylogenomic tales, each with discovery and woe – Uncultured organisms I: complete genomes of symbionts – Uncultured organisms II: incomplete genomes and phylogenetic anchors – Predicting gene function • One approach that can help with all the woe TIGR
- 6. Phylogenomic Tale I: Sequencing Symbiont Genomes TIGR
- 7. Symbiont Genome Sequencing Warner Brothers, Inc. shotgun sequence TIGR
- 8. Wolbachia pipientis wMel TIGR Wu et al., 2004
- 9. Wolbachia Primer • Intracellular bacteria related to Rickettsias (e.g., agent of Typhus) • Found in many invertebrate species including insects, Arachnids, isopods, and nematodes • Transmitted vertically from mother to offspring, like mitochondria • Many Wolbachia inhibit male survival or reproduction, to promote transmission through females. • Wolbachia that infect parasitic filarial nematodes (e.g., Brugia malayi) are needed by the host. Treatment of people infected with these nematodes with bacterial antibiotics kills the Wolbachia and helps kill the nematode. TIGR
- 10. Wolbachia Mobile/Repetitive DNA Repeat Size Copies Protein motifs/families IS Family Possible Terminal Inverted Repeat Sequence Class (Median) 1 1512 3 Transposase IS4 5’ ATACGCGTCAAGTTAAG 3’ 2 360 12 - New 5’ GGCTTTGTTGCATCGCTA 3’ 3 858 9 Transposase IS492/IS110 5’ GGCTTTGTTGCAT 3’ 4 1404.5 4 Conserved hypothetical, New 5’ ATACCGCGAWTSAWTCGCGGTAT 3’ phage terminase 5 1212 15 Transposase IS3 5’ TGACCTTACCCAGAAAAAGTGGAGAGAAAG 3’ 6 948 13 Transposase IS5 5’ AGAGGTTGTCCGGAAACAAGTAAA 3’ 7 2405.5 8 RT/maturase - 8 468 45 - - 9 817 3 conserved hypothetical, ISBt12 transposase 10 238 2 ExoD - 11 225 2 RT/maturase - 12 1263 4 Transposase ??? 13 572.5 2 Transposase ??? None detected 14 433 2 Ankyrin - 15 201 2 - - 16 1400 6 RT/maturase - 17 721 2 transposase IS630 18 1191.5 2 EF-Tu - 19 230 2 hypothetical - TIGR Wu et al., 2004
- 11. TIGR
- 12. TIGR
- 13. TIGR
- 14. e S9. Ankyrin repeats in wMel proteins Number of Signal Highly Name Locus Annotation Repeats Peptide Expressed 00505 WD0035 ankyrin repeat domain protein 6 00554 WD0073 ankyrin repeat domain protein 5 00647 WD0147 ankyrin repeat domain protein 11 00700 WD0191 ankyrin repeat domain protein 1 00821 WD0285 prophage LambdaW1, ankyrin repeat domain protein 3 Y 00822 WD0286 prophage LambdaW1, ankyrin repeat domain protein 3 00827 WD0291 prophage LambdaW1, ankyrin repeat domain protein 5 00828 WD0292 prophage LambdaW1, ankyrin repeat domain protein 2 00830 WD0294 ankyrin repeat domain protein 9 00948 WD0385 ankyrin repeat domain protein 11 01014 WD0438 ankyrin repeat domain protein 2 01017 WD0441 ankyrin repeat domain protein 1 Y 01081 WD0498 ankyrin repeat domain protein 9 01104 WD0514 ankyrin repeat domain protein 6 01148 WD0550 ankyrin repeat domain protein 6 01171 WD0566 ankyrin repeat domain protein 2 01204 WD0596 prophage LambdaW4, ankyrin repeat domain protein 9 01255 WD0633 prophage LambdaW5, ankyrin repeat domain protein 4 01260 WD0636 prophage LambdaW5, ankyrin repeat domain protein 2 Y 01261 WD0637 prophage LambdaW5, ankyrin repeat domain protein 3 Y 01402 WD0754 ankyrin repeat domain protein 2 01414 WD0766 ankyrin repeat domain protein 8 00332 WD1213 ankyrin repeat domain protein, putative 1 Y TIGR
