L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES Ludovic ORLANDO Décembre 2008 Paléog...
<ul><li>Inset tree, fix, photos </li></ul>STREPSIRHINIENS PEIGNE DENTAIRE TRUFFE A VIBRISSES HAPLORHINIENS PLACENTA HEMOCH...
INTRODUCTION SINGES ANTHROPOMORPHES, GRANDS SINGES & HOMMES 8MA 12-13MA HOMO (BIPEDIE PERMANENTE) PAN (KNUCKLE-WALK) PONGI...
INTRODUCTION GRANDS SINGES & HOMMES: DIVERSITE GENETIQUE <ul><li>>7 GINDIVIDUS </li></ul><ul><li>FAIBLE DIVERSITE GENETIQU...
<ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique...
L’HOMO SAPIENS EVENT LES ORIGINES FOSSILES 400 - 30 KYA OMO-1 OMO-2 Herto [email_address] Décembre 2008 196 ±2 104 ±1 154±...
L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) PREDICTION #1.  DIVERSITE AFRICAINE > AUTRES CONTINENTS [email_...
PREDICTION #2.  CROISSANCE  DE LA DISTANCE GENETIQUE A L’AFRIQUE ET  DECROISSANCE  DE LA DIVERSITE AVEC LA DISTANCE GEOGRA...
L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) AFRIQUE AFRIQUE + AUTRES CONTINENTS PREDICTION #3.  LIGNEES BAS...
L’HOMO SAPIENS EVENT LE MULTIREGIONALISME [email_address] Décembre 2008
L’HOMO SAPIENS EVENT LE MULTIREGIONALISME HOMO « ERECTUS » [email_address] Décembre 2008
L’HOMO SAPIENS EVENT LE MULTIREGIONALISME HOMO « ERECTUS » HOMO SAPIENS [email_address] Décembre 2008
L’HOMO SAPIENS EVENT LE MULTIREGIONALISME PREDICTION #4.  (MONOPHYLIE DES LIGNEES CONTINENTALES) & ORIGINE >1 MYA [email_a...
L’HOMO SAPIENS EVENT LES OBSERVATIONS: L’EVE AFRICAINE (PREDICTIONS #1 & #3) <ul><li>147 mtDNA </li></ul><ul><li>PROFILS D...
L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTIONS #1 & #3) [email_address] Décembre 2008
L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI GENEALOGIE DES GENES vs DES INDIVIDUS [email_address] Décembre 2008
L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI G 0 G 1 <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR C...
L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR COALESCEN...
L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI G 0 G 1 G 2 G 3 <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROC...
<ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS <...
L’HOMO SAPIENS EVENT LES OBSERVATIONS: L’APPORT DES DONNEES NUCLEAIRES (Nb. HT / REGION GENOMIQUE - 54 CHR.) 2,834 SNPs – ...
L’HOMO SAPIENS EVENT LES OBSERVATIONS: PREDICTION #2 <ul><li>51 POPULATIONS </li></ul><ul><li>377 MICROSATELLITES </li></u...
L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTION #4) PRESENT DIVERGENCE T MRCA  >= T DIVERGENCE MRCA MRCA 1 MRCA 2 [email...
L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTION #4) POINT DE CALIBRATION SI CONSTANCE DE L’HORLOGE: 171.5 KYA 52.0 KYA [...
L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTION #4) [email_address] Décembre 2008
L’HOMO SAPIENS EVENT UNE NOUVELLE CRITIQUE DE L’OUT OF AFRICA N HAPLOTYPES ~ DIVERSITE << NON-AFRICAINES AFRICAINES EXPANS...
L’HOMO SAPIENS EVENT L’APPORT DES POLYMORPHISMES DES PARASITES / COMMENSAUX <ul><li>HELICOBACTER PILORI </li></ul><ul><li>...
L’HOMO SAPIENS EVENT L’APPORT DES POLYMORPHISMES DES PARASITES / COMMENSAUX <ul><li>769 ISOLATS, DE 51 ETHNIES </li></ul><...
<ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique...
LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS ht ANCESTRAL DIVERSITE + FAIBLE APPARITION NOUVEAUX ht (+ RECENTS) EFFET FON...
LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS DIVERSITE + FAIBLE APPARITION NOUVEAUX ht (+ RECENTS) EFFET FONDATEUR POP2 P...
LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS DIVERSITE + FAIBLE APPARITION NOUVEAUX ht (+ RECENTS) EFFET FONDATEUR POP2 P...
LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS DIVERSITE + FAIBLE APPARITION NOUVEAUX ht (+ RECENTS) EFFET FONDATEUR POP2 P...
LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS DIVERSITE + FAIBLE APPARITION NOUVEAUX ht (+ RECENTS) EFFET FONDATEUR POP2 P...
LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS DATER LA MIGRATION: LE PRINCIPE DE LA FOUNDER ANALYSIS HYPOTHESE: MIGRATION ...
LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS RESEAU WORLDWIDE RESEAU POPULATION   F1 F2 F3 F4 F6 F5 F7 [email_address] D...
LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS RESEAU WORLDWIDE RESEAU POPULATION   F1 F2 F3 F4 F6 F5 F7 3 MUTATIONS in 4 ...
LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS [email_address] Décembre 2008
LIGNEES MATERNELLES LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS [email_address] Décembre 2008
LIGNEES PATERNELLES LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS https://www3.nationalgeographic.com/genographic/atlas.ht...
LA SORTIE D’AFRIQUE L’ORIGINE DE L’HABILLEMENT: LA SPECIATION POUX DE LA TÊTE / DU CORPS P. humanus capitis P. h. humanus ...
LA SORTIE D’AFRIQUE L’ORIGINE DE L’HABILLEMENT: LA SPECIATION POUX DE LA TÊTE / DU CORPS K2 NJ ND4 + CYTB H [email_address...
<ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique...
LA RENCONTRE AVEC NEANDERTAL DES SIGNATURES D’INTROGRESSIONS ANCIENNES PRESENT [email_address] Décembre 2008
LA RENCONTRE AVEC NEANDERTAL DES SIGNATURES D’INTROGRESSIONS ANCIENNES PRESENT HYBRIDATION [email_address] Décembre 2008
LA RENCONTRE AVEC NEANDERTAL DES SIGNATURES D’INTROGRESSIONS ANCIENNES PRESENT HYBRIDATION [email_address] Décembre 2008
LA RENCONTRE AVEC NEANDERTAL DES SIGNATURES D’INTROGRESSIONS ANCIENNES PRESENT HYBRIDATION [email_address] Décembre 2008
LA RENCONTRE AVEC NEANDERTAL DES SIGNATURES D’INTROGRESSIONS ANCIENNES Microcephalin D: Asp314His EXON 8 [email_address] D...
LA RENCONTRE AVEC NEANDERTAL DES HYBRIDATIONS AVEC D’AUTRES HOMMES DU PASSE ? LEVEL C = MOUSTERIEN CHATELPERRONIEN CHATELP...
LA RENCONTRE AVEC NEANDERTAL DES HYBRIDATIONS AVEC D’AUTRES HOMMES DU PASSE ? CRÂNE LARGEUR COURONNE DENTAIRE [email_addre...
3’OH 5’P N-GLYCOSIDIQUE PHOSPHODIESTER NUCLEOTIDE A T NICK G C 5’P .. .. .. AAAGTCGCGA TGCGCATAGCGATAGCAGCATATGCCCAGATATCG...
AMPLIFICATION (PCR) EXTRACTION SEQUENCAGE ANALYSE BIOINFORMATIQUE DEGRADATIONS TAPHONOMIQUES PROBLEMES DE CONTAMINATIONS S...
LES POPULATIONS D’HOMMES MODERNES DES HYBRIDATIONS AVEC D’AUTRES HOMMES DU PASSE ? Feldhofer I Vindija 75 Vindija 80 El Si...
LA RENCONTRE AVEC NEANDERTAL DES HYBRIDATIONS AVEC D’AUTRES HOMMES DU PASSE ? LARGEUR COURONNE DENTAIRE [email_address] Dé...
LES POPULATIONS D’HOMMES MODERNES HYBRIDATIONS ? L’APPORT GENOMIQUE END-REPAIR 1 2 [email_address] Décembre 2008
LES POPULATIONS D’HOMMES MODERNES HYBRIDATIONS ? L’APPORT GENOMIQUE Homo GENERIC PRIMERS [email_address] Décembre 2008
LES POPULATIONS D’HOMMES MODERNES HYBRIDATIONS ? L’APPORT GENOMIQUE [email_address] Décembre 2008
SNP T A A A C A >0.5 MY T <0.2 MY A SITUATION PASSEE, AU MOMENT DE L’HYBRIDATION SNP T A A C A >0.5 MY T <0.2 MY A SITUATI...
<ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique...
LES SPECIFICITES DE L’HOMME MODERNE GENOMIQUE COMPAREE A T A ? A 0.5MY Homme moderne  AGCTCTAACTGCTTATAGTCGTATACGCGCTA Néa...
LES SPECIFICITES DE L’HOMME MODERNE GENOMIQUE COMPAREE: HOMME vs CHIMPANZE [email_address] Décembre 2008 GAIN DE FONCTION ...
LES SPECIFICITES DE L’HOMME MODERNE GENOMIQUE COMPAREE: HOMME vs CHIMPANZE RECEPTEURS OLFACTIFS (>1,000 GENES) PSEUDOGENES...
PEDIGREE FAMILIAL KE ATTEINT LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE RIGHT RIGHT LEFT LEFT KE WORD REPETIT...
LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE: LE GENE FOX-P2 MUTATIONS NON-SYNONYMES DATATION 0-200 KYA [email_...
BONE #1253 BONE #1351c mtDNA 98 99 80 20 40 60 100 % % Homo PRIMERS <ul><li>FOUILLES MINISANT LA CONTAMINATION </li></ul><...
SNPs: X, Y, CHR. 8 AFRICA WORLWIDE CHR.8 / CHR. X T  C A  T C  A A  C -    T C  T T  G ANCESTRAL DERIVE ? LES SPECI...
LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE n=98 n=18 n=18 n=57 n=16 n=53 EXTRACT #1253 FOX-P2 AFRICA WORLWIDE...
LES SPECIFICITES DE L’HOMME MODERNE TRANSCRIPTOMIQUE COMPAREE [email_address] Décembre 2008
LES SPECIFICITES DE L’HOMME MODERNE TRANSCRIPTOMIQUE COMPAREE SELECTION SEXUELLE ? CONTRE-SELECTION DES CHANGEMENTS DE NIV...
PERSPECTIVES L’UTILISATION DES OUTILS: UN TRAIT PARTAGE AVEC LES CHIMPANZES <ul><li>TENTATIVE D’OUVERTURE DE LA RUCHE (MAR...
PERSPECTIVES UNE GRANDE TENDANCE: L’AUGMENTATION DU V CEREBRAL <ul><li>AUGMENTATION DU VOLUME CEREBRAL </li></ul>[email_ad...
PERSPECTIVES UN NOUVEAU VENU: HOMO FLORESIENSIS 380-410cc ~1m INDIVIDU MALADE / DIFORME ? MICROCEPHALIE  PIGMEES INDIVIDU ...
PERSPECTIVES UN NOUVEAU VENU: HOMO FLORESIENSIS MICROCEPHALES <ul><li>ANALYSES MULTIVARIEES </li></ul><ul><li>7 MESURES CR...
PERSPECTIVES DE L’ADN D’AUTRES HOMMES PREHISTORIQUES ? Homo heidelbergensis Atapuerca (350-500 KYA) Homo floresiensis Flor...
