SlideShare une entreprise Scribd logo
1  sur  57
Breast cancer genetic testing:
Is it right for you?
Patty Tenofsky, MD FACS
Women‘s Connection
October 8, 2013
Angelina Jolie
Marcheline Bertrand
Angelina Jolie‘s decision
• “The truth is I carry a „faulty‟ gene, BRCA 1,
which sharply increases my risk of
developing breast cancer and ovarian
cancer.”
• Her mother had previously battled breast cancer, but
then developed ovarian cancer at age 49 and died of
the disease at age 56
• Her Grandmother died of ovarian cancer at age 45
• Her maternal aunt died of breast cancer
• She chose to have bilateral preventive double
mastectomies.
• She plans to have her ovaries removed once she has
decided that she does not want any more children.
Christina Applegate
• She was diagnosed
with breast cancer,
and then found to
have the BRCA 1
gene at age 36
• She chose to have
bilateral
mastectomies
Breast & Ovarian Cancer
• 200,000 cases of Breast Cancer/year in the U.S.
– Lifetime risk is around 10-13%
– Risk factors
• Being a woman and getting older
• Family history, early menarche, late or no
pregnancy, hormone replacement, alcohol use,
obesity, lack of exercise
• 25,000 cases of Ovarian Cancer/year in the U.S.
– Lifetime risk is <2%
Most Women Develop Breast Cancer
WITHOUT a Family History
Hereditary Breast & Ovarian
Cancer Syndrome (BRCA)
• Characterized by significantly
increased risks for breast and ovarian
cancer
– 1:800 people in the general population
have a BRCA genetic mutation
– 1:40 people of Eastern European Jewish
descent will have the gene.
• Most cases are caused by a BRCA1
or BRCA2 mutation
• Clinical testing is available to identify
individuals with mutations
DNA
• Double Helix
• Made up of 4 building blocks
that get together in pairs
– Adenine (A), thymine (T) ,
guanine (G), cytosine (C)
• These 4 ―letters‖ create a
―word‖ that codes for a certain
amino acid. Amino Acids are
the building blocks of our
proteins – these proteins are
what lead to our characteristics
and features
• Misplaced letters or words can
lead to severely incorrect
proteins (mutations)
Sickle Cell Anemia – only
one base code incorrect
What is the purpose of our
normal BRCA genes?
• BRCA gene‘s purpose: It codes for proteins
that function to fight changes in your DNA that
can lead to breast and ovarian cancer.
– Changes may occur in your DNA which can
lead to cancer when normal cells divide and
are exposed to cancer inducing substances
– BRCA gene is therefore a cancer fighter
• BRCA gene that is mutated: The body is less
able to find and repair mistakes and cancer is
more likely.
Background
• 1990 – Families who had many women
with breast and ovarian cancer underwent
DNA studies and scientists identified the
first gene associated with breast cancer:
BRCA 1 on Chromosome 17.
• 1994 – BRCA 2 gene was discovered on
Chromosome 13.
• Jewish families were found to have a
much higher rate of the gene mutations.
• By the late 1990s – we were able to test
for the gene mutations.
Human Chromosomes
Laboratory Testing for
Genetic Mutations
• BRCA1: > 5,500 bp– AGCTCGCTGAGACTTCCTGGACCCCGCACCAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAGTTCATTGGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCC
ATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTG
TGCTTTTCAGCTTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTC
TCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCA
AAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAG
AACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGTAGATCTGAATGCTGATCCCCTGTGTGAGAGAAAA
GAATGGAATAAGCAGAAACTGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATGCCAAAGTAGCTGATGTATTGGACGTTCTA
AATGAGGTAGATGAATATTCTGGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTTAATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTGAAGACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAACTTAAGCCATGTAACTGAAAATCTAAT
TATAGGAGCATTTGTTACTGAGCCACAGATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGGAGACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTGGCAGTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGGAGCAGAATGGTCAAGTGATGAAT
ATTACTAATAGTGGTCATGAGAATAAAACAAAAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCACTCGAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAGTATAAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAAGCACCTAAAAAGAATAGGCTGAGGAG
GAAGTCTTCTACCAGGCATATTCATGCGCTTGAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCAAATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACCAAATGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAACCTGCAACTGGAGCC
AAGAAGAGTAACAAGCCAAATGAACAGACAAGTAAAAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTCTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGC
TGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTGGTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCACTCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAGCATTTGA
AAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGAAATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGTCGGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATTTGCAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAAT
CCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTT
GATAATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTCAGTTCAGAGGCAACGAAACTGGACTCATTACTCCAAATAAACATGGACTTTTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAA
CATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCAGCTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCAGTATTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGA
ACTAGGTAGAAACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGGGTTTTGCAACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCTGAAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGATTTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTA
TGGGAAGTAGTCATGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATGGTGAAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAGTTCTGCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCCTAGCCCTTTCACCCATACACATTTGGCTCAGGGTT
ACCGAAGAGGGGCCAAGAAATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGATGAAGAGCTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTT
AAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGA
GTTGGTCTGAGTGACAAGGAATTGGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAGAAGAGCAAAGCATGGATTCAAACTTAGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGA
GGGATACCATGCAACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAGCAGTATTAACTTCACAGAAAAGTAGTG
AATACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGG
AGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGG
CAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTG
GCCTGACCCCAGAAGAATTTATGCTCGTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGGGTGACCCA
GTCTATTAAAGAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGATCAACTGGAATGGATGGTACAG
CTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACAGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGA
GCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGACTGCAG
• BRCA2: > 11,000 bp– GGTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTGCTGCGCCTCTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCGCCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCGCGGTTTTTGTCAGCTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCG
GACTTATTTACCAAGCATTGGAGGAATATCGTAGGTAAAAATGCCTATTGGATCCAAAGAGAGGCCAACATTTTTTGAAATTTTTAAGACACGCTGCAACAAAGCAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACATA
AAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAACCATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGGCTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAAATTAGACTTAGGAAGGAATGTTCCCAATAGTAGACATAAAAGTCTTCGCA
CAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGTCCACTTCTAAATTCTTGTCTTAGTGAAAGTCCTGTTGTTCTACAATGTACACATGTAACACCACAAAGAGATAAGTCAGTGGTATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAGGGTCGTCAGACACCAAAACATATTTCTGAAAGTCTA
GGAGCTGAGGTGGATCCTGATATGTCTTGGTCAAGTTCTTTAGCTACACCACCCACCCTTAGTTCTACTGTGCTCATAGTCAGAAATGAAGAAGCATCTGAAACTGTATTTCCTCATGATACTACTGCTAATGTGAAAAGCTATTTTTCCAATCATGATGAAAGTCTGAAGAAAAATGATAGATTTATCGCTTCTGT
GACAGACAGTGAAAACACAAATCAAAGAGAAGCTGCAAGTCATGGATTTGGAAAAACATCAGGGAATTCATTTAAAGTAAATAGCTGCAAAGACCACATTGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAAACAGTTGTAGATACCTCTGAAGAAGATAGTTTTTCATTATGTTTTTCTAAATGTA
GAACAAAAAATCTACAAAAAGTAAGAACTAGCAAGACTAGGAAAAAAATTTTCCATGAAGCAAACGCTGATGAATGTGAAAAATCTAAAAACCAAGTGAAAGAAAAATACTCATTTGTATCTGAAGTGGAACCAAATGATACTGATCCATTAGATTCAAATGTAGCACATCAGAAGCCCTTTGAGAGTGGAAGTGAC
AAAATCTCCAAGGAAGTTGTACCGTCTTTGGCCTGTGAATGGTCTCAACTAACCCTTTCAGGTCTAAATGGAGCCCAGATGGAGAAAATACCCCTATTGCATATTTCTTCATGTGACCAAAATATTTCAGAAAAAGACCTATTAGACACAGAGAACAAAAGAAAGAAAGATTTTCTTACTTCAGAGAATTCTTTGCC
ACGTATTTCTAGCCTACCAAAATCAGAGAAGCCATTAAATGAGGAAACAGTGGTAAATAAGAGAGATGAAGAGCAGCATCTTGAATCTCATACAGACTGCATTCTTGCAGTAAAGCAGGCAATATCTGGAACTTCTCCAGTGGCTTCTTCATTTCAGGGTATCAAAAAGTCTATATTCAGAATAAGAGAATCACCTA
AAGAGACTTTCAATGCAAGTTTTTCAGGTCATATGACTGATCCAAACTTTAAAAAAGAAACTGAAGCCTCTGAAAGTGGACTGGAAATACATACTGTTTGCTCACAGAAGGAGGACTCCTTATGTCCAAATTTAATTGATAATGGAAGCTGGCCAGCCACCACCACACAGAATTCTGTAGCTTTGAAGAATGCAGG
TTTAATATCCACTTTGAAAAAGAAAACAAATAAGTTTATTTATGCTATACATGATGAAACATCTTATAAAGGAAAAAAAATACCGAAAGACCAAAAATCAGAACTAATTAACTGTTCAGCCCAGTTTGAAGCAAATGCTTTTGAAGCACCACTTACATTTGCAAATGCTGATTCAGGTTTATTGCATTCTTCTGTGAAAA
GAAGCTGTTCACAGAATGATTCTGAAGAACCAACTTTGTCCTTAACTAGCTCTTTTGGGACAATTCTGAGGAAATGTTCTAGAAATGAAACATGTTCTAATAATACAGTAATCTCTCAGGATCTTGATTATAAAGAAGCAAAATGTAATAAGGAAAAACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCAT
GCCTGCAGGAAGGACAGTGTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGATATAAAAGAAGAGGTCTTGGCTGCAGCATGTCACCCAGTACAACATTCAAAAGTGGAATACAGTGATACTGACTTTCAATCCCAGAAAAGTCTTTTATATGATCATGAAAATGCCAGCACTCTTATTTTAACTCCTACTTCCAAG
GATGTTCTGTCAAACCTAGTCATGATTTCTAGAGGCAAAGAATCATACAAAATGTCAGACAAGCTCAAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAAAATATTCCCATGGAAAAGAATCAAGATGTATGTGCTTTAAATGAAAATTATAAAAACGTTGAGCTGTTGCCACCTGAAAAATACATGAGAGTA
GCATCACCTTCAAGAAAGGTACAATTCAACCAAAACACAAATCTAAGAGTAATCCAAAAAAATCAAGAAGAAACTACTTCAATTTCAAAAATAACTGTCAATCCAGACTCTGAAGAACTTTTCTCAGACAATGAGAATAATTTTGTCTTCCAAGTAGCTAATGAAAGGAATAATCTTGCTTTAGGAAATACTAAGGAAC
TTCATGAAACAGACTTGACTTGTGTAAACGAACCCATTTTCAAGAACTCTACCATGGTTTTATATGGAGACACAGGTGATAAACAAGCAACCCAAGTGTCAATTAAAAAAGATTTGGTTTATGTTCTTGCAGAGGAGAACAAAAATAGTGTAAAGCAGCATATAAAAATGACTCTAGGTCAAGATTTAAAATCGGAC
ATCTCCTTGAATATAGATAAAATACCAGAAAAAAATAATGATTACATGAACAAATGGGCAGGACTCTTAGGTCCAATTTCAAATCACAGTTTTGGAGGTAGCTTCAGAACAGCTTCAAATAAGGAAATCAAGCTCTCTGAACATAACATTAAGAAGAGCAAAATGTTCTTCAAAGATATTGAAGAACAATATCCTACT