- 15. TIGR Wu et al., 2004
- 16. Selection Apparently Inefficient in wMel • Likely not due to higher mutation rate – Full suite of DNA repair genes • Likely not due to low amounts of homologous recombination – RecA present – Population studies suggest homologous recombination occurs • Wolbachia has multiple types of bottlenecks – Maternal transmission like obligate mutualists – Infectious sweeps of cytoplasmic incompatibility like pathogens TIGR Wu et al., 2004
- 17. Baumannia cicadellinicola genome project: 1° symbionts of the Glassy-winged Sharpshooter • Sap feeding insect •Carriers of Xylella fastidiosa that causes Pierce’s disease of grapevines •Listed as potential Agro- Terrorism Agent •There are >20000 sharpshooter species, Glassy-winged Sharpshooter within which intracellular symbiotic bacteria are wildspread TIGR
- 18. Baumania Genome Completed 1 600,000 100,000 500,000 200,000 400,000 300,000 Collaboration between Jonathan Eisen and Nancy Moran (U. TIGR Arizona). Analysis led by Dongying Wu in Eisen’s group.
- 19. “Whole genome” tree of insect endosymbionts TIGR
- 20. DNA repair genes Bu_APS Bu_Bp Bu_Sg Wi_gl Ca_bl gebc recG&ruvABC(recombinate repa ir) - - - - - recG&ruvABC methy - direct DNA repair(correct T - G) mutSL mutSLH mutSL - - mutSLH 8- Oxo_ dGTP prevention(mutT, MutY||MutM ) mutTY mutY mutTY - mutTY mutTM uvrD(or homolog rep) rep rep rep uvrD - uvrD recA - - - recA - recA phrB(UV pyrimidine dimer) phrB phrB - phrB - - recBCD recBCD recBCD recBCD recBCD recBCD recBCD mutL(mismatch repair) mutL mutL mutL - - mutL recJ(rec based exision,methy - direct repair) - - - recJ - recJ transcription -repair coupling factor(mfd) mfd mfd - mfd - - uracil -DNA - glycosylase(remove U from DNA) ung ung - ung ung ung site -specific DNA inversion stimulation(fis) fis - fis - - - dna recombination protein rmuc (inversion) - - - - rmuc rmuc TIGR
- 21. PEP + erythrose aroH aroB aroD aroE aroK aroA aroC chorismate pabB pabA pabC 4-phosphate folP folC folA folate folE folB folK GTP thiS thiF thiI L-cysteine thiS-COSH glyceraldehyde-3-phosphate dxs thiG thiH +pyruvate thiE ? thiamine thiamine L-tyrosine phosphate thiC thiD 5’-phosphoribosyl-5-aminoimidazole unknown bioC bioH pimeloyl coA bioF bioA bioD bioB biotin precursor L-glutamate gshA gshB + L-cysteine glutathione cysG siroheme gltX hemA hemL hemB hemC hemD hemE L-glutamate porphobilinogen uroporphyrinogen III coproporphyrinogen III hemN hemG hemH cyoE proporphyrinogen protoheme Heme O Succinyl CoA Delta-aminoevulinic + Glycine acid TIGR
- 22. Phylogenomic Tale II: Phylogenetic Anchors TIGR
- 23. rRNA and Uncultured Microbes TIGR Eisen et al. 1992
- 24. Phylogenetic Anchors TIGR Beja et al., 2000
- 25. TIGR
- 26. ArgA ArgB ArgC ArgD ArgE AarAB ArgF ArgG ArgH Glutamate Omithine Arg IvHI IlvC IlvD IlvE Pyruvate Val Ile Pyruvate Threonine IlvA + Alpha-Ketobutyrate HisC Phe PheA PEP + AroH AroB AroD AroE AroK AroA AroC Erythrose 4- Chorismate phosphate TrpE G TrpD TrpC Trp TrpA B C ThrA Asd ThrA ThrB Thr Thr Aspartate Homoserine Dap MetB A Dap MetC B D MetE Met apD Dap C Dap E D apF Lys Lys A HisG HisI HisA HisHF HisB HisC HisB HisD PRPP+ATP His Essential amino acid biosynthetic pathways TIGR