Prochain SlideShare
Chargement dans…5
×

ConfEvolutionHumaineOrlando

4 158 vues

Publié le

Publié dans : Formation, Technologie
0 commentaire
0 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Vues
Nombre de vues
4 158
Sur SlideShare
0
Issues des intégrations
0
Intégrations
3 255
Actions
Partages
0
Téléchargements
13
Commentaires
0
J’aime
0
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

ConfEvolutionHumaineOrlando

  1. 1. L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES Ludovic ORLANDO Décembre 2008 Paléogénétique et Evolution moléculaire (33)4 72 72 84 65 [email_address] [email_address] Décembre 2008
  2. 2. <ul><li>Inset tree, fix, photos </li></ul>STREPSIRHINIENS PEIGNE DENTAIRE TRUFFE A VIBRISSES HAPLORHINIENS PLACENTA HEMOCHORIAL PROSIMIENS SIMIIFORMES ORBITE REDUITE, FERMEE DVT CEREBRAL SINGES ANTHROPOMORPHES LORIS, GALAGO TARSIERS SINGES DU OW PLATYRRHINIENS QUEUE PREHENSILE NARINES CLOISONNEES SINGES DU NW LEMURIENS INTRODUCTION LA PLACE DE L’HOMME PARMI LES PRIMATES CATARRHINIENS NARINES VERS LE BAS, FINE CLOISON PROCONSUL KENYA HOMINOÏDES COCCYX AEGYPTOPITHECUS EGYPTE [email_address] Décembre 2008
  3. 3. INTRODUCTION SINGES ANTHROPOMORPHES, GRANDS SINGES & HOMMES 8MA 12-13MA HOMO (BIPEDIE PERMANENTE) PAN (KNUCKLE-WALK) PONGIDES HOMINIDES (FAMILLE) HOMININES (TRIBU) HOMINOÏDES ~ SINGES ANTHROPOMORPHES (SUPERFAMILLE) SINGE ‘INFERIEUR’ GRANDS SINGES GIBBONS SIAMANG [email_address] Décembre 2008
  4. 4. INTRODUCTION GRANDS SINGES & HOMMES: DIVERSITE GENETIQUE <ul><li>>7 GINDIVIDUS </li></ul><ul><li>FAIBLE DIVERSITE GENETIQUE </li></ul>Xq13.3 mtDNA HVR-1 HOMMES MODERNES [email_address] Décembre 2008 70 30 5 10 14
  5. 5. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  6. 6. L’HOMO SAPIENS EVENT LES ORIGINES FOSSILES 400 - 30 KYA OMO-1 OMO-2 Herto [email_address] Décembre 2008 196 ±2 104 ±1 154±7 >160 Homo neanderthalensis Homo «erectus» Homo sapiens
  7. 7. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  8. 8. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  9. 9. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  10. 10. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) [email_address] Décembre 2008
  11. 11. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) PREDICTION #1. DIVERSITE AFRICAINE > AUTRES CONTINENTS [email_address] Décembre 2008
  12. 12. PREDICTION #2. CROISSANCE DE LA DISTANCE GENETIQUE A L’AFRIQUE ET DECROISSANCE DE LA DIVERSITE AVEC LA DISTANCE GEOGRAPHIQUE L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) D GEN DV GEN D GEO /AFRIQUE D GEO INTERPOP. INTRAPOP. [email_address] Décembre 2008
  13. 13. L’HOMO SAPIENS EVENT L’OUT OF AFRICA (REMPLACEMENT RAPIDE) AFRIQUE AFRIQUE + AUTRES CONTINENTS PREDICTION #3. LIGNEES BASALES EN AFRIQUE UNIQUEMENT & ORIGINE <200 KYA [email_address] Décembre 2008
  14. 14. L’HOMO SAPIENS EVENT LE MULTIREGIONALISME [email_address] Décembre 2008
  15. 15. L’HOMO SAPIENS EVENT LE MULTIREGIONALISME HOMO « ERECTUS » [email_address] Décembre 2008
  16. 16. L’HOMO SAPIENS EVENT LE MULTIREGIONALISME HOMO « ERECTUS » HOMO SAPIENS [email_address] Décembre 2008
  17. 17. L’HOMO SAPIENS EVENT LE MULTIREGIONALISME PREDICTION #4. (MONOPHYLIE DES LIGNEES CONTINENTALES) & ORIGINE >1 MYA [email_address] Décembre 2008
