PhyloJava : une application de phylogénie sur la grille DATAGRID WP10 - Biomedical applications in EU-DataGrid T. SILVESTR...
Un peu d ’ étymologie... <ul><li>Phylogenèse : [...] du grec  phulon   « race, tribu »  et  genèse , histoire évolutive de...
Exemples d ’arbres phylogenétique (Xenopus,(Gallus,(((Rattus,Mus),Bos),Homo)))
A quoi sert la phylogenétique ? <ul><li>reconstruire l ’ « arbre de la vie » </li></ul><ul><li>aide à la découverte de fon...
Calcul d ’ arbre phylogenétique CLUSTAL W (1.74) multiple sequence alignment Xenopus  ATGCATGGGCCAACATGACCAGGAGTTGGTGTCGGT...
PhyloJava <ul><li>PhyloJava est une application qui permet le  calcul d’arbres phylogenétiques  à partir de fichiers d’ali...
Méthodes de calcul <ul><li>Il existe 3 familles de méthodes : </li></ul><ul><ul><li>basées sur des distances (NJ,BIONJ) =>...
Tests de fiabilités des topologies : le « Bootstrap »
Pourquoi utiliser la grille DATAGRID ? <ul><li>permet de  lancer de longs calculs  de vraisemblances sans « saturer » les ...
Cahier des charges de l ’application (1) <ul><li>édition d ’ arbres et d’ alignement de séquences  => choix d ’une applica...
<ul><li>PhyloJava devrait être disponible au  printemps 2003  sous formes de paquetages téléchargeables à partir du  site ...
Architecture globale UI CGI ssh agent Inputfile Biomserv (SUN, Solaris) Pcgrid1 (Linux, RedHat 7.2) grid-proxy output tree...
Choix des méthodes
Sélection des paramètres
Statut des calculs en cours
Edition d’arbres
Tests préliminaires <ul><li>l’ algorithme  fastDNAml  (méthode de maximum de vraissemblance) a été testé sur la grille : <...
Résultats(1)
Résultats(2) <ul><li>pas de gain significatif de la grille par rapport à un ordinateur unique pour de faibles valeurs de b...
Perspectives <ul><li>PhyloJava est une application qui permettra d’utiliser les ressources de la grille de façon  transpar...
Prochain SlideShare
Chargement dans…5
×

PhyloJava : une application de phylogénie sur la grille DATAGRID

757 vues

Publié le

0 commentaire
0 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Vues
Nombre de vues
757
Sur SlideShare
0
Issues des intégrations
0
Intégrations
11
Actions
Partages
0
Téléchargements
6
Commentaires
0
J’aime
0
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