- 27. Another Symbiont Present 9359 clones that are not included in the final assembly Run_TA 7152 assembles (400 have been assembled) <1kb 6996 1kb-2kb 125 2kb-3kb 18 3kb-4kb 6 4kb-5kb 3 5kb-6kb 2 6kb-7kb 1 7kb-8kb 1 TIGR 150 Bacteroides/Chlorobi (njtree/blast)
- 28. C ThrA Asd ThrB Thr Thr Aspartate Homoserine Dap MetB A Dap MetC B D MetE Met apD Dap C Dap E D apF Lys Lys A TIGR
- 29. Phylogenetic Anchors and the Sargasso Sea Shotgun Sequencing Warner Brothers, Inc. shotgun sequence TIGR
- 30. rRNA as a Phylogenetic Anchor TIGR Venter et al., 2004
- 31. Shotgun Sequencing Allows Use of Alternative Anchors (e.g., RecA) TIGR Venter et al., 2004
- 32. Sargasso Phylotypes 0.5 0.45 0.4 0.35 EFG 0.3 EFTu HSP70 0.25 RecA RpoB 0.2 rRNA 0.15 Weighted % of Clones 0.1 0.05 0 CFB Chlorobi Firmicutes Chloroflexi Fusobacteria Spirochaetes Cyanobacteria Actinobacteria Euryarchaeota Crenarchaeota BetaproteobacteriaDeltaproteobacteria Alphaproteobacteria Epsilonproteobacteria Gammaproteobacteria Deinococcus-Thermus Major Phylogenetic Group TIGR Venter et al., 2004
- 33. Phylogenomic Tale III: Functional Prediction TIGR
- 34. Shotgun Sequencing Detects More Diversity than PCR-methods Venter et al., TIGR 2004
- 35. Functional Diversity of Proteorhodopsins? TIGR Venter et al., 2004
- 37. DNA Repair Genes in D. radiodurans Complete Genome Process Genes in D. radiodurans Nucleotide Excision Repair UvrABCD, UvrA2 Base Excision Repair AlkA, Ung, Ung2, GT, MutM, MutY-Nths, MPG AP Endonuclease Xth Mismatch Excision Repair MutS, MutL Recombination Initiation RecFJNRQ, SbcCD, RecD Recombinase RecA Migration and resolution RuvABC, RecG Replication PolA, PolC, PolX, phage Pol Ligation DnlJ dNTP pools, cleanup MutTs, RRase Other LexA, RadA, HepA, UVDE, MutS2 TIGR
- 38. Problem: List of DNA repair gene homologs in D. radiodurans genome is not significantly different from other bacterial genomes of the similar size TIGR
- 39. Proteobacteria TM6 OS-K ~40 Phyla Acidobacteria Termite Group OP8 of Bacteria Nitrospira Bacteroides Chlorobi Fibrobacteres Marine GroupA WS3 Gemmimonas Firmicutes Fusobacteria Actinobacteria OP9 Cyanobacteria Synergistes Deferribacteres Chrysiogenetes NKB19 Verrucomicrobia Chlamydia OP3 Planctomycetes Spriochaetes 0.1 Coprothmermobacter OP10 Thermomicrobia Chloroflexi TM7 Deinococcus-Thermus Dictyoglomus Aquificae Tree based on Thermudesulfobacteria Hugenholtz (2002) TIGR Thermotogae OP1 with some OP11 modifications.
- 40. Proteobacteria TM6 OS-K Acidobacteria Most DNA Termite Group OP8 Nitrospira metabolism Bacteroides Chlorobi Fibrobacteres studies in Marine GroupA WS3 Gemmimonas two Phyla Firmicutes Fusobacteria Actinobacteria OP9 Cyanobacteria Synergistes Deferribacteres Chrysiogenetes NKB19 Verrucomicrobia Chlamydia OP3 Planctomycetes Spriochaetes 0.1 Coprothmermobacter OP10 Thermomicrobia Chloroflexi TM7 Deinococcus-Thermus Dictyoglomus Aquificae Tree based on Thermudesulfobacteria Thermotogae Hugenholtz (2002) TIGR OP1 OP11 with some modifications.