AGTTTAGCTTGTGTTGAAATTGTAAATACCTTGGCATTAGATAATCAAAAGAAACTGAGCAAGCCTCAGTCAATTAATACTGTATCTGCACATTTACAGAGTAGTGTAGTTGTTTCTGATTGTAAAAATAGTCATATAACCCCTCAGATGTTATTTTCCAAGCAGGATTTTAATTCAAACCATAATTTAACACCTAGCC
AAAAGGCAGAAATTACAGAACTTTCTACTATATTAGAAGAATCAGGAAGTCAGTTTGAATTTACTCAGTTTAGAAAACCAAGCTACATATTGCAGAAGAGTACATTTGAAGTGCCTGAAAACCAGATGACTATCTTAAAGACCACTTCTGAGGAATGCAGAGATGCTGATCTTCATGTCATAATGAATGCCCCATCG
ATTGGTCAGGTAGACAGCAGCAAGCAATTTGAAGGTACAGTTGAAATTAAACGGAAGTTTGCTGGCCTGTTGAAAAATGACTGTAACAAAAGTGCTTCTGGTTATTTAACAGATGAAAATGAAGTGGGGTTTAGGGGCTTTTATTCTGCTCATGGCACAAAACTGAATGTTTCTACTGAAGCTCTGCAAAAAGCTG
TGAAACTGTTTAGTGATATTGAGAATATTAGTGAGGAAACTTCTGCAGAGGTACATCCAATAAGTTTATCTTCAAGTAAATGTCATGATTCTGTTGTTTCAATGTTTAAGATAGAAAATCATAATGATAAAACTGTAAGTGAAAAAAATAATAAATGCCAACTGATATTACAAAATAATATTGAAATGACTACTGGCACT
TTTGTTGAAGAAATTACTGAAAATTACAAGAGAAATACTGAAAATGAAGATAACAAATATACTGCTGCCAGTAGAAATTCTCATAACTTAGAATTTGATGGCAGTGATTCAAGTAAAAATGATACTGTTTGTATTCATAAAGATGAAACGGACTTGCTATTTACTGATCAGCACAACATATGTCTTAAATTATCTGGCC
AGTTTATGAAGGAGGGAAACACTCAGATTAAAGAAGATTTGTCAGATTTAACTTTTTTGGAAGTTGCGAAAGCTCAAGAAGCATGTCATGGTAATACTTCAAATAAAGAACAGTTAACTGCTACTAAAACGGAGCAAAATATAAAAGATTTTGAGACTTCTGATACATTTTTTCAGACTGCAAGTGGGAAAAATATTA
GTGTCGCCAAAGAGTCATTTAATAAAATTGTAAATTTCTTTGATCAGAAACCAGAAGAATTGCATAACTTTTCCTTAAATTCTGAATTACATTCTGACATAAGAAAGAACAAAATGGACATTCTAAGTTATGAGGAAACAGACATAGTTAAACACAAAATACTGAAAGAAAGTGTCCCAGTTGGTACTGGAAATCAACT
AGTGACCTTCCAGGGACAACCCGAACGTGATGAAAAGATCAAAGAACCTACTCTGTTGGGTTTTCATACAGCTAGCGGGAAAAAAGTTAAAATTGCAAAGGAATCTTTGGACAAAGTGAAAAACCTTTTTGATGAAAAAGAGCAAGGTACTAGTGAAATCACCAGTTTTAGCCATCAATGGGCAAAGACCCTAAA
GTACAGAGAGGCCTGTAAAGACCTTGAATTAGCATGTGAGACCATTGAGATCACAGCTGCCCCAAAGTGTAAAGAAATGCAGAATTCTCTCAATAATGATAAAAACCTTGTTTCTATTGAGACTGTGGTGCCACCTAAGCTCTTAAGTGATAATTTATGTAGACAAACTGAAAATCTCAAAACATCAAAAAGTATCT
TTTTGAAAGTTAAAGTACATGAAAATGTAGAAAAAGAAACAGCAAAAAGTCCTGCAACTTGTTACACAAATCAGTCCCCTTATTCAGTCATTGAAAATTCAGCCTTAGCTTTTTACACAAGTTGTAGTAGAAAAACTTCTGTGAGTCAGACTTCATTACTTGAAGCAAAAAAATGGCTTAGAGAAGGAATATTTGATG
GTCAACCAGAAAGAATAAATACTGCAGATTATGTAGGAAATTATTTGTATGAAAATAATTCAAACAGTACTATAGCTGAAAATGACAAAAATCATCTCTCCGAAAAACAAGATACTTATTTAAGTAACAGTAGCATGTCTAACAGCTATTCCTACCATTCTGATGAGGTATATAATGATTCAGGATATCTCTCAAAAAA
TAAACTTGATTCTGGTATTGAGCCAGTATTGAAGAATGTTGAAGATCAAAAAAACACTAGTTTTTCCAAAGTAATATCCAATGTAAAAGATGCAAATGCATACCCACAAACTGTAAATGAAGATATTTGCGTTGAGGAACTTGTGACTAGCTCTTCACCCTGCAAAAATAAAAATGCAGCCATTAAATTGTCCATATC
TAATAGTAATAATTTTGAGGTAGGGCCACCTGCATTTAGGATAGCCAGTGGTAAAATCGTTTGTGTTTCACATGAAACAATTAAAAAAGTGAAAGACATATTTACAGACAGTTTCAGTAAAGTAATTAAGGAAAACAACGAGAATAAATCAAAAATTTGCCAAACGAAAATTATGGCAGGTTGTTACGAGGCATTGG
ATGATTCAGAGGATATTCTTCATAACTCTCTAGATAATGATGAATGTAGCACGCATTCACATAAGGTTTTTGCTGACATTCAGAGTGAAGAAATTTTACAACATAACCAAAATATGTCTGGATTGGAGAAAGTTTCTAAAATATCACCTTGTGATGTTAGTTTGGAAACTTCAGATATATGTAAATGTAGTATAGGGA
AGCTTCATAAGTCAGTCTCATCTGCAAATACTTGTGGGATTTTTAGCACAGCAAGTGGAAAATCTGTCCAGGTATCAGATGCTTCATTACAAAACGCAAGACAAGTGTTTTCTGAAATAGAAGATAGTACCAAGCAAGTCTTTTCCAAAGTATTGTTTAAAAGTAACGAACATTCAGACCAGCTCACAAGAGAAGAA
AATACTGCTATACGTACTCCAGAACATTTAATATCCCAAAAAGGCTTTTCATATAATGTGGTAAATTCATCTGCTTTCTCTGGATTTAGTACAGCAAGTGGAAAGCAAGTTTCCATTTTAGAAAGTTCCTTACACAAAGTTAAGGGAGTGTTAGAGGAATTTGATTTAATCAGAACTGAGCATAGTCTTCACTATTCA
CCTACGTCTAGACAAAATGTATCAAAAATACTTCCTCGTGTTGATAAGAGAAACCCAGAGCACTGTGTAAACTCAGAAATGGAAAAAACCTGCAGTAAAGAATTTAAATTATCAAATAACTTAAATGTTGAAGGTGGTTCTTCAGAAAATAATCACTCTATTAAAGTTTCTCCATATCTCTCTCAATTTCAACAAGACA
AACAACAGTTGGTATTAGGAACCAAAGTCTCACTTGTTGAGAACATTCATGTTTTGGGAAAAGAACAGGCTTCACCTAAAAACGTAAAAATGGAAATTGGTAAAACTGAAACTTTTTCTGATGTTCCTGTGAAAACAAATATAGAAGTTTGTTCTACTTACTCCAAAGATTCAGAAAACTACTTTGAAACAGAAGCAG
TAGAAATTGCTAAAGCTTTTATGGAAGATGATGAACTGACAGATTCTAAACTGCCAAGTCATGCCACACATTCTCTTTTTACATGTCCCGAAAATGAGGAAATGGTTTTGTCAAATTCAAGAATTGGAAAAAGAAGAGGAGAGCCCCTTATCTTAGTGGGAGAACCCTCAATCAAAAGAAACTTATTAAATGAATTT
GACAGGATAATAGAAAATCAAGAAAAATCCTTAAAGGCTTCAAAAAGCACTCCAGATGGCACAATAAAAGATCGAAGATTGTTTATGCATCATGTTTCTTTAGAGCCGATTACCTGTGTACCCTTTCGCACAACTAAGGAACGTCAAGAGATACAGAATCCAAATTTTACCGCACCTGGTCAAGAATTTCTGTCTAA
ATCTCATTTGTATGAACATCTGACTTTGGAAAAATCTTCAAGCAATTTAGCAGTTTCAGGACATCCATTTTATCAAGTTTCTGCTACAAGAAATGAAAAAATGAGACACTTGATTACTACAGGCAGACCAACCAAAGTCTTTGTTCCACCTTTTAAAACTAAATCACATTTTCACAGAGTTGAACAGTGTGTTAGGAAT
ATTAACTTGGAGGAAAACAGACAAAAGCAAAACATTGATGGACATGGCTCTGATGATAGTAAAAATAAGATTAATGACAATGAGATTCATCAGTTTAACAAAAACAACTCCAATCAAGCAGCAGCTGTAACTTTCACAAAGTGTGAAGAAGAACCTTTAGATTTAATTACAAGTCTTCAGAATGCCAGAGATATACAG
GATATGCGAATTAAGAAGAAACAAAGGCAACGCGTCTTTCCACAGCCAGGCAGTCTGTATCTTGCAAAAACATCCACTCTGCCTCGAATCTCTCTGAAAGCAGCAGTAGGAGGCCAAGTTCCCTCTGCGTGTTCTCATAAACAGCTGTATACGTATGGCGTTTCTAAACATTGCATAAAAATTAACAGCAAAAATG
CAGAGTCTTTTCAGTTTCACACTGAAGATTATTTTGGTAAGGAAAGTTTATGGACTGGAAAAGGAATACAGTTGGCTGATGGTGGATGGCTCATACCCTCCAATGATGGAAAGGCTGGAAAAGAAGAATTTTATAGGGCTCTGTGTGACACTCCAGGTGTGGATCCAAAGCTTATTTCTAGAATTTGGGTTTATAA
TCACTATAGATGGATCATATGGAAACTGGCAGCTATGGAATGTGCCTTTCCTAAGGAATTTGCTAATAGATGCCTAAGCCCAGAAAGGGTGCTTCTTCAACTAAAATACAGATATGATACGGAAATTGATAGAAGCAGAAGATCGGCTATAAAAAAGATAATGGAAAGGGATGACACAGCTGCAAAAACACTTGTT
CTCTGTGTTTCTGACATAATTTCATTGAGCGCAAATATATCTGAAACTTCTAGCAATAAAACTAGTAGTGCAGATACCCAAAAAGTGGCCATTATTGAACTTACAGATGGGTGGTATGCTGTTAAGGCCCAGTTAGATCCTCCCCTCTTAGCTGTCTTAAAGAATGGCAGACTGACAGTTGGTCAGAAGATTATTCT
TCATGGAGCAGAACTGGTGGGCTCTCCTGATGCCTGTACACCTCTTGAAGCCCCAGAATCTCTTATGTTAAAGATTTCTGCTAACAGTACTCGGCCTGCTCGCTGGTATACCAAACTTGGATTCTTTCCTGACCCTAGACCTTTTCCTCTGCCCTTATCATCGCTTTTCAGTGATGGAGGAAATGTTGGTTGTGT
TGATGTAATTATTCAAAGAGCATACCCTATACAGTGGATGGAGAAGACATCATCTGGATTATACATATTTCGCAATGAAAGAGAGGAAGAAAAGGAAGCAGCAAAATATGTGGAGGCCCAACAAAAGAGACTAGAAGCCTTATTCACTAAAATTCAGGAGGAATTTGAAGAACATGAAGAAAACACAACAAAACCA
TATTTACCATCACGTGCACTAACAAGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCAGCAGACCCAGCTTACCTTGAGGGTTATTTCAGTGAAGAGCAGTTAAGAGCCTTGAATAATCACAGGCAAATGTTGAATGATAAGAAACAAGCTCAGATCCAGTTGGAAATT
AGGAAGGCCATGGAATCTGCTGAACAAAAGGAACAAGGTTTATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGATTCAGTTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTC
AAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAACTCAGTATCAACAACTACCGGTTTCAGATGAAATTTTATTTCAGATTTACCAGCCACGGGAGCCCCTTCACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGAGGTGGACCTAATAGGATTTGTCGTTT
CTGTTGTGAAAAAAACAGGACTTGCCCCTTTCGTCTATTTGTCAGACGAATGTTACAATTTACTGGCAATAAAGTTTTGGATAGACCTTAATGAGGACATTATTAAGCCTCATATGTTAATTGCTGCAAGCAACCTCCAGTGGCGACCAGAATCCAAATCAGGCCTTCTTACTTTATTTGCTGGAGATTTTTCTGTG
TTTTCTGCTAGTCCAAAAGAGGGCCACTTTCAAGAGACATTCAACAAAATGAAAAATACTGTTGAGAATATTGACATACTTTGCAATGAAGCAGAAAACAAGCTTATGCATATACTGCATGCAAATGATCCCAAGTGGTCCACCCCAACTAAAGACTGTACTTCAGGGCCGTACACTGCTCAAATCATTCCTGGTAC
AGGAAACAAGCTTCTGATGTCTTCTCCTAATTGTGAGATATATTATCAAAGTCCTTTATCACTTTGTATGGCCAAAAGGAAGTCTGTTTCCACACCTGTCTCAGCCCAGATGACTTCAAAGTCTTGTAAAGGGGAGAAAGAGATTGATGACCAAAAGAACTGCAAAAAGAGAAGAGCCTTGGATTTCTTGAGTAGA
CTGCCTTTACCTCCACCTGTTAGTCCCATTTGTACATTTGTTTCTCCGGCTGCACAGAAGGCATTTCAGCCACCAAGGAGTTGTGGCACCAAATACGAAACACCCATAAAGAAAAAAGAACTGAATTCTCCTCAGATGACTCCATTTAAAAAATTCAATGAAATTTCTCTTTTGGAAAGTAATTCAATAGCTGACGA
AGAACTTGCATTGATAAATACCCAAGCTCTTTTGTCTGGTTCAACAGGAGAAAAACAATTTATATCTGTCAGTGAATCCACTAGGACTGCTCCCACCAGTTCAGAAGATTATCTCAGACTGAAACGACGTTGTACTACATCTCTGATCAAAGAACAGGAGAGTTCCCAGGCCAGTACGGAAGAATGTGAGAAAAAT
AAGCAGGACACAATTACAACTAAAAAATATATCTAAGCATTTGCAAAGGCGACAATAAATTATTGACGCTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAAACCACACATTAGTACTTATGTTGCACAATGAGAAAAGAAATTAGTTTCAAATTTACCTCAGCGTTTGTGTATCGGGCAAAAATCGTTTTGC
CCGATTCCGTATTGGTATACTTTTGCTTCAGTTGCATATCTTAAAACTAAATGTAATTTATTAACTAATCAAGAAAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCCCAACACTTTGAGAAGCTGAGGTGGGAGGAGTGCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACATAGGGAGACCC
CCATCTTTACGAAGAAAAAAAAAAAGGGGAAAAGAAAATCTTTTAAATCTTTGGATTTGATCACTACAAGTATTATTTTACAATCAACAAAATGGTCATCCAAACTCAAACTTGAGAAAATATCTTGCTTTCAAATTGACACTA
GGCTTTAAGTATCCATGGCTTTAAGTATCCATGGCTTTAAGTATCCATGGCTTTAAGTATCCAT
―Founder Effect‖
• The majority of people tested have a unique mutation –
one that is specific to them and their family.
– Hundreds of unique mutations have been found.
– Some are recurring, however.
• Ashkenazi Jewish population has 3 specific genes that
recur: Two BRCA1 and One BRCA2
– 185delAG; 5382insC; 6174delT
– 1996 study by Muto,et.al:
• 19% of Jewish women with ovarian cancer in Mass and
Israel had 185delAG
• 12% of breast cancers in Ashkenazi Jews are attributable to
BRCA 1 or BRCA 2 (Journal of National Cancer Institute,
1999)
– Genes come from groups of people who do not go
out of their small groups to find a mate
(interbreeding).
How do you get the bad gene?
BRCA Mutation Increases Breast
and Ovarian Cancer Risks
AJHG 1995;56:265-271
Science 2003: 643-646
JCO 2005 23 (8): 1656-63
NCI 2005
20
40
60
80
100
Breast cancer
by age 50
Breast cancer
by age 70
Ovarian cancer
by age 70
2%
Up to
50%
8%
Up to
87%
RiskofCancer(%)
<1%
Up to
44%
General Population
BRCA Mutation
Lancet 1994;343:692-695
NEJM 1997;336:1401-1408
AJHG 2003;72:1117-1130
BRCA Mutation Increases Risk
of Second Breast Cancer
Lancet 1998;351:316-21
JCO 2004;22:2328-35
Lancet 1994;3343:692-5
Gynecol Oncol. 2005 Jan;96(1):222-6
0
20
40
60
Breast Cancer
after 5 years
Breast Cancer
by age 70
Up to
3.5%
Up to
27%
Up to
11%
Up to
64%
RiskofCancer(%)
General Population
BRCA Mutation
Ca Epi Biomarkers Prev. 1999;8(10):855-61
JNCI 1999;15:1310-6
JCO 1998;16:2417-25
Risks in Men With a
BRCA Mutation
JCO 2004;22:
735-42
Breast Cancer
by age 80
Prostate Cancer
by age 80
General Population
BRCA Mutation*
5
10
15
20
25
<1%
7%
15%
20%
RiskofCancer(%)
*Risks refer to BRCA2 mutation carriers.
Risks for male BRCA1 mutation carriers are less characterized
―Red Flags‖ for Hereditary Breast
and Ovarian Cancer Syndrome
• For Women or Men with a newly diagnosed breast
cancer:
– Diagnosed at < 45 with or without FH
– Diagnosed at 45-50 with at a least one close blood relative
with breast cancer and/or at least one close blood relative
with ovarian cancer. Some would test all women in their
40s
– Bilateral breast cancer
– Diagnosed >50 with two or more close blood relatives with
breast or ovarian cancer at any age
– Close male relative with breast cancer
– Personal history of ovarian cancer
– Specific ethnicity associated with founder mutations
(Ashkenazi Jewish, Icelandic, Swedish, Hungarian)
especially along with family history
―Red Flags‖ for Women & Men
who do not have Cancer
• Women or Men who do not currently have cancer are at
risk:
– Family member with known BRCA 1 or BRCA 2 mutation
– Previous history of breast cancer from the previously stated risk
factors. (The test has only been available for ten years)
– Personal history of ovarian cancer
– One or more close male relatives with breast cancer
– Two or more female relatives with breast cancer especially at age <50
on either maternal or paternal side