  18. 18. L’HOMO SAPIENS EVENT LES OBSERVATIONS: L’EVE AFRICAINE (PREDICTIONS #1 & #3) <ul><li>147 mtDNA </li></ul><ul><li>PROFILS DE RESTRICTION </li></ul><ul><li>DIVERSITE + DISTANCES ENTRE COUPLES </li></ul>[email_address] Décembre 2008
  19. 19. L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTIONS #1 & #3) [email_address] Décembre 2008
  20. 20. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI GENEALOGIE DES GENES vs DES INDIVIDUS [email_address] Décembre 2008
  21. 21. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI G 0 G 1 <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR COALESCENCE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>[email_address] Décembre 2008
  22. 22. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR COALESCENCE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>G 0 G 1 G 2 [email_address] Décembre 2008
  23. 23. L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI G 0 G 1 G 2 G 3 <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>APPROCHE PAR COALESCENCE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>[email_address] Décembre 2008
  24. 24. <ul><li>MODELISATION MULTIREGIONALE SIMPLE </li></ul><ul><li>2 POPULATIONS </li></ul><ul><li>1 MIGRATION / 2 GENERATIONS </li></ul><ul><li>TAILLE CONSTANTE </li></ul>1 LOCUS: P(Racine Africaine) ~ ¼ x ½ ~ 0.125 2 LOCI: P(Racine Africaine) ~ (¼ x ½)² ~ 0.016 L’HOMO SAPIENS EVENT 1 LOCUS vs N LOCI [email_address] Décembre 2008
  25. 25. L’HOMO SAPIENS EVENT LES OBSERVATIONS: L’APPORT DES DONNEES NUCLEAIRES (Nb. HT / REGION GENOMIQUE - 54 CHR.) 2,834 SNPs – 12Mb – 927 INDIVIDUS [email_address] Décembre 2008
  26. 26. L’HOMO SAPIENS EVENT LES OBSERVATIONS: PREDICTION #2 <ul><li>51 POPULATIONS </li></ul><ul><li>377 MICROSATELLITES </li></ul>INTRAPOP. [email_address] Décembre 2008
  27. 27. L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTION #4) PRESENT DIVERGENCE T MRCA >= T DIVERGENCE MRCA MRCA 1 MRCA 2 [email_address] Décembre 2008
  28. 28. L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTION #4) POINT DE CALIBRATION SI CONSTANCE DE L’HORLOGE: 171.5 KYA 52.0 KYA [email_address] Décembre 2008
  29. 29. L’HOMO SAPIENS EVENT LES OBSERVATIONS (PREDICTION #4) [email_address] Décembre 2008
  30. 30. L’HOMO SAPIENS EVENT UNE NOUVELLE CRITIQUE DE L’OUT OF AFRICA N HAPLOTYPES ~ DIVERSITE << NON-AFRICAINES AFRICAINES EXPANSION DEMOGRAPHIQUE EXPANSION DEMOGRAPHIQUE [email_address] Décembre 2008
  31. 31. L’HOMO SAPIENS EVENT L’APPORT DES POLYMORPHISMES DES PARASITES / COMMENSAUX <ul><li>HELICOBACTER PILORI </li></ul><ul><li>INFECTIONS STOMACHALES </li></ul><ul><li>ULCERES </li></ul><ul><li>TRANSMISSION ~ MATERNELLE (VERTICALE) </li></ul>[email_address] Décembre 2008
  32. 32. L’HOMO SAPIENS EVENT L’APPORT DES POLYMORPHISMES DES PARASITES / COMMENSAUX <ul><li>769 ISOLATS, DE 51 ETHNIES </li></ul><ul><li>DIFFERENCIATION GENETIQUE DIMINUE AUGMENTE AVEC LA DISTANCE GEOGRAPHIQUE </li></ul><ul><li>DIVERSITE GENETIQUE DIMINUE DE L’AFRIQUE AUX AUTRES CONTINENTS </li></ul>[email_address] Décembre 2008
  33. 33. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  34. 34. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS ht ANCESTRAL DIVERSITE + FAIBLE APPARITION NOUVEAUX ht (+ RECENTS) EFFET FONDATEUR POP2 POP1 [email_address] Décembre 2008