PhyloJava : une application de phylogénie sur la grille DATAGRID

  1. 1. PhyloJava : une application de phylogénie sur la grille DATAGRID WP10 - Biomedical applications in EU-DataGrid T. SILVESTRE, L. DURET Laboratoire de Biométrie et Biologie Evolutive (BBE) CNRS UMR 5558 - Lyon Réunion Datagrid France IN2P3 - Centre de calcul Lyon, 12 Février 2003
  2. 2. Un peu d ’ étymologie... <ul><li>Phylogenèse : [...] du grec phulon « race, tribu » et genèse , histoire évolutive des espèces, des lignées, et des groupes d ’organismes </li></ul><ul><ul><li>Définition du « Petit Robert », édition Juin 2000 </li></ul></ul><ul><li>La phylogénétique est donc la phylogenèse réalisée à partir des gènes (séquences nucléiques ou protéiques) </li></ul><ul><li>Les résultats sont souvent représentés par des arbres (sous formes parenthésées ou graphique) </li></ul>
  3. 3. Exemples d ’arbres phylogenétique (Xenopus,(Gallus,(((Rattus,Mus),Bos),Homo)))
  4. 4. A quoi sert la phylogenétique ? <ul><li>reconstruire l ’ « arbre de la vie » </li></ul><ul><li>aide à la découverte de fonction de nouveaux gènes </li></ul><ul><li>identification de souches bactériennes ou virales </li></ul><ul><li>traçabilité des aliments ( viandes, poissons…) </li></ul>
  5. 5. Calcul d ’ arbre phylogenétique CLUSTAL W (1.74) multiple sequence alignment Xenopus ATGCATGGGCCAACATGACCAGGAGTTGGTGTCGGTCCAAACAGCGTT---GGCTCTCTA Gallus ATGCATGGGCCAGCATGACCAGCAGGAGGTAGC---CAAAATAACACCAACATGCAAATG Bos ATGCATCCGCCACCATGACCAGCAGGAGGTAGCACCCAAAACAGCACCAACGTGCAAATG Homo ATGCATCCGCCACCATGACCAGCAGGAGGTAGCACTCAAAACAGCACCAACGTGCAAATG Mus ATGCATCCGCCACCATGACCAGCAGGAGGTAGCACTCAAAACAGCACCAACGTGCAAATG Rattus ATGCATCCGCCACCATGACCAGCGGGAGGTAGCTCTCAAAACAGCACCAACGTGCAAATG ****** **** ********* * *** * * *** * * * 
  6. 6. PhyloJava <ul><li>PhyloJava est une application qui permet le calcul d’arbres phylogenétiques à partir de fichiers d’alignements de séquences (protéiques ou nucléiques). </li></ul><ul><li>PhyloJava est constituée par 3 éléments : </li></ul><ul><ul><li>un client qui permet de visualiser et d’ éditer les alignements et les arbres phylogenétiques. </li></ul></ul><ul><ul><li>un serveur de méthodes phylogenétique qui exécute les calculs “rapides”. </li></ul></ul><ul><ul><li>une interface à la grille de calcul DATAGRID (UI : User Interface) permettant de soumettre des calculs plus “lourds”. </li></ul></ul>
  7. 7. Méthodes de calcul <ul><li>Il existe 3 familles de méthodes : </li></ul><ul><ul><li>basées sur des distances (NJ,BIONJ) => O(n 3 ) </li></ul></ul><ul><ul><li>maximum de parsimonie (DNAPars) </li></ul></ul><ul><ul><li>maximum de vraisemblance (FastDNAml) => O(p n ) n : num. of seq. </li></ul></ul><ul><li>Les méthodes basées sur le maximum de vraisemblance sont les plus exactes mais les plus longues à exécuter. </li></ul><ul><li>Difficile d’ évaluer la « robustesse » de l’arbre par un « bootstrap » qui nécessite le recalcul de plusieurs centaines d’arbres. </li></ul>
  8. 8. Tests de fiabilités des topologies : le « Bootstrap »
  9. 9. Pourquoi utiliser la grille DATAGRID ? <ul><li>permet de lancer de longs calculs de vraisemblances sans « saturer » les machines des laboratoires. </li></ul><ul><ul><li>disponibilité des ressources de calcul de la grille. </li></ul></ul><ul><li>accélérer le « bootstrap » en parallélisant le calcul des arbres artificiels. </li></ul><ul><ul><li>une valeur de bootstrap de 1000 => 1000 jobs sur la grille </li></ul></ul>
  10. 10. Cahier des charges de l ’application (1) <ul><li>édition d ’ arbres et d’ alignement de séquences => choix d ’une application plutôt qu ’un portail Web. </li></ul><ul><li>muti-plateformes => développement en JAVA. </li></ul><ul><li>une architecture client-serveur permet au client d’ afficher automatiquement les nouvelles méthodes implémentées sur le serveur. </li></ul><ul><li>réactivité => possibilité de choisir d ’ exécuter les jobs rapides sur le serveur PhyloJava et les plus longs sur la grille. </li></ul><ul><li>possibilité d’ interroger l’ état des calculs en cours </li></ul><ul><li>avertissement de la fin d’ un calcul par mail à l’ utilisateur. </li></ul>
  11. 11. <ul><li>PhyloJava devrait être disponible au printemps 2003 sous formes de paquetages téléchargeables à partir du site web de DATAGRID . </li></ul><ul><li>Possibilité de télécharger individuellement : </li></ul><ul><ul><li>le client => peut choisir de se connecter sur le server PhyloJava et utiliser des ressources de la grille à partir de l’ UI du BBE. </li></ul></ul><ul><ul><li>le serveur => pour implémenter les méthodes de son choix. </li></ul></ul><ul><ul><li>l’ UI de DATAGRID => pour accéder à la grille : peut être installée sur le serveur ou sur un ordinateur distant . Ce paquetage contiendra les scripts d’interfaçage entre l’ UI et le serveur. </li></ul></ul>Cahier des charges de l ’application (2)
  12. 12. Architecture globale UI CGI ssh agent Inputfile Biomserv (SUN, Solaris) Pcgrid1 (Linux, RedHat 7.2) grid-proxy output trees mail cert User User User DATAGRID Client PhyloJava Serveur PhyloJava Grille de calcul
  13. 13. Choix des méthodes
  14. 14. Sélection des paramètres
  15. 15. Statut des calculs en cours
  16. 16. Edition d’arbres
  17. 17. Tests préliminaires <ul><li>l’ algorithme fastDNAml (méthode de maximum de vraissemblance) a été testé sur la grille : </li></ul><ul><ul><li>fichier d’alignement nucléique de 22 séquences et 4697 sites. </li></ul></ul><ul><ul><li>valeurs de bootstrap de 2, 20 et 50. </li></ul></ul><ul><ul><li>version middleware DATAGRID : edg 1.2.2 </li></ul></ul><ul><ul><li>ordinateur utilisé pour la comparaison : SUN UltraEnterprise 450 (900Mhz). </li></ul></ul>
  18. 18. Résultats(1)
  19. 19. Résultats(2) <ul><li>pas de gain significatif de la grille par rapport à un ordinateur unique pour de faibles valeurs de bootstrap. </li></ul><ul><li>résultats encourageants pour des nombres de bootstrap de 50 => accélération des calculs par un facteur de 5 . </li></ul><ul><li>des tests à plus grandes échelles doivent être lancés avec des valeurs de bootstrap de 1000 . </li></ul>
  20. 20. Perspectives <ul><li>PhyloJava est une application qui permettra d’utiliser les ressources de la grille de façon transparente pour les biologistes. </li></ul><ul><li>installation facile => paquetage Java pour le client. </li></ul><ul><li>Limitations : lorsqu’ un élément d’un calcul est bloqué, c’est tout l’ ensemble des résultats qui est retardé. </li></ul><ul><ul><li>possibilité de détecter lorsqu’ une opération prends plus de temps que la normale et la relancer. </li></ul></ul><ul><ul><li>possibilité de stopper un calcul et récupérer un résultats intermédiaire sans perdre le bénéfice du calcul qui a déjà été fait… </li></ul></ul>

×