– One or more close female relatives with ovarian cancer
– Specific ethnicity as stated previously along with family history
• REMEMBER: The family member who had the cancer
diagnosis should always be tested FIRST if possible.
Family History Considerations
• One-half of BRCA carriers inherit the
mutation from their father
• Ovarian cancer is a very important
indicator
• Early onset breast cancer is more
important than the number of affected
family members
Science
2003:302(5645):643-6
New Considerations
• Triple Negative Breast Cancer:
– Research has shown that women who have breast
cancer not sensitive to hormones or a drug called
Herceptin are more inclined to have the BRCA
gene even without a family history.
– Testing is indicated if you have triple negative
breast cancer under age 60
• Pancreatic Cancer:
– If two or more people in the family have had
pancreatic cancer that may be a criteria for testing
– The gene will be found in 17-19% of those families
Prevalence of BRCA
Mutations – Non Jewish
www.brcacalculator.com
Ovarian cancer
in one relative,
no breast
cancer <50
21.1%23.1%8.8%
Ovarian
cancer, no
breast cancer
16.9%15.8%6.8%
Breast
cancer <50
5.6%4.5%2.8%
No breast
or ovarian
cancer
Breast cancer
<50, no ovarian
cancer
No breast cancer
<50 or ovarian
cancer
Patient‟s
History
Family History
Prevalence of Mutations in
Ashkenazi Jewish Individuals
www.brcacalculator.com
42.0%37.0%22.2%
Ovarian
cancer, no
breast cancer
38.8%24.2%12.0%
Breast
cancer <50
15.6%13.7%6.9%
No breast
or ovarian
cancer
Breast cancer
<50, no ovarian
cancer
No breast cancer
<50 or ovarian
cancer
Patient‟s
History
Family History
Ovarian cancer
in one relative,
no breast
cancer <50
Genetic Testing
• Benefits
– Allows for individualized medical
management
– Accurate risk assessment
– Alleviates uncertainty and anxiety
• Limitations
– Genetic testing for BRCA1 and BRCA2
does not identify all causes of
hereditary breast or ovarian cancer
© 2007 Myriad Genetic
Laboratories, Inc.
Interpreting Test Results
• Positive for a deleterious mutation
• No mutation detected (negative test)
– Mutation has been previously
identified in the family
– No known mutation in the family or
the family hasn‘t been tested
• Genetic variant of uncertain significance
© 2007 Myriad Genetic
Laboratories, Inc.
Positive for a
Deleterious Mutation
• BRCA-associated cancer risks
• 50% chance for first degree relatives to
have the same mutation
– Children
– Siblings
– Parents
• Test relatives for identified familial
mutation
© 2007 Myriad Genetic
Laboratories, Inc.
Negative Test (no
mutation detected)
• Does not mean that the patient cannot
or will not develop breast cancer.
• Only means that they are not at risk
for developing hereditary breast
cancer related to the BRCA mutations
for which they were tested.
Negative Test (no
mutation detected)
• Family History is positive for the gene
• General population cancer risks—if no
cancer history on the other side of the
family
• Avoid unnecessary screening/surgery
• Can‘t pass on the gene
• Family History is negative or unknown for
the gene
• Most difficult to interpret
• Risk is based on total family history and
can still be significant.
© 2007 Myriad Genetic
Laboratories, Inc.
Family History & BRCA
Positive and Negative
CancerRisks%
50
Age (Years)
30 50 70
Positive for deleterious
BRCA mutation
100
Risk based on family
history
Negative for familial
BRCA mutation
Reprinted with permission from Ponder B: Genetic Testing for Cancer Risk. Science 1997; 278:1050-4.
Copyright 1997 American Association for the Advancement of Science
Genetic Variant of
uncertain significance
• Clinical significance not yet known. It
is neither positive or negative.
• Manage based on personal and family
cancer history.
• May be further clarified, and then re-
classified as positive or negative later
on as more information is identified.
© 2007 Myriad Genetic
Laboratories, Inc.
Managing Hereditary
Cancer Risk
• Surveillance
• Chemoprevention
• Prophylactic surgery
*Individual risk reduction may vary
based on personal health history
Screening for
Ovarian Cancer
• Screening for Familial Ovarian Cancer
– Poor Survival
– Most cancers are diagnosed at Stage 3 and 4
– Transvaginal U.S. & CA 125 are ineffective in
detecting tumors at a sufficiently early stage to
influence survival. Only detect 57% stage 1
– Ovarian cancer is 1/8 as common as breast, but
3 times more lethal
• Should be followed by an OB/GYN
Prophylactic Oophorectomy
• Recommend bilateral salpingo-
oophorectomy (BSO) at age 35 or after
childbearing is complete
– ~96% ovarian cancer risk reduction in
BRCA carriers
– Can reduce breast cancer risk by up to
68% for both BRCA1 and BRCA2
mutation carriers if the woman is pre-
menopausal
JAMA. 2006;296:185-92
Clin Oncol. 2005 Mar
10;23(8):1656-63
Prophylactic Ovarian removal -
Bilateral Oophorectomy (BSO)
• Does HRT increase cancer risk after
oophorectomy (ovarian removal)?
– No measurable effect with ―short term
usage‖ of Estrogen alone
– Estrogen until menopausal age – 50
• Unopposed estrogen does increase the
risk of uterine cancer. Adding a
hysterectomy to the BSO would
eliminate that risk, however, a much
bigger operation.
Surveillance for Breast Cancer
www.nccn.org
Cancer
Procedure Age to begin Frequency
Breast self-exam 18 yrs Monthly
Clinical breast
exam
25 yrs Twice a year
Mammography 25 yrs Yearly
MRI 25 yrs Yearly
Screening with MRI in
BRCA patients
• JAMA, 2004: MRI most
sensitive in detecting cancer
and can decrease mortality
in high risk women.
• Adequacy of screening
women with BRCA mutations
with only Mammo was not
shown to be good enough
even if the women had fatty
or low-dense breasts.
• Waiting a year between
screening is too long –
BRCA patient‘s cancers grow
faster than sporadic cancers.
Chemoprevention of
Breast Cancer
Tamoxifen
• Selective Estrogen Receptor Modulator (SERM)
– it blocks hormones from affecting breast cells
• Affected BRCA carriers: 50% decrease for
contralateral breast cancer
• Unaffected BRCA2 carriers: 62% decrease in
the risk of cancer
• Unaffected high-risk: 45% decrease
• Risks – increased risk of uterine cancer and
clotting. Low risk in women who took the
medication under age 50
Int J Cancer.
2006;118(9):2281-4
Lancet 2000;356:1876-81
Prophylactic Mastectomy
• Greater than 90% breast
cancer risk reduction
in BRCA carriers. May be
has high as 95-98%
reduction
• 100 women having
prophylactic surgery 1995-
2006
• 18/100 had abnormal lesions
• 3 invasive cancer
• 8 in situ cancer
• 7 ADH
•Eur J Surg Oncol 2008,
April 21
Reconstruction after Mastectomy
has come a long way
Postoperative left mastectomy – left latissimus flap and implant
Pre-operative view
Nipple Sparing Mastectomy
Insurance Coverage of
Genetic Testing
• All major carriers provide coverage for
genetic testing
• Established guidelines
– Medicare
– Most major carriers
– Some insurance companies have genetic
exclusions and will not pay no matter what the
indication - rare
• Cost: $3,350
• Cost if known family mutation: $450
• Supreme Court ruling may allow other
companies to compete and the price may go
down © 2007 Myriad Genetic
Genetic Discrimination
• Federal and state laws prohibit the use of
genetic information as a ‗pre-existing
condition‘
– Federal HIPAA legislation
– The majority of states have additional
laws
• Over 175,000 clinical tests performed to date
• No documented cases of genetic
discrimination
AJHG
2000;66:293
Gina Legislation
• U.S. President George
W. Bush signed into law
May 21, 2008 the first
civil rights legislation of
the new millennium, the
Genetic Information
Nondiscrimination Act
(GINA).
• GINA is the first and only
federal legislation that will
provide protections
against discrimination
based on an individual‘s
genetic information in
health insurance
coverage and
employment settings.
How do you test?
• Talk to your Primary Care Physician
– Your Doctor may feel comfortable with the discussion
and go ahead and test you; or they may send you to a
breast specialist to discuss your risks and whether the
test is right for you.
– The test is either blood or saliva
– The results are available in 2-3 weeks if insurance
approves
• Genetic Counselors
– If your BRCA test is negative but you have a very strong
FH – may need additional testing
• Other rare mutations exist – p53. pTEN/MMAC1
• Dr Jennifer Klemp in Kansas City: 913-588-7750
Summary/Case Presentations
1. BRCA 1 and 2 gene increase the risk of breast
and ovarian cancer significantly
2. ―Red Flags‖ such as multiple women with breast
or ovarian cancer in a family, especially at a
young age clue us in to the possibility that the
gene may be present
3. A blood and saliva test is available to identify the
gene
4. Options are available to improve screening and
decrease risk in women who have the gene
© 2007 Myriad Genetic
Rachel, age 40 – no cancer
Rachel‘s Test result
Rachel--Ovarian
Recommendations
• Her risk of ovarian cancer is 40-50%
• She is 40 and has completed child-
bearing
– Recommend: bilateral oophorectomy
(ovary removal) +/- hysterectomy
– Ovarian removal decreases her risk of
breast cancer by over 50%
– Unopposed Estrogen for 10 years okay,
but it increases her risk of uterine cancer if
she doesn‘t have a hysterectomy
Rachel – Breast
Recommendations
• Risk of Breast Cancer: 50-87%
• Options
– Increase screening with Mammogram and
MRI yearly separated by 6 months
– Above + Tamoxifen for 5 years to
decrease her risk by 50%
– Bilateral prophylactic mastectomies with
or without reconstruction
Rachel – Family
Recommendations
• Consider testing her
Brother – If he tests
Negative then his
daughter couldn‘t
inherit the gene from
him
• Rachel‘s Children –
each has a 50:50
chance of inheriting
the gene.
Heather, age 38
Heather
• Heather is at risk because her p Aunt
had breast cancer at a young age
• The best person to test would be
– Heather‘s Aunt – the person affected by
cancer
• If her aunt is positive then I would test
– Heather‘s Father
• If he is positive then I would test
– Heather
Heather
• Heather‘s aunt was positive
• Heather‘s Dad was negative
• What is Heather‘s risk?
– 10-13%, same as the general population
• Does she or her brother or sister need to
be tested?
– No, their Dad was negative
• Does her uncle and other two aunts need
to be tested?
– Yes, they all have a 50:50 chance of having the
gene.
Conclusion
• The BRCA gene is rare, but can
significantly increase the risk of breast and
ovarian cancer in patient‘s who have this
mutation.
• In patients who meet criteria, the test can
easily be done.
• If positive, there are many options
available to follow and potentially prevent
cancer.
Questions?