  35. 35. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS DIVERSITE + FAIBLE APPARITION NOUVEAUX ht (+ RECENTS) EFFET FONDATEUR POP2 POP1 ht ANCESTRAL [email_address] Décembre 2008
  36. 36. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS DIVERSITE + FAIBLE APPARITION NOUVEAUX ht (+ RECENTS) EFFET FONDATEUR POP2 POP1 ht ANCESTRAL [email_address] Décembre 2008
  37. 37. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS DIVERSITE + FAIBLE APPARITION NOUVEAUX ht (+ RECENTS) EFFET FONDATEUR POP2 POP1 ht ANCESTRAL [email_address] Décembre 2008
  38. 38. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS DIVERSITE + FAIBLE APPARITION NOUVEAUX ht (+ RECENTS) EFFET FONDATEUR POP2 POP1 ht ANCESTRAL [email_address] Décembre 2008
  39. 39. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS DATER LA MIGRATION: LE PRINCIPE DE LA FOUNDER ANALYSIS HYPOTHESE: MIGRATION UNIQUE, INSTANTANEE RESEAU WORLDWIDE RESEAU POPULATION  [email_address] Décembre 2008
  40. 40. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS RESEAU WORLDWIDE RESEAU POPULATION  F1 F2 F3 F4 F6 F5 F7 [email_address] Décembre 2008
  41. 41. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS RESEAU WORLDWIDE RESEAU POPULATION  F1 F2 F3 F4 F6 F5 F7 3 MUTATIONS in 4 INDIVIDUS 3 in 4 2 in 3 3 in 3 2 in 3 3 in 4 2 in 2 SI TOUS LES Fi PROVIENNENT DE LA MÊME POPULATION & HORLOGE MOLECULAIRE (1 MUT / 20,000 ANS) ALORS LA POPULATION  A ETE FONDEE IL Y A 18/23*20,000 ~ 15,562 ANS 18 in 23 [email_address] Décembre 2008
  42. 42. LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS [email_address] Décembre 2008
  43. 43. LIGNEES MATERNELLES LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS [email_address] Décembre 2008
  44. 44. LIGNEES PATERNELLES LA SORTIE D’AFRIQUE L’HISTOIRE DES MIGRATIONS https://www3.nationalgeographic.com/genographic/atlas.html [email_address] Décembre 2008
  45. 45. LA SORTIE D’AFRIQUE L’ORIGINE DE L’HABILLEMENT: LA SPECIATION POUX DE LA TÊTE / DU CORPS P. humanus capitis P. h. humanus P. h. corporis HABILLEMENT B H [email_address] Décembre 2008
  46. 46. LA SORTIE D’AFRIQUE L’ORIGINE DE L’HABILLEMENT: LA SPECIATION POUX DE LA TÊTE / DU CORPS K2 NJ ND4 + CYTB H [email_address] Décembre 2008
  47. 47. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  48. 48. LA RENCONTRE AVEC NEANDERTAL DES SIGNATURES D’INTROGRESSIONS ANCIENNES PRESENT [email_address] Décembre 2008
  49. 49. LA RENCONTRE AVEC NEANDERTAL DES SIGNATURES D’INTROGRESSIONS ANCIENNES PRESENT HYBRIDATION [email_address] Décembre 2008
  50. 50. LA RENCONTRE AVEC NEANDERTAL DES SIGNATURES D’INTROGRESSIONS ANCIENNES PRESENT HYBRIDATION [email_address] Décembre 2008
  51. 51. LA RENCONTRE AVEC NEANDERTAL DES SIGNATURES D’INTROGRESSIONS ANCIENNES PRESENT HYBRIDATION [email_address] Décembre 2008
  52. 52. LA RENCONTRE AVEC NEANDERTAL DES SIGNATURES D’INTROGRESSIONS ANCIENNES Microcephalin D: Asp314His EXON 8 [email_address] Décembre 2008 DIVERGENT Homo POPULATION FUTURE Homo sapiens POPULATION
  53. 53. LA RENCONTRE AVEC NEANDERTAL DES HYBRIDATIONS AVEC D’AUTRES HOMMES DU PASSE ? LEVEL C = MOUSTERIEN CHATELPERRONIEN CHATELPERRONIEN AURIGNACIEN POINTES COEXISTENCE MOUSTERIEN ~ NEANDERTAL CHATELPERRONIEN ~ NEANDERTAL AURIGNACIEN ~ SAPIENS [email_address] Décembre 2008