- 41. Proteobacteria TM6 OS-K Acidobacteria Deinococcus Termite Group OP8 Nitrospira is very distant Bacteroides Chlorobi Fibrobacteres from well Marine GroupA WS3 Gemmimonas studied Firmicutes Fusobacteria groups Actinobacteria OP9 Cyanobacteria Synergistes Deferribacteres Chrysiogenetes NKB19 Verrucomicrobia Chlamydia OP3 Planctomycetes Spriochaetes 0.1 Coprothmermobacter OP10 Thermomicrobia Chloroflexi TM7 Deinococcus-Thermus Dictyoglomus Aquificae Tree based on Thermudesulfobacteria Thermotogae Hugenholtz (2002) TIGR OP1 OP11 with some modifications.
- 42. Gain and Loss of Repair Genes BACTERIA ARCHAEA EUKARYOTES Trepa Helpy Ecoli Human Mycpn Mycge Bacsu Borbu Synsp Neigo Metth Yeast Haein Metjn Arcfu Strpy -Ogt -AlkA -Nfo -AlkA -PhrI -Ogt -AlkA -AlkA -PhrI -Ogt -Ung -Xth -Rad25 -AlkA -Nfo -RecFRQN -Rad25? + us R -Nfo -TagI -RecQ +P53 -Vsr -RuvC UmuD + -Nfo -SbcD? dRecQ -SbcCD -Dut +Rad7 +Nei? -Rec -Lon dRad23 -LexA -SMS +CCE1 +RecE -SbcCD -LexA +MAG? tRecT? -UmuC -LexA +Spr tTagI ? tRad25 t3MG -PhrI -PhrII -PhrI -Ogt -PhrI -Ogg tUvrABCD Ada + -PhrII -AlkA -Ogt MutH + -PhrII? -AlkA -Xth -AlkA -Ung SbcB + -Fpg -MutLS -Nfo -Fpg -Nfo -RecFJORQN -Nfo -Dut -MutLS -Mfd -RecO -Lon -PhrI -RecFORQ -SbcCD -LexA -Ung? -PhrII -SbcCD -RecG -UmuC -MutLS -LexA -Dut -RecQ? + sr V -UmuC -PriA -Dut RecBCD? + -TagI+RecT -LexA -UmuC -SMS -MutT RFAs + -PhrII +TFIIH -RuvC +Rad4,10,14,16,23,26 CSA + Rad52,53,54 + +TagI? dPhr DNA-PK, Ku + SNF2 d TagI? + dMutS +Fpg dMutL UvrABCD + dRecA Mfd + RecFJNOR + Ung? + RuvABC + SSB, + +RecG Rad1 + +Dut? LigI + +Rad2 from mitochondria LexA + +Rad25? SSB + Ogg + +PriA LigII + +Dut? PhrI, PhrII + +Ogt +Ung, AlkA, MutY-Nth +AlkA +Xth, Nfo? +MutLS? +SbcCD +RecA +UmuC TIGR +MutT +Lon dMutSI/MutSII dRecA/SMS Eisen and Hanawalt, 1999 dPhrI/PhrII
- 43. Non-Homology Prediction: Phylogenetic Profiles • Step 1: Search all genes in organisms of interest against all other genomes • Ask: Yes or No, is each gene found in each other species • Cluster genes by distribution patterns (profiles) TIGR
- 44. Carboxydothermus hydrogenoformans • Isolated in Yellowstone • Thermophile (grows at 80°C) • Anaerobic • Grows on CO (Carbon Monoxide) • Produces hydrogen gas • Low GC gram postive species • Many Archaeal-like genes TIGR
- 45. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. TIGR
- 46. IV. Phylogenetic Based Genome Sequencing TIGR
- 47. Reminders 1.Phylogenetic anchors don’t work if you do not have data from across the tree (e.g., Sargasso study limited) 2.Non homology methods rely on diverse genomes 3.Novel processes need to be studied in novel lineages TIGR
- 48. Biased Sampling of Bacterial Genomes Hugenholtz 2002 • Of 40 bacterial phyla, most genome sequences come from only 3 groups • Sargasso Sea Study Limited By Poor Sampling of Species for Data in Genbank • Difficult to figure out what types of species may be present except when analyzing rRNA genes TIGR