Contenu connexe

Tendances

Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023CHC Connecticut
 
Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.Mohamed Abdulla
 
Genetic assays in breast cancer
Genetic assays in breast cancerGenetic assays in breast cancer
Genetic assays in breast cancerVibhay Pareek
 
Molecular testing of breast ca
Molecular testing of breast caMolecular testing of breast ca
Molecular testing of breast caAyshax12
 
Chapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer preventionChapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer preventionNilesh Kucha
 
Cancer Immunotherapy
Cancer ImmunotherapyCancer Immunotherapy
Cancer ImmunotherapyPranav Sopory
 
BRCA Bible
BRCA BibleBRCA Bible
BRCA BibleNHS
 
Should triple negative breast cancer (tnbc) subtype
Should triple negative breast cancer (tnbc) subtypeShould triple negative breast cancer (tnbc) subtype
Should triple negative breast cancer (tnbc) subtypeEreny Samwel
 
Aviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planningAviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planningbreastcancerupdatecongress
 
Molecular profiling in breast cancer
Molecular profiling in breast cancerMolecular profiling in breast cancer
Molecular profiling in breast cancerShashidhara TS
 
Neoadjuvant therapy in her2+ ca breast ver 2.0
Neoadjuvant therapy in her2+ ca breast ver 2.0Neoadjuvant therapy in her2+ ca breast ver 2.0
Neoadjuvant therapy in her2+ ca breast ver 2.0Vivek Verma
 
Ca breast molecular biology
Ca breast molecular biology Ca breast molecular biology
Ca breast molecular biology suhas k r
 

Tendances (20)

breastcancer.pdf
breastcancer.pdfbreastcancer.pdf
breastcancer.pdf
 
Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023
 
Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.
 
Metastatic Breast Cancer Research and Treatment
Metastatic Breast Cancer Research and TreatmentMetastatic Breast Cancer Research and Treatment
Metastatic Breast Cancer Research and Treatment
 
Hereditary Cancer Predisposition
Hereditary Cancer PredispositionHereditary Cancer Predisposition
Hereditary Cancer Predisposition
 
Colon cancer
Colon cancerColon cancer
Colon cancer
 
Genetic assays in breast cancer
Genetic assays in breast cancerGenetic assays in breast cancer
Genetic assays in breast cancer
 
Molecular testing of breast ca
Molecular testing of breast caMolecular testing of breast ca
Molecular testing of breast ca
 
Chapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer preventionChapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer prevention
 
Cancer Immunotherapy
Cancer ImmunotherapyCancer Immunotherapy
Cancer Immunotherapy
 
BRCA Bible
BRCA BibleBRCA Bible
BRCA Bible
 
Should triple negative breast cancer (tnbc) subtype
Should triple negative breast cancer (tnbc) subtypeShould triple negative breast cancer (tnbc) subtype
Should triple negative breast cancer (tnbc) subtype
 
Aviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planningAviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planning
 
Molecular profiling in breast cancer
Molecular profiling in breast cancerMolecular profiling in breast cancer
Molecular profiling in breast cancer
 
Cancer biology
Cancer biologyCancer biology
Cancer biology
 
Neoadjuvant therapy in her2+ ca breast ver 2.0
Neoadjuvant therapy in her2+ ca breast ver 2.0Neoadjuvant therapy in her2+ ca breast ver 2.0
Neoadjuvant therapy in her2+ ca breast ver 2.0
 
An Overview of Cancer Genetics
An Overview of Cancer GeneticsAn Overview of Cancer Genetics
An Overview of Cancer Genetics
 
Ca breast molecular biology
Ca breast molecular biology Ca breast molecular biology
Ca breast molecular biology
 
Origin of Cancer
Origin of CancerOrigin of Cancer
Origin of Cancer
 
Tumor markers
Tumor markersTumor markers
Tumor markers
 

En vedette

Molecular biology of breast cancer and
Molecular biology of breast cancer andMolecular biology of breast cancer and
Molecular biology of breast cancer andbarun kumar
 
Molecular subtypes of breast cancer
Molecular subtypes of breast cancerMolecular subtypes of breast cancer
Molecular subtypes of breast cancerJoydeep Ghosh
 
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...Setia Pramana
 
Efrat Levy Lahad : Genetic testing for breast and ovarian cancer
Efrat Levy Lahad : Genetic testing for breast and ovarian cancerEfrat Levy Lahad : Genetic testing for breast and ovarian cancer
Efrat Levy Lahad : Genetic testing for breast and ovarian cancerbreastcancerupdatecongress
 
Beyond BRCA Mutations: What's New in the World of Genetic Testing?
Beyond BRCA Mutations: What's New in the World of Genetic Testing?Beyond BRCA Mutations: What's New in the World of Genetic Testing?
Beyond BRCA Mutations: What's New in the World of Genetic Testing?bkling
 
Session Three: Genetic Testing Process
Session Three: Genetic Testing ProcessSession Three: Genetic Testing Process
Session Three: Genetic Testing ProcessNCHPEG
 
Ca ovary dr. varun
Ca ovary  dr. varunCa ovary  dr. varun
Ca ovary dr. varunVarun Goel
 
Regulatory oversight of genetic testing in Canada: Health Canada perspective
Regulatory oversight of genetic testing in Canada: Health Canada perspectiveRegulatory oversight of genetic testing in Canada: Health Canada perspective
Regulatory oversight of genetic testing in Canada: Health Canada perspectiveMaRS Discovery District
 
Genetic testing of breast and ovarian cancer patients: clinical characteristi...
Genetic testing of breast and ovarian cancer patients: clinical characteristi...Genetic testing of breast and ovarian cancer patients: clinical characteristi...
Genetic testing of breast and ovarian cancer patients: clinical characteristi...dewisetiyana52
 
Annie Ellis Patient Perspective from Ovarian Cancer Endpoints Workshop hosted...
Annie Ellis Patient Perspective from Ovarian Cancer Endpoints Workshop hosted...Annie Ellis Patient Perspective from Ovarian Cancer Endpoints Workshop hosted...
Annie Ellis Patient Perspective from Ovarian Cancer Endpoints Workshop hosted...Ovarian Cancer Research Fund Alliance
 
Screening for ovarian cancer may 15
Screening for ovarian cancer  may 15Screening for ovarian cancer  may 15
Screening for ovarian cancer may 15Basalama Ali
 
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.hungnguyenthien
 

En vedette (20)

Molecular biology of breast cancer and
Molecular biology of breast cancer andMolecular biology of breast cancer and
Molecular biology of breast cancer and
 
Molecular subtypes of breast cancer
Molecular subtypes of breast cancerMolecular subtypes of breast cancer
Molecular subtypes of breast cancer
 
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
 
Efrat Levy Lahad : Genetic testing for breast and ovarian cancer
Efrat Levy Lahad : Genetic testing for breast and ovarian cancerEfrat Levy Lahad : Genetic testing for breast and ovarian cancer
Efrat Levy Lahad : Genetic testing for breast and ovarian cancer
 
Beyond BRCA Mutations: What's New in the World of Genetic Testing?
Beyond BRCA Mutations: What's New in the World of Genetic Testing?Beyond BRCA Mutations: What's New in the World of Genetic Testing?
Beyond BRCA Mutations: What's New in the World of Genetic Testing?
 