  54. 54. LA RENCONTRE AVEC NEANDERTAL DES HYBRIDATIONS AVEC D’AUTRES HOMMES DU PASSE ? CRÂNE LARGEUR COURONNE DENTAIRE [email_address] Décembre 2008 NEANDERTALIENS 1ERS HOMMES SAPIENS D’EUROPE GRAVETTIEN (HOMMES SAPIENS) MUERII OASE 2 MLADEC
  55. 55. 3’OH 5’P N-GLYCOSIDIQUE PHOSPHODIESTER NUCLEOTIDE A T NICK G C 5’P .. .. .. AAAGTCGCGA TGCGCATAGCGATAGCAGCATATGCCCAGATATCG GATATCGCG A SITE ABASIQUE T 5’-PROTRUDENTES 5’P A T NICK  -ELIMINATION DESAMINATIONS (URACILES) AUTTCGCGATATC CGATATCTGGGCATAGGCTGCTAT h GCTATGCGCATTCGCGACTTT G G C C CROSSLINK ADN-ADN T h OXYDATIONS (HYDANTOINES) d [email_address] Décembre 2008 A U T T A T 3’OH a e f c b
  56. 56. AMPLIFICATION (PCR) EXTRACTION SEQUENCAGE ANALYSE BIOINFORMATIQUE DEGRADATIONS TAPHONOMIQUES PROBLEMES DE CONTAMINATIONS SALLES BLANCHES LA RENCONTRE AVEC NEANDERTAL MANIPULER DE L’ADN FOSSILE [email_address] Décembre 2008
  57. 57. LES POPULATIONS D’HOMMES MODERNES DES HYBRIDATIONS AVEC D’AUTRES HOMMES DU PASSE ? Feldhofer I Vindija 75 Vindija 80 El Sidron 1252 Mt. Lessini Mezmaïskaya Feldhofer II Okladnikov Scladina Teshik Tash Homo sapiens 0.005 HVR-1 660 KYA [email_address] Décembre 2008
  58. 58. LA RENCONTRE AVEC NEANDERTAL DES HYBRIDATIONS AVEC D’AUTRES HOMMES DU PASSE ? LARGEUR COURONNE DENTAIRE [email_address] Décembre 2008 MLADEC NEANDERTALIENS 1ERS HOMMES SAPIENS D’EUROPE GRAVETTIEN (HOMMES SAPIENS)
  59. 59. LES POPULATIONS D’HOMMES MODERNES HYBRIDATIONS ? L’APPORT GENOMIQUE END-REPAIR 1 2 [email_address] Décembre 2008
  60. 60. LES POPULATIONS D’HOMMES MODERNES HYBRIDATIONS ? L’APPORT GENOMIQUE Homo GENERIC PRIMERS [email_address] Décembre 2008
  61. 61. LES POPULATIONS D’HOMMES MODERNES HYBRIDATIONS ? L’APPORT GENOMIQUE [email_address] Décembre 2008
  62. 62. SNP T A A A C A >0.5 MY T <0.2 MY A SITUATION PASSEE, AU MOMENT DE L’HYBRIDATION SNP T A A C A >0.5 MY T <0.2 MY A SITUATION ACTUELLE, APRES HYBRIDATION: ► INTROGRESSION NEANDERTALIENNE DANS LE POOL GENIQUE SAPIENS ► SEGREGATION DE POLYMORPHISMES ARCHAÎQUES CHEZ NEANDERTAL C C LES POPULATIONS D’HOMMES MODERNES HYBRIDATIONS ? L’APPORT GENOMIQUE [email_address] Décembre 2008
  63. 63. <ul><li>L’Homo sapiens EVENT </li></ul><ul><li>Out of Africa vs Multirégionalisme </li></ul><ul><li>2. La sortie d’Afrique </li></ul><ul><li>3. La rencontre avec les autres hommes fossiles </li></ul><ul><li>4. L’origine génomique de nos particularités </li></ul><ul><li>L’homme et le chimpanzé: si loins, si proches… </li></ul>L’EVOLUTION DE LA LIGNEE HUMAINE: L’HOMME, LA PALEONTOLOGIE, LES GENES ET LES GENOMES [email_address] Décembre 2008
  64. 64. LES SPECIFICITES DE L’HOMME MODERNE GENOMIQUE COMPAREE A T A ? A 0.5MY Homme moderne AGCTCTAACTGCTTATAGTCGTATACGCGCTA Néandertal .........A...................... Australopithèque ???????????????????????????????? Chimpanzé .........A...................... Gorille .........A...................... ? T A ? A 6-8MY A A A A A ? ? A SANS GENOME NEANDERTALIEN AVEC GENOME NEANDERTALIEN ? ALIGNEMENT D’UNE REGION HOMOLOGUE DU GENOME [email_address] Décembre 2008
  65. 65. LES SPECIFICITES DE L’HOMME MODERNE GENOMIQUE COMPAREE: HOMME vs CHIMPANZE [email_address] Décembre 2008 GAIN DE FONCTION Ex. LANGAGE PERTE DE FONCTION Ex. PILLOSITE REGULATION