- 49. Coprothmermobacter Dictyoglomus Thermomicrobia Chrysiogenetes Thermudesulfobacteria Deferribacteres Synergistes Nitrospira OP11 OP1 TM7 OP10 OP3 NKB19 OP9 WS3 Marine Group OP8 TermiteGroupA OS-K based TM6 project Thermotogae Aquificae Deinococcus-Thermus Spriochaetes Chlamydia Cyanobacteria Actinobacteria Fusobacteria Firmicutes Chlorobi Proteobacteria Chloroflexi Planctomycetes Verrucomicrobia Gemmimonas Fibrobacteres Bacteroides lineage Acidobacteria on Tree Uncultured In progress Published This 0.1 Hugenholtz (2002) • Solution: TIGR Tree of with some modifications. Life Project – Eisen and Ward, Co-PIs – Selecting genome projects to increase phylogenetic diversity – Supported by NSF Tree of Life Program – Genomes from 6 new phyla in closure – More information at http://www.tigr.org/tol TIGR
- 50. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. TIGR
- 51. TIGR $$$ J. C. Venter Fraser C. Frase Other people DOE M-I Benito ONR NSF N. Moran H. Tettelin N. Ward NIH F. Robb H. Ochman T.Read S. Salzberg J. Battista E. Orias J. Heidelberg D. Bryant R. Myers S. O’Neill O. White M. Eisen W. Martin I. Paulsen P. Hanawalt Eisen Group C. M. Cavanaugh Martin Wu Dongying Wu Mom and Dad James Sakwa TIGR Jonathan Badger
- 52. Duplication?SEQUENCES Species 3ACTUAL 6 IDENTIFY HOMOLOGS PREDICTION 5 peciesMETHOD EVOLUTION 4B EXAMPLE A B 3A CALCULATE GENE KNOWN 2CHOOSE GENE(S) OF FUNCTION 1ALIGNINFER LIKELY INTEREST 1EXAMPLE Ambiguous Duplication S 1A 3B 2B 1B 3A 2A 2 PHYLOGENENETIC OVERLAY TREE OF GENE FUNCTION (ASSUMED TO BEOFONTO TREE OF GENE(S) UNKNOWN) FUNCTIONS INTEREST Evolutionary Method TIGR
- 53. rRNA and Uncultured Microbes TIGR Eisen et al., 1992
Notes de l'éditeur
- Shotgun genome sequencing works by breaking a genome apart into millions of little pieces and then sequencing those pieces randomly
- Functional prediction using a gene tree is just like predicting the biology of a species using a species tree
- Shotgun genome sequencing works by breaking a genome apart into millions of little pieces and then sequencing those pieces randomly
- This is a tree of a rRNA gene that was found on a large DNA fragment isolated from the Monterey Bay. This rRNA gene groups in a tree with genes from members of the gamma Proteobacteria a group that includes E. coli as well as many environmental bacteria. This rRNA phylotype has been found to be a dominant species in many ocean ecosystems. clone from the Sargasso Sea. This shows that this
- Samples are unbiased
- Phil Hugenholtz wrote an excellent review paper in Genome Biology tracing which Phyla had genome sequences available. Proteobacteria have the most with Firmicutes next (these are the low GC gram positives like B. subtilis) and Actinobacteria (the high GC gram positives like M. tuberculosis) third.
- In Red are the Phyla of bacteria with cultured species but no genome sequences that we are sequencing as part of a NSF Tree of Life project. NOTE **** In White are the Phyla with no cultured representatives. ALSO NOTE **** This project is contingent upon having a good tree of bacteria.