LDI Research Seminar- Targeted Testing & Treatment for Breast Cancer 11_18_11
LDI Research Seminar- Targeted Testing & Treatment for Breast Cancer 11_18_11LDI Research Seminar- Targeted Testing & Treatment for Breast Cancer 11_18_11
LDI Research Seminar- Targeted Testing & Treatment for Breast Cancer 11_18_11
 
GENETICS
GENETICSGENETICS
GENETICS
 
Session Three: Genetic Testing Process
Session Three: Genetic Testing ProcessSession Three: Genetic Testing Process
Session Three: Genetic Testing Process
 
Ca ovary dr. varun
Ca ovary  dr. varunCa ovary  dr. varun
Ca ovary dr. varun
 
Ovarian cancer
Ovarian cancerOvarian cancer
Ovarian cancer
 
Web. hboc visual aids
Web. hboc visual aidsWeb. hboc visual aids
Web. hboc visual aids
 
Regulatory oversight of genetic testing in Canada: Health Canada perspective
Regulatory oversight of genetic testing in Canada: Health Canada perspectiveRegulatory oversight of genetic testing in Canada: Health Canada perspective
Regulatory oversight of genetic testing in Canada: Health Canada perspective
 
Genetic testing of breast and ovarian cancer patients: clinical characteristi...
Genetic testing of breast and ovarian cancer patients: clinical characteristi...Genetic testing of breast and ovarian cancer patients: clinical characteristi...
Genetic testing of breast and ovarian cancer patients: clinical characteristi...
 
Annie Ellis Patient Perspective from Ovarian Cancer Endpoints Workshop hosted...
Annie Ellis Patient Perspective from Ovarian Cancer Endpoints Workshop hosted...Annie Ellis Patient Perspective from Ovarian Cancer Endpoints Workshop hosted...
Annie Ellis Patient Perspective from Ovarian Cancer Endpoints Workshop hosted...
 
DrTerespolsky
DrTerespolskyDrTerespolsky
DrTerespolsky
 
Hereditary Breast and Ovarian Cancer: A Discussion on Cancer Genetics and a F...
Hereditary Breast and Ovarian Cancer: A Discussion on Cancer Genetics and a F...Hereditary Breast and Ovarian Cancer: A Discussion on Cancer Genetics and a F...
Hereditary Breast and Ovarian Cancer: A Discussion on Cancer Genetics and a F...
 
Screening for ovarian cancer may 15
Screening for ovarian cancer  may 15Screening for ovarian cancer  may 15
Screening for ovarian cancer may 15
 
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
 
Breast cancer awareness 13 march 2015
Breast cancer awareness 13 march 2015Breast cancer awareness 13 march 2015
Breast cancer awareness 13 march 2015
 
The BRCA Challenge - John Burn
The BRCA Challenge - John BurnThe BRCA Challenge - John Burn
The BRCA Challenge - John Burn
 

Similaire à Breast cancer genetic testing: Is it right for you?

Prevention of cancer in women
Prevention of cancer in women Prevention of cancer in women
Prevention of cancer in women vandana bansal
 
Update on breast cancer english presentation
Update on breast cancer english presentationUpdate on breast cancer english presentation
Update on breast cancer english presentationdaredoctor
 
Case 6.2 (Hereditary colorectal cancer)
Case 6.2 (Hereditary colorectal cancer)Case 6.2 (Hereditary colorectal cancer)
Case 6.2 (Hereditary colorectal cancer)Arwa H. Al-Onayzan
 
What Black Women Need to Know About Endometrial Cancer
What Black Women Need to Know About Endometrial CancerWhat Black Women Need to Know About Endometrial Cancer
What Black Women Need to Know About Endometrial Cancerbkling
 
When Cells Go Rogue and Become Breast Cancer
When Cells Go Rogue and Become Breast CancerWhen Cells Go Rogue and Become Breast Cancer
When Cells Go Rogue and Become Breast Cancerbkling
 
Breast cancer سرطان الثدي
Breast cancer  سرطان الثديBreast cancer  سرطان الثدي
Breast cancer سرطان الثديMEEQAT HOSPITAL
 
Simple Ways to Reduce Your Cancer Risk - Montclair Public Library - 5.18.19
Simple Ways to Reduce Your Cancer Risk - Montclair Public Library - 5.18.19Simple Ways to Reduce Your Cancer Risk - Montclair Public Library - 5.18.19
Simple Ways to Reduce Your Cancer Risk - Montclair Public Library - 5.18.19Summit Health
 
Surviving and Thriving with Gynecologic Cancer - 9.7.19
Surviving and Thriving with Gynecologic Cancer - 9.7.19Surviving and Thriving with Gynecologic Cancer - 9.7.19
Surviving and Thriving with Gynecologic Cancer - 9.7.19Summit Health
 
Family Genetics - Having the Conversation with Family
Family Genetics - Having the Conversation with FamilyFamily Genetics - Having the Conversation with Family
Family Genetics - Having the Conversation with FamilyFight Colorectal Cancer
 
March 2016 Webinar - Lynch Syndrome & Hereditary Colorectal Cancer
March 2016 Webinar - Lynch Syndrome & Hereditary Colorectal CancerMarch 2016 Webinar - Lynch Syndrome & Hereditary Colorectal Cancer
March 2016 Webinar - Lynch Syndrome & Hereditary Colorectal CancerFight Colorectal Cancer
 
Beta Blockers, Stress, and Breast Cancer: Studying Alternative Cancer Treatme...
Beta Blockers, Stress, and Breast Cancer: Studying Alternative Cancer Treatme...Beta Blockers, Stress, and Breast Cancer: Studying Alternative Cancer Treatme...
Beta Blockers, Stress, and Breast Cancer: Studying Alternative Cancer Treatme...M. Chiamaka Okonkwo
 
Breast carcinoma etiology and classification.pptx
Breast carcinoma etiology and classification.pptxBreast carcinoma etiology and classification.pptx
Breast carcinoma etiology and classification.pptxPradeep Pande
 
Dec. Webinar - Tumor vs. Germline Testing: What’s the Difference?
Dec. Webinar - Tumor vs. Germline Testing: What’s the Difference?Dec. Webinar - Tumor vs. Germline Testing: What’s the Difference?
Dec. Webinar - Tumor vs. Germline Testing: What’s the Difference?Fight Colorectal Cancer
 
cancer and DNA Test.pptx
cancer and DNA Test.pptxcancer and DNA Test.pptx
cancer and DNA Test.pptxSaImoon QureShi
 

Similaire à Breast cancer genetic testing: Is it right for you? (20)

Prevention of cancer in women
Prevention of cancer in women Prevention of cancer in women
Prevention of cancer in women
 
Update on breast cancer english presentation
Update on breast cancer english presentationUpdate on breast cancer english presentation
Update on breast cancer english presentation
 
Case 6.2 (Hereditary colorectal cancer)
Case 6.2 (Hereditary colorectal cancer)Case 6.2 (Hereditary colorectal cancer)
Case 6.2 (Hereditary colorectal cancer)
 
What Black Women Need to Know About Endometrial Cancer
What Black Women Need to Know About Endometrial CancerWhat Black Women Need to Know About Endometrial Cancer
What Black Women Need to Know About Endometrial Cancer
 
When Cells Go Rogue and Become Breast Cancer
When Cells Go Rogue and Become Breast CancerWhen Cells Go Rogue and Become Breast Cancer
When Cells Go Rogue and Become Breast Cancer
 
Breast cancer سرطان الثدي
Breast cancer  سرطان الثديBreast cancer  سرطان الثدي
Breast cancer سرطان الثدي
 
Simple Ways to Reduce Your Cancer Risk - Montclair Public Library - 5.18.19
Simple Ways to Reduce Your Cancer Risk - Montclair Public Library - 5.18.19Simple Ways to Reduce Your Cancer Risk - Montclair Public Library - 5.18.19
Simple Ways to Reduce Your Cancer Risk - Montclair Public Library - 5.18.19
 
Surviving and Thriving with Gynecologic Cancer - 9.7.19
Surviving and Thriving with Gynecologic Cancer - 9.7.19Surviving and Thriving with Gynecologic Cancer - 9.7.19
Surviving and Thriving with Gynecologic Cancer - 9.7.19
 
Komen Webinar on Genetics and Breast Cancer
Komen Webinar on Genetics and Breast CancerKomen Webinar on Genetics and Breast Cancer
Komen Webinar on Genetics and Breast Cancer
 
Family Genetics - Having the Conversation with Family
Family Genetics - Having the Conversation with FamilyFamily Genetics - Having the Conversation with Family
Family Genetics - Having the Conversation with Family
 
March 2016 Webinar - Lynch Syndrome & Hereditary Colorectal Cancer
March 2016 Webinar - Lynch Syndrome & Hereditary Colorectal CancerMarch 2016 Webinar - Lynch Syndrome & Hereditary Colorectal Cancer
March 2016 Webinar - Lynch Syndrome & Hereditary Colorectal Cancer
 
41 10103-11886-382
41 10103-11886-38241 10103-11886-382
41 10103-11886-382
 
Cancer mm
Cancer mmCancer mm
Cancer mm
 
Beta Blockers, Stress, and Breast Cancer: Studying Alternative Cancer Treatme...
Beta Blockers, Stress, and Breast Cancer: Studying Alternative Cancer Treatme...Beta Blockers, Stress, and Breast Cancer: Studying Alternative Cancer Treatme...
Beta Blockers, Stress, and Breast Cancer: Studying Alternative Cancer Treatme...
 
Breast carcinoma etiology and classification.pptx
Breast carcinoma etiology and classification.pptxBreast carcinoma etiology and classification.pptx
Breast carcinoma etiology and classification.pptx
 
Dec. Webinar - Tumor vs. Germline Testing: What’s the Difference?
Dec. Webinar - Tumor vs. Germline Testing: What’s the Difference?Dec. Webinar - Tumor vs. Germline Testing: What’s the Difference?
Dec. Webinar - Tumor vs. Germline Testing: What’s the Difference?
 
cancer and DNA Test.pptx
cancer and DNA Test.pptxcancer and DNA Test.pptx
cancer and DNA Test.pptx
 
Liver cancer
Liver cancerLiver cancer
Liver cancer
 
Liver cancer
Liver cancerLiver cancer
Liver cancer
 
Liver cancer
Liver cancerLiver cancer
Liver cancer
 

Plus de Via Christi Health

Colon cancer;you have the power!
Colon cancer;you have the power!Colon cancer;you have the power!
Colon cancer;you have the power!Via Christi Health
 
Oh, my aching feet! Presentation by Dr. Miki Matsuda
Oh, my aching feet! Presentation by Dr. Miki MatsudaOh, my aching feet! Presentation by Dr. Miki Matsuda
Oh, my aching feet! Presentation by Dr. Miki MatsudaVia Christi Health
 
Via Christi Women's Connection: Migraines
Via Christi Women's Connection: MigrainesVia Christi Women's Connection: Migraines
Via Christi Women's Connection: MigrainesVia Christi Health
 
Via Christi 50+: Anxiety and depression
Via Christi 50+: Anxiety and depressionVia Christi 50+: Anxiety and depression
Via Christi 50+: Anxiety and depressionVia Christi Health
 
2014 Via Christi Cardiac Symposium Presentations
2014 Via Christi Cardiac Symposium Presentations2014 Via Christi Cardiac Symposium Presentations
2014 Via Christi Cardiac Symposium PresentationsVia Christi Health
 
Via Christi Women's Connection: Six ways to a better you
Via Christi Women's Connection: Six ways to a better youVia Christi Women's Connection: Six ways to a better you
Via Christi Women's Connection: Six ways to a better youVia Christi Health
 
What you need to know about dietary supplements
What you need to know about dietary supplementsWhat you need to know about dietary supplements
What you need to know about dietary supplementsVia Christi Health
 
Via Christi Safe Kids Summer Safety Tips for Parents
Via Christi Safe Kids Summer Safety Tips for ParentsVia Christi Safe Kids Summer Safety Tips for Parents
Via Christi Safe Kids Summer Safety Tips for ParentsVia Christi Health
 
Advances in depression treatment
Advances in depression treatmentAdvances in depression treatment
Advances in depression treatmentVia Christi Health
 
Understanding Chronic Shoulder Pain
Understanding Chronic Shoulder PainUnderstanding Chronic Shoulder Pain
Understanding Chronic Shoulder PainVia Christi Health
 
The Affordable Care Act and You
The Affordable Care Act and YouThe Affordable Care Act and You
The Affordable Care Act and YouVia Christi Health
 
ACA: Impact on Physician Practices in Kansas
ACA: Impact on Physician Practices in KansasACA: Impact on Physician Practices in Kansas
ACA: Impact on Physician Practices in KansasVia Christi Health
 
The Affordable Care Act: Impact on Hospitals in Kansas
The Affordable Care Act: Impact on Hospitals in KansasThe Affordable Care Act: Impact on Hospitals in Kansas
The Affordable Care Act: Impact on Hospitals in KansasVia Christi Health
 

Plus de Via Christi Health (20)

Colon cancer;you have the power!
Colon cancer;you have the power!Colon cancer;you have the power!
Colon cancer;you have the power!
 
Cancer: What's your risk?
Cancer: What's your risk?Cancer: What's your risk?
Cancer: What's your risk?
 
Oh, my aching feet! Presentation by Dr. Miki Matsuda
Oh, my aching feet! Presentation by Dr. Miki MatsudaOh, my aching feet! Presentation by Dr. Miki Matsuda
Oh, my aching feet! Presentation by Dr. Miki Matsuda
 
Via Christi Women's Connection: Migraines
Via Christi Women's Connection: MigrainesVia Christi Women's Connection: Migraines
Via Christi Women's Connection: Migraines
 
Via Christi 50+: Anxiety and depression
Via Christi 50+: Anxiety and depressionVia Christi 50+: Anxiety and depression
Via Christi 50+: Anxiety and depression
 
2014 Via Christi Cardiac Symposium Presentations
2014 Via Christi Cardiac Symposium Presentations2014 Via Christi Cardiac Symposium Presentations
2014 Via Christi Cardiac Symposium Presentations
 
Veins, trains and automobiles
Veins, trains and automobilesVeins, trains and automobiles
Veins, trains and automobiles
 
Via Christi Women's Connection: Six ways to a better you
Via Christi Women's Connection: Six ways to a better youVia Christi Women's Connection: Six ways to a better you
Via Christi Women's Connection: Six ways to a better you
 
What you need to know about dietary supplements
What you need to know about dietary supplementsWhat you need to know about dietary supplements
What you need to know about dietary supplements
 
The Beauty of BOTOX
The Beauty of BOTOXThe Beauty of BOTOX
The Beauty of BOTOX
 
Via Christi Safe Kids Summer Safety Tips for Parents
Via Christi Safe Kids Summer Safety Tips for ParentsVia Christi Safe Kids Summer Safety Tips for Parents
Via Christi Safe Kids Summer Safety Tips for Parents
 
Keeping an eye on your vision
Keeping an eye on your visionKeeping an eye on your vision
Keeping an eye on your vision
 
Preventing diabetes
Preventing diabetesPreventing diabetes
Preventing diabetes
 
Advances in depression treatment
Advances in depression treatmentAdvances in depression treatment
Advances in depression treatment
 
50+ Heart Valve Presentation
50+ Heart Valve Presentation50+ Heart Valve Presentation
50+ Heart Valve Presentation
 
Understanding Chronic Shoulder Pain
Understanding Chronic Shoulder PainUnderstanding Chronic Shoulder Pain
Understanding Chronic Shoulder Pain
 
Better ways to handle stress
Better ways to handle stressBetter ways to handle stress
Better ways to handle stress
 
The Affordable Care Act and You
The Affordable Care Act and YouThe Affordable Care Act and You
The Affordable Care Act and You
 
ACA: Impact on Physician Practices in Kansas
ACA: Impact on Physician Practices in KansasACA: Impact on Physician Practices in Kansas
ACA: Impact on Physician Practices in Kansas
 
The Affordable Care Act: Impact on Hospitals in Kansas
The Affordable Care Act: Impact on Hospitals in KansasThe Affordable Care Act: Impact on Hospitals in Kansas
The Affordable Care Act: Impact on Hospitals in Kansas
 

Dernier

Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service JaipurHigh Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipurparulsinha
 
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy Girls
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy GirlsCall Girls In Andheri East Call 9920874524 Book Hot And Sexy Girls
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy Girlsnehamumbai
 
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort Service
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort ServiceCollege Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort Service
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort ServiceNehru place Escorts
 
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...narwatsonia7
 
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service MumbaiVIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbaisonalikaur4
 
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safenarwatsonia7
 
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Miss joya
 
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbers
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbersBook Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbers
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbersnarwatsonia7
 
Book Call Girls in Yelahanka - For 7001305949 Cheap & Best with original Photos
Book Call Girls in Yelahanka - For 7001305949 Cheap & Best with original PhotosBook Call Girls in Yelahanka - For 7001305949 Cheap & Best with original Photos
Book Call Girls in Yelahanka - For 7001305949 Cheap & Best with original Photosnarwatsonia7
 
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdfHemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdfMedicoseAcademics
 
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowKolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowNehru place Escorts
 
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknow
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service LucknowVIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknow
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknownarwatsonia7
 

Dernier (20)

Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
 
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service JaipurHigh Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
High Profile Call Girls Jaipur Vani 8445551418 Independent Escort Service Jaipur
 
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy Girls
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy GirlsCall Girls In Andheri East Call 9920874524 Book Hot And Sexy Girls
Call Girls In Andheri East Call 9920874524 Book Hot And Sexy Girls
 
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort Service
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort ServiceCollege Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort Service
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort Service
 
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
 
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service MumbaiVIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
 
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Servicesauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
 
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Marathahalli 📞 9907093804 High Profile Service 100% Safe
 
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
 
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCREscort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
 
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbers
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbersBook Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbers
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbers
 
Book Call Girls in Yelahanka - For 7001305949 Cheap & Best with original Photos
Book Call Girls in Yelahanka - For 7001305949 Cheap & Best with original PhotosBook Call Girls in Yelahanka - For 7001305949 Cheap & Best with original Photos
Book Call Girls in Yelahanka - For 7001305949 Cheap & Best with original Photos
 
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdfHemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdf
 
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
 
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowKolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Kolkata Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
 
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknow
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service LucknowVIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknow
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknow
 

Breast cancer genetic testing: Is it right for you?

  • 1. Breast cancer genetic testing: Is it right for you? Patty Tenofsky, MD FACS Women‘s Connection October 8, 2013
  • 4. Angelina Jolie‘s decision • “The truth is I carry a „faulty‟ gene, BRCA 1, which sharply increases my risk of developing breast cancer and ovarian cancer.” • Her mother had previously battled breast cancer, but then developed ovarian cancer at age 49 and died of the disease at age 56 • Her Grandmother died of ovarian cancer at age 45 • Her maternal aunt died of breast cancer • She chose to have bilateral preventive double mastectomies. • She plans to have her ovaries removed once she has decided that she does not want any more children.
  • 5. Christina Applegate • She was diagnosed with breast cancer, and then found to have the BRCA 1 gene at age 36 • She chose to have bilateral mastectomies
  • 6. Breast & Ovarian Cancer • 200,000 cases of Breast Cancer/year in the U.S. – Lifetime risk is around 10-13% – Risk factors • Being a woman and getting older • Family history, early menarche, late or no pregnancy, hormone replacement, alcohol use, obesity, lack of exercise • 25,000 cases of Ovarian Cancer/year in the U.S. – Lifetime risk is <2%
  • 7. Most Women Develop Breast Cancer WITHOUT a Family History
  • 8. Hereditary Breast & Ovarian Cancer Syndrome (BRCA) • Characterized by significantly increased risks for breast and ovarian cancer – 1:800 people in the general population have a BRCA genetic mutation – 1:40 people of Eastern European Jewish descent will have the gene. • Most cases are caused by a BRCA1 or BRCA2 mutation • Clinical testing is available to identify individuals with mutations
  • 9. DNA • Double Helix • Made up of 4 building blocks that get together in pairs – Adenine (A), thymine (T) , guanine (G), cytosine (C) • These 4 ―letters‖ create a ―word‖ that codes for a certain amino acid. Amino Acids are the building blocks of our proteins – these proteins are what lead to our characteristics and features • Misplaced letters or words can lead to severely incorrect proteins (mutations)
  • 10. Sickle Cell Anemia – only one base code incorrect
  • 11. What is the purpose of our normal BRCA genes? • BRCA gene‘s purpose: It codes for proteins that function to fight changes in your DNA that can lead to breast and ovarian cancer. – Changes may occur in your DNA which can lead to cancer when normal cells divide and are exposed to cancer inducing substances – BRCA gene is therefore a cancer fighter • BRCA gene that is mutated: The body is less able to find and repair mistakes and cancer is more likely.
  • 12. Background • 1990 – Families who had many women with breast and ovarian cancer underwent DNA studies and scientists identified the first gene associated with breast cancer: BRCA 1 on Chromosome 17. • 1994 – BRCA 2 gene was discovered on Chromosome 13. • Jewish families were found to have a much higher rate of the gene mutations. • By the late 1990s – we were able to test for the gene mutations.
  • 14. Laboratory Testing for Genetic Mutations • BRCA1: > 5,500 bp– AGCTCGCTGAGACTTCCTGGACCCCGCACCAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAGTTCATTGGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCC ATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTG TGCTTTTCAGCTTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTC TCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCA AAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAG AACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGTAGATCTGAATGCTGATCCCCTGTGTGAGAGAAAA GAATGGAATAAGCAGAAACTGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATGCCAAAGTAGCTGATGTATTGGACGTTCTA AATGAGGTAGATGAATATTCTGGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTTAATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTGAAGACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAACTTAAGCCATGTAACTGAAAATCTAAT TATAGGAGCATTTGTTACTGAGCCACAGATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGGAGACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTGGCAGTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGGAGCAGAATGGTCAAGTGATGAAT ATTACTAATAGTGGTCATGAGAATAAAACAAAAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCACTCGAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAGTATAAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAAGCACCTAAAAAGAATAGGCTGAGGAG GAAGTCTTCTACCAGGCATATTCATGCGCTTGAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCAAATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACCAAATGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAACCTGCAACTGGAGCC AAGAAGAGTAACAAGCCAAATGAACAGACAAGTAAAAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTCTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGC TGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTGGTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCACTCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAGCATTTGA AAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGAAATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGTCGGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATTTGCAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAAT CCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTT GATAATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTCAGTTCAGAGGCAACGAAACTGGACTCATTACTCCAAATAAACATGGACTTTTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAA CATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCAGCTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCAGTATTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGA ACTAGGTAGAAACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGGGTTTTGCAACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCTGAAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGATTTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTA TGGGAAGTAGTCATGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATGGTGAAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAGTTCTGCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCCTAGCCCTTTCACCCATACACATTTGGCTCAGGGTT ACCGAAGAGGGGCCAAGAAATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGATGAAGAGCTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTT AAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGA GTTGGTCTGAGTGACAAGGAATTGGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAGAAGAGCAAAGCATGGATTCAAACTTAGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGA GGGATACCATGCAACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAGCAGTATTAACTTCACAGAAAAGTAGTG AATACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGG AGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGG CAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTG GCCTGACCCCAGAAGAATTTATGCTCGTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGGGTGACCCA GTCTATTAAAGAAAGAAAAATGCTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGATCAACTGGAATGGATGGTACAG CTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACAGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGA GCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGACTGCAG • BRCA2: > 11,000 bp– GGTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTGCTGCGCCTCTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCGCCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCGCGGTTTTTGTCAGCTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCG GACTTATTTACCAAGCATTGGAGGAATATCGTAGGTAAAAATGCCTATTGGATCCAAAGAGAGGCCAACATTTTTTGAAATTTTTAAGACACGCTGCAACAAAGCAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACATA AAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAACCATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGGCTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAAATTAGACTTAGGAAGGAATGTTCCCAATAGTAGACATAAAAGTCTTCGCA CAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGTCCACTTCTAAATTCTTGTCTTAGTGAAAGTCCTGTTGTTCTACAATGTACACATGTAACACCACAAAGAGATAAGTCAGTGGTATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAGGGTCGTCAGACACCAAAACATATTTCTGAAAGTCTA GGAGCTGAGGTGGATCCTGATATGTCTTGGTCAAGTTCTTTAGCTACACCACCCACCCTTAGTTCTACTGTGCTCATAGTCAGAAATGAAGAAGCATCTGAAACTGTATTTCCTCATGATACTACTGCTAATGTGAAAAGCTATTTTTCCAATCATGATGAAAGTCTGAAGAAAAATGATAGATTTATCGCTTCTGT GACAGACAGTGAAAACACAAATCAAAGAGAAGCTGCAAGTCATGGATTTGGAAAAACATCAGGGAATTCATTTAAAGTAAATAGCTGCAAAGACCACATTGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAAACAGTTGTAGATACCTCTGAAGAAGATAGTTTTTCATTATGTTTTTCTAAATGTA GAACAAAAAATCTACAAAAAGTAAGAACTAGCAAGACTAGGAAAAAAATTTTCCATGAAGCAAACGCTGATGAATGTGAAAAATCTAAAAACCAAGTGAAAGAAAAATACTCATTTGTATCTGAAGTGGAACCAAATGATACTGATCCATTAGATTCAAATGTAGCACATCAGAAGCCCTTTGAGAGTGGAAGTGAC AAAATCTCCAAGGAAGTTGTACCGTCTTTGGCCTGTGAATGGTCTCAACTAACCCTTTCAGGTCTAAATGGAGCCCAGATGGAGAAAATACCCCTATTGCATATTTCTTCATGTGACCAAAATATTTCAGAAAAAGACCTATTAGACACAGAGAACAAAAGAAAGAAAGATTTTCTTACTTCAGAGAATTCTTTGCC ACGTATTTCTAGCCTACCAAAATCAGAGAAGCCATTAAATGAGGAAACAGTGGTAAATAAGAGAGATGAAGAGCAGCATCTTGAATCTCATACAGACTGCATTCTTGCAGTAAAGCAGGCAATATCTGGAACTTCTCCAGTGGCTTCTTCATTTCAGGGTATCAAAAAGTCTATATTCAGAATAAGAGAATCACCTA AAGAGACTTTCAATGCAAGTTTTTCAGGTCATATGACTGATCCAAACTTTAAAAAAGAAACTGAAGCCTCTGAAAGTGGACTGGAAATACATACTGTTTGCTCACAGAAGGAGGACTCCTTATGTCCAAATTTAATTGATAATGGAAGCTGGCCAGCCACCACCACACAGAATTCTGTAGCTTTGAAGAATGCAGG TTTAATATCCACTTTGAAAAAGAAAACAAATAAGTTTATTTATGCTATACATGATGAAACATCTTATAAAGGAAAAAAAATACCGAAAGACCAAAAATCAGAACTAATTAACTGTTCAGCCCAGTTTGAAGCAAATGCTTTTGAAGCACCACTTACATTTGCAAATGCTGATTCAGGTTTATTGCATTCTTCTGTGAAAA GAAGCTGTTCACAGAATGATTCTGAAGAACCAACTTTGTCCTTAACTAGCTCTTTTGGGACAATTCTGAGGAAATGTTCTAGAAATGAAACATGTTCTAATAATACAGTAATCTCTCAGGATCTTGATTATAAAGAAGCAAAATGTAATAAGGAAAAACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCAT GCCTGCAGGAAGGACAGTGTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGATATAAAAGAAGAGGTCTTGGCTGCAGCATGTCACCCAGTACAACATTCAAAAGTGGAATACAGTGATACTGACTTTCAATCCCAGAAAAGTCTTTTATATGATCATGAAAATGCCAGCACTCTTATTTTAACTCCTACTTCCAAG GATGTTCTGTCAAACCTAGTCATGATTTCTAGAGGCAAAGAATCATACAAAATGTCAGACAAGCTCAAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAAAATATTCCCATGGAAAAGAATCAAGATGTATGTGCTTTAAATGAAAATTATAAAAACGTTGAGCTGTTGCCACCTGAAAAATACATGAGAGTA GCATCACCTTCAAGAAAGGTACAATTCAACCAAAACACAAATCTAAGAGTAATCCAAAAAAATCAAGAAGAAACTACTTCAATTTCAAAAATAACTGTCAATCCAGACTCTGAAGAACTTTTCTCAGACAATGAGAATAATTTTGTCTTCCAAGTAGCTAATGAAAGGAATAATCTTGCTTTAGGAAATACTAAGGAAC TTCATGAAACAGACTTGACTTGTGTAAACGAACCCATTTTCAAGAACTCTACCATGGTTTTATATGGAGACACAGGTGATAAACAAGCAACCCAAGTGTCAATTAAAAAAGATTTGGTTTATGTTCTTGCAGAGGAGAACAAAAATAGTGTAAAGCAGCATATAAAAATGACTCTAGGTCAAGATTTAAAATCGGAC ATCTCCTTGAATATAGATAAAATACCAGAAAAAAATAATGATTACATGAACAAATGGGCAGGACTCTTAGGTCCAATTTCAAATCACAGTTTTGGAGGTAGCTTCAGAACAGCTTCAAATAAGGAAATCAAGCTCTCTGAACATAACATTAAGAAGAGCAAAATGTTCTTCAAAGATATTGAAGAACAATATCCTACT