  66. 66. LES SPECIFICITES DE L’HOMME MODERNE GENOMIQUE COMPAREE: HOMME vs CHIMPANZE RECEPTEURS OLFACTIFS (>1,000 GENES) PSEUDOGENES [ / 50] %DIVERGENCE MOINDRE DEPENDANCE CHEMOSENSORIELLE >2 INDIVIDUS / ESPECE [email_address] Décembre 2008
  67. 67. PEDIGREE FAMILIAL KE ATTEINT LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE RIGHT RIGHT LEFT LEFT KE WORD REPETITION TEST CEREBELLUM MEDULLA FOREBRAIN [email_address] Décembre 2008
  68. 68. LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE: LE GENE FOX-P2 MUTATIONS NON-SYNONYMES DATATION 0-200 KYA [email_address] Décembre 2008
  69. 69. BONE #1253 BONE #1351c mtDNA 98 99 80 20 40 60 100 % % Homo PRIMERS <ul><li>FOUILLES MINISANT LA CONTAMINATION </li></ul><ul><li>ESTIMATION EXPERIMENTALE DU NIVEAU DE CONTAMINATION </li></ul>LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE [email_address] Décembre 2008 0 20 40 60 80 100
  70. 70. SNPs: X, Y, CHR. 8 AFRICA WORLWIDE CHR.8 / CHR. X T  C A  T C  A A  C -  T C  T T  G ANCESTRAL DERIVE ? LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE n=98 n=18 n=18 % PCRs INDEPENDENTES QUASI-ABSENCE DE CONTAMINATION PAR DE L’ADN MODERNE n=53 EXTRACT #1253 [email_address] Décembre 2008
  71. 71. LES SPECIFICITES DE L’HOMME MODERNE LE LANGAGE ARTICULE n=98 n=18 n=18 n=57 n=16 n=53 EXTRACT #1253 FOX-P2 AFRICA WORLWIDE ANCESTRAL DERIVE % PCRs INDEPENDENTES C 911 A 977 C 911 A 977 A 911 G 977 A 911 G 977 A 911 G 977 [email_address] Décembre 2008
  72. 72. LES SPECIFICITES DE L’HOMME MODERNE TRANSCRIPTOMIQUE COMPAREE [email_address] Décembre 2008
  73. 73. LES SPECIFICITES DE L’HOMME MODERNE TRANSCRIPTOMIQUE COMPAREE SELECTION SEXUELLE ? CONTRE-SELECTION DES CHANGEMENTS DE NIVEAUX D’EXPRESSION SP j SP k GENE i DISTANCES PAR COUPLES DE VALEUR [email_address] Décembre 2008
  74. 74. PERSPECTIVES L’UTILISATION DES OUTILS: UN TRAIT PARTAGE AVEC LES CHIMPANZES <ul><li>TENTATIVE D’OUVERTURE DE LA RUCHE (MARTELEMENT) </li></ul><ul><li>FABRICATION D’UN 2 ND OUTIL (TAILLE ADAPTEE) </li></ul><ul><li>FABRICATION D’UN 3 EME OUTIL </li></ul>4. RECUPERATION DU MIEL ( ABEILLES SANS DARD) SEQUENCE DE 3 OUTILS POUR EFFECTUER UNE ACTION [email_address] Décembre 2008
  75. 75. PERSPECTIVES UNE GRANDE TENDANCE: L’AUGMENTATION DU V CEREBRAL <ul><li>AUGMENTATION DU VOLUME CEREBRAL </li></ul>[email_address] Décembre 2008
  76. 76. PERSPECTIVES UN NOUVEAU VENU: HOMO FLORESIENSIS 380-410cc ~1m INDIVIDU MALADE / DIFORME ? MICROCEPHALIE PIGMEES INDIVIDU SAIN ? NANISME INSULAIRE F, 30 ANS [email_address] Décembre 2008
  77. 77. PERSPECTIVES UN NOUVEAU VENU: HOMO FLORESIENSIS MICROCEPHALES <ul><li>ANALYSES MULTIVARIEES </li></ul><ul><li>7 MESURES CRÂNIENNES </li></ul><ul><li>(97.1%,1.7%) – (72.7%,12.4%) </li></ul>H. ergaster H. habilis H. ergaster H. ergaster H. habilis 8/6 2/1 9 MICROCEPHALES 11 NON-MICROCEPHALES * * TOMOGRAPHIE 3D [email_address] Décembre 2008
  78. 78. PERSPECTIVES DE L’ADN D’AUTRES HOMMES PREHISTORIQUES ? Homo heidelbergensis Atapuerca (350-500 KYA) Homo floresiensis Flores (12-95 KYA) Larson et al. Proc Natl Acad Sci U S A. 2007 Sep 25 Valdiosera et al. Biol Lett. 2006 Dec 22 [email_address] Décembre 2008

×