AGTTTAGCTTGTGTTGAAATTGTAAATACCTTGGCATTAGATAATCAAAAGAAACTGAGCAAGCCTCAGTCAATTAATACTGTATCTGCACATTTACAGAGTAGTGTAGTTGTTTCTGATTGTAAAAATAGTCATATAACCCCTCAGATGTTATTTTCCAAGCAGGATTTTAATTCAAACCATAATTTAACACCTAGCC AAAAGGCAGAAATTACAGAACTTTCTACTATATTAGAAGAATCAGGAAGTCAGTTTGAATTTACTCAGTTTAGAAAACCAAGCTACATATTGCAGAAGAGTACATTTGAAGTGCCTGAAAACCAGATGACTATCTTAAAGACCACTTCTGAGGAATGCAGAGATGCTGATCTTCATGTCATAATGAATGCCCCATCG ATTGGTCAGGTAGACAGCAGCAAGCAATTTGAAGGTACAGTTGAAATTAAACGGAAGTTTGCTGGCCTGTTGAAAAATGACTGTAACAAAAGTGCTTCTGGTTATTTAACAGATGAAAATGAAGTGGGGTTTAGGGGCTTTTATTCTGCTCATGGCACAAAACTGAATGTTTCTACTGAAGCTCTGCAAAAAGCTG TGAAACTGTTTAGTGATATTGAGAATATTAGTGAGGAAACTTCTGCAGAGGTACATCCAATAAGTTTATCTTCAAGTAAATGTCATGATTCTGTTGTTTCAATGTTTAAGATAGAAAATCATAATGATAAAACTGTAAGTGAAAAAAATAATAAATGCCAACTGATATTACAAAATAATATTGAAATGACTACTGGCACT TTTGTTGAAGAAATTACTGAAAATTACAAGAGAAATACTGAAAATGAAGATAACAAATATACTGCTGCCAGTAGAAATTCTCATAACTTAGAATTTGATGGCAGTGATTCAAGTAAAAATGATACTGTTTGTATTCATAAAGATGAAACGGACTTGCTATTTACTGATCAGCACAACATATGTCTTAAATTATCTGGCC AGTTTATGAAGGAGGGAAACACTCAGATTAAAGAAGATTTGTCAGATTTAACTTTTTTGGAAGTTGCGAAAGCTCAAGAAGCATGTCATGGTAATACTTCAAATAAAGAACAGTTAACTGCTACTAAAACGGAGCAAAATATAAAAGATTTTGAGACTTCTGATACATTTTTTCAGACTGCAAGTGGGAAAAATATTA GTGTCGCCAAAGAGTCATTTAATAAAATTGTAAATTTCTTTGATCAGAAACCAGAAGAATTGCATAACTTTTCCTTAAATTCTGAATTACATTCTGACATAAGAAAGAACAAAATGGACATTCTAAGTTATGAGGAAACAGACATAGTTAAACACAAAATACTGAAAGAAAGTGTCCCAGTTGGTACTGGAAATCAACT AGTGACCTTCCAGGGACAACCCGAACGTGATGAAAAGATCAAAGAACCTACTCTGTTGGGTTTTCATACAGCTAGCGGGAAAAAAGTTAAAATTGCAAAGGAATCTTTGGACAAAGTGAAAAACCTTTTTGATGAAAAAGAGCAAGGTACTAGTGAAATCACCAGTTTTAGCCATCAATGGGCAAAGACCCTAAA GTACAGAGAGGCCTGTAAAGACCTTGAATTAGCATGTGAGACCATTGAGATCACAGCTGCCCCAAAGTGTAAAGAAATGCAGAATTCTCTCAATAATGATAAAAACCTTGTTTCTATTGAGACTGTGGTGCCACCTAAGCTCTTAAGTGATAATTTATGTAGACAAACTGAAAATCTCAAAACATCAAAAAGTATCT TTTTGAAAGTTAAAGTACATGAAAATGTAGAAAAAGAAACAGCAAAAAGTCCTGCAACTTGTTACACAAATCAGTCCCCTTATTCAGTCATTGAAAATTCAGCCTTAGCTTTTTACACAAGTTGTAGTAGAAAAACTTCTGTGAGTCAGACTTCATTACTTGAAGCAAAAAAATGGCTTAGAGAAGGAATATTTGATG GTCAACCAGAAAGAATAAATACTGCAGATTATGTAGGAAATTATTTGTATGAAAATAATTCAAACAGTACTATAGCTGAAAATGACAAAAATCATCTCTCCGAAAAACAAGATACTTATTTAAGTAACAGTAGCATGTCTAACAGCTATTCCTACCATTCTGATGAGGTATATAATGATTCAGGATATCTCTCAAAAAA TAAACTTGATTCTGGTATTGAGCCAGTATTGAAGAATGTTGAAGATCAAAAAAACACTAGTTTTTCCAAAGTAATATCCAATGTAAAAGATGCAAATGCATACCCACAAACTGTAAATGAAGATATTTGCGTTGAGGAACTTGTGACTAGCTCTTCACCCTGCAAAAATAAAAATGCAGCCATTAAATTGTCCATATC TAATAGTAATAATTTTGAGGTAGGGCCACCTGCATTTAGGATAGCCAGTGGTAAAATCGTTTGTGTTTCACATGAAACAATTAAAAAAGTGAAAGACATATTTACAGACAGTTTCAGTAAAGTAATTAAGGAAAACAACGAGAATAAATCAAAAATTTGCCAAACGAAAATTATGGCAGGTTGTTACGAGGCATTGG ATGATTCAGAGGATATTCTTCATAACTCTCTAGATAATGATGAATGTAGCACGCATTCACATAAGGTTTTTGCTGACATTCAGAGTGAAGAAATTTTACAACATAACCAAAATATGTCTGGATTGGAGAAAGTTTCTAAAATATCACCTTGTGATGTTAGTTTGGAAACTTCAGATATATGTAAATGTAGTATAGGGA AGCTTCATAAGTCAGTCTCATCTGCAAATACTTGTGGGATTTTTAGCACAGCAAGTGGAAAATCTGTCCAGGTATCAGATGCTTCATTACAAAACGCAAGACAAGTGTTTTCTGAAATAGAAGATAGTACCAAGCAAGTCTTTTCCAAAGTATTGTTTAAAAGTAACGAACATTCAGACCAGCTCACAAGAGAAGAA AATACTGCTATACGTACTCCAGAACATTTAATATCCCAAAAAGGCTTTTCATATAATGTGGTAAATTCATCTGCTTTCTCTGGATTTAGTACAGCAAGTGGAAAGCAAGTTTCCATTTTAGAAAGTTCCTTACACAAAGTTAAGGGAGTGTTAGAGGAATTTGATTTAATCAGAACTGAGCATAGTCTTCACTATTCA CCTACGTCTAGACAAAATGTATCAAAAATACTTCCTCGTGTTGATAAGAGAAACCCAGAGCACTGTGTAAACTCAGAAATGGAAAAAACCTGCAGTAAAGAATTTAAATTATCAAATAACTTAAATGTTGAAGGTGGTTCTTCAGAAAATAATCACTCTATTAAAGTTTCTCCATATCTCTCTCAATTTCAACAAGACA AACAACAGTTGGTATTAGGAACCAAAGTCTCACTTGTTGAGAACATTCATGTTTTGGGAAAAGAACAGGCTTCACCTAAAAACGTAAAAATGGAAATTGGTAAAACTGAAACTTTTTCTGATGTTCCTGTGAAAACAAATATAGAAGTTTGTTCTACTTACTCCAAAGATTCAGAAAACTACTTTGAAACAGAAGCAG TAGAAATTGCTAAAGCTTTTATGGAAGATGATGAACTGACAGATTCTAAACTGCCAAGTCATGCCACACATTCTCTTTTTACATGTCCCGAAAATGAGGAAATGGTTTTGTCAAATTCAAGAATTGGAAAAAGAAGAGGAGAGCCCCTTATCTTAGTGGGAGAACCCTCAATCAAAAGAAACTTATTAAATGAATTT GACAGGATAATAGAAAATCAAGAAAAATCCTTAAAGGCTTCAAAAAGCACTCCAGATGGCACAATAAAAGATCGAAGATTGTTTATGCATCATGTTTCTTTAGAGCCGATTACCTGTGTACCCTTTCGCACAACTAAGGAACGTCAAGAGATACAGAATCCAAATTTTACCGCACCTGGTCAAGAATTTCTGTCTAA ATCTCATTTGTATGAACATCTGACTTTGGAAAAATCTTCAAGCAATTTAGCAGTTTCAGGACATCCATTTTATCAAGTTTCTGCTACAAGAAATGAAAAAATGAGACACTTGATTACTACAGGCAGACCAACCAAAGTCTTTGTTCCACCTTTTAAAACTAAATCACATTTTCACAGAGTTGAACAGTGTGTTAGGAAT ATTAACTTGGAGGAAAACAGACAAAAGCAAAACATTGATGGACATGGCTCTGATGATAGTAAAAATAAGATTAATGACAATGAGATTCATCAGTTTAACAAAAACAACTCCAATCAAGCAGCAGCTGTAACTTTCACAAAGTGTGAAGAAGAACCTTTAGATTTAATTACAAGTCTTCAGAATGCCAGAGATATACAG GATATGCGAATTAAGAAGAAACAAAGGCAACGCGTCTTTCCACAGCCAGGCAGTCTGTATCTTGCAAAAACATCCACTCTGCCTCGAATCTCTCTGAAAGCAGCAGTAGGAGGCCAAGTTCCCTCTGCGTGTTCTCATAAACAGCTGTATACGTATGGCGTTTCTAAACATTGCATAAAAATTAACAGCAAAAATG CAGAGTCTTTTCAGTTTCACACTGAAGATTATTTTGGTAAGGAAAGTTTATGGACTGGAAAAGGAATACAGTTGGCTGATGGTGGATGGCTCATACCCTCCAATGATGGAAAGGCTGGAAAAGAAGAATTTTATAGGGCTCTGTGTGACACTCCAGGTGTGGATCCAAAGCTTATTTCTAGAATTTGGGTTTATAA TCACTATAGATGGATCATATGGAAACTGGCAGCTATGGAATGTGCCTTTCCTAAGGAATTTGCTAATAGATGCCTAAGCCCAGAAAGGGTGCTTCTTCAACTAAAATACAGATATGATACGGAAATTGATAGAAGCAGAAGATCGGCTATAAAAAAGATAATGGAAAGGGATGACACAGCTGCAAAAACACTTGTT CTCTGTGTTTCTGACATAATTTCATTGAGCGCAAATATATCTGAAACTTCTAGCAATAAAACTAGTAGTGCAGATACCCAAAAAGTGGCCATTATTGAACTTACAGATGGGTGGTATGCTGTTAAGGCCCAGTTAGATCCTCCCCTCTTAGCTGTCTTAAAGAATGGCAGACTGACAGTTGGTCAGAAGATTATTCT TCATGGAGCAGAACTGGTGGGCTCTCCTGATGCCTGTACACCTCTTGAAGCCCCAGAATCTCTTATGTTAAAGATTTCTGCTAACAGTACTCGGCCTGCTCGCTGGTATACCAAACTTGGATTCTTTCCTGACCCTAGACCTTTTCCTCTGCCCTTATCATCGCTTTTCAGTGATGGAGGAAATGTTGGTTGTGT TGATGTAATTATTCAAAGAGCATACCCTATACAGTGGATGGAGAAGACATCATCTGGATTATACATATTTCGCAATGAAAGAGAGGAAGAAAAGGAAGCAGCAAAATATGTGGAGGCCCAACAAAAGAGACTAGAAGCCTTATTCACTAAAATTCAGGAGGAATTTGAAGAACATGAAGAAAACACAACAAAACCA TATTTACCATCACGTGCACTAACAAGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCAGCAGACCCAGCTTACCTTGAGGGTTATTTCAGTGAAGAGCAGTTAAGAGCCTTGAATAATCACAGGCAAATGTTGAATGATAAGAAACAAGCTCAGATCCAGTTGGAAATT AGGAAGGCCATGGAATCTGCTGAACAAAAGGAACAAGGTTTATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGATTCAGTTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTC AAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAACTCAGTATCAACAACTACCGGTTTCAGATGAAATTTTATTTCAGATTTACCAGCCACGGGAGCCCCTTCACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGAGGTGGACCTAATAGGATTTGTCGTTT CTGTTGTGAAAAAAACAGGACTTGCCCCTTTCGTCTATTTGTCAGACGAATGTTACAATTTACTGGCAATAAAGTTTTGGATAGACCTTAATGAGGACATTATTAAGCCTCATATGTTAATTGCTGCAAGCAACCTCCAGTGGCGACCAGAATCCAAATCAGGCCTTCTTACTTTATTTGCTGGAGATTTTTCTGTG TTTTCTGCTAGTCCAAAAGAGGGCCACTTTCAAGAGACATTCAACAAAATGAAAAATACTGTTGAGAATATTGACATACTTTGCAATGAAGCAGAAAACAAGCTTATGCATATACTGCATGCAAATGATCCCAAGTGGTCCACCCCAACTAAAGACTGTACTTCAGGGCCGTACACTGCTCAAATCATTCCTGGTAC AGGAAACAAGCTTCTGATGTCTTCTCCTAATTGTGAGATATATTATCAAAGTCCTTTATCACTTTGTATGGCCAAAAGGAAGTCTGTTTCCACACCTGTCTCAGCCCAGATGACTTCAAAGTCTTGTAAAGGGGAGAAAGAGATTGATGACCAAAAGAACTGCAAAAAGAGAAGAGCCTTGGATTTCTTGAGTAGA CTGCCTTTACCTCCACCTGTTAGTCCCATTTGTACATTTGTTTCTCCGGCTGCACAGAAGGCATTTCAGCCACCAAGGAGTTGTGGCACCAAATACGAAACACCCATAAAGAAAAAAGAACTGAATTCTCCTCAGATGACTCCATTTAAAAAATTCAATGAAATTTCTCTTTTGGAAAGTAATTCAATAGCTGACGA AGAACTTGCATTGATAAATACCCAAGCTCTTTTGTCTGGTTCAACAGGAGAAAAACAATTTATATCTGTCAGTGAATCCACTAGGACTGCTCCCACCAGTTCAGAAGATTATCTCAGACTGAAACGACGTTGTACTACATCTCTGATCAAAGAACAGGAGAGTTCCCAGGCCAGTACGGAAGAATGTGAGAAAAAT AAGCAGGACACAATTACAACTAAAAAATATATCTAAGCATTTGCAAAGGCGACAATAAATTATTGACGCTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAAACCACACATTAGTACTTATGTTGCACAATGAGAAAAGAAATTAGTTTCAAATTTACCTCAGCGTTTGTGTATCGGGCAAAAATCGTTTTGC CCGATTCCGTATTGGTATACTTTTGCTTCAGTTGCATATCTTAAAACTAAATGTAATTTATTAACTAATCAAGAAAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCCCAACACTTTGAGAAGCTGAGGTGGGAGGAGTGCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACATAGGGAGACCC CCATCTTTACGAAGAAAAAAAAAAAGGGGAAAAGAAAATCTTTTAAATCTTTGGATTTGATCACTACAAGTATTATTTTACAATCAACAAAATGGTCATCCAAACTCAAACTTGAGAAAATATCTTGCTTTCAAATTGACACTA GGCTTTAAGTATCCATGGCTTTAAGTATCCATGGCTTTAAGTATCCATGGCTTTAAGTATCCAT
  • 15. ―Founder Effect‖ • The majority of people tested have a unique mutation – one that is specific to them and their family. – Hundreds of unique mutations have been found. – Some are recurring, however. • Ashkenazi Jewish population has 3 specific genes that recur: Two BRCA1 and One BRCA2 – 185delAG; 5382insC; 6174delT – 1996 study by Muto,et.al: • 19% of Jewish women with ovarian cancer in Mass and Israel had 185delAG • 12% of breast cancers in Ashkenazi Jews are attributable to BRCA 1 or BRCA 2 (Journal of National Cancer Institute, 1999) – Genes come from groups of people who do not go out of their small groups to find a mate (interbreeding).
  • 16. How do you get the bad gene?
  • 17. BRCA Mutation Increases Breast and Ovarian Cancer Risks AJHG 1995;56:265-271 Science 2003: 643-646 JCO 2005 23 (8): 1656-63 NCI 2005 20 40 60 80 100 Breast cancer by age 50 Breast cancer by age 70 Ovarian cancer by age 70 2% Up to 50% 8% Up to 87% RiskofCancer(%) <1% Up to 44% General Population BRCA Mutation Lancet 1994;343:692-695 NEJM 1997;336:1401-1408 AJHG 2003;72:1117-1130
  • 18. BRCA Mutation Increases Risk of Second Breast Cancer Lancet 1998;351:316-21 JCO 2004;22:2328-35 Lancet 1994;3343:692-5 Gynecol Oncol. 2005 Jan;96(1):222-6 0 20 40 60 Breast Cancer after 5 years Breast Cancer by age 70 Up to 3.5% Up to 27% Up to 11% Up to 64% RiskofCancer(%) General Population BRCA Mutation Ca Epi Biomarkers Prev. 1999;8(10):855-61 JNCI 1999;15:1310-6 JCO 1998;16:2417-25
  • 19. Risks in Men With a BRCA Mutation JCO 2004;22: 735-42 Breast Cancer by age 80 Prostate Cancer by age 80 General Population BRCA Mutation* 5 10 15 20 25 <1% 7% 15% 20% RiskofCancer(%) *Risks refer to BRCA2 mutation carriers. Risks for male BRCA1 mutation carriers are less characterized
  • 20. ―Red Flags‖ for Hereditary Breast and Ovarian Cancer Syndrome • For Women or Men with a newly diagnosed breast cancer: – Diagnosed at < 45 with or without FH – Diagnosed at 45-50 with at a least one close blood relative with breast cancer and/or at least one close blood relative with ovarian cancer. Some would test all women in their 40s – Bilateral breast cancer – Diagnosed >50 with two or more close blood relatives with breast or ovarian cancer at any age – Close male relative with breast cancer – Personal history of ovarian cancer – Specific ethnicity associated with founder mutations (Ashkenazi Jewish, Icelandic, Swedish, Hungarian) especially along with family history
  • 21. ―Red Flags‖ for Women & Men who do not have Cancer • Women or Men who do not currently have cancer are at risk: – Family member with known BRCA 1 or BRCA 2 mutation – Previous history of breast cancer from the previously stated risk factors. (The test has only been available for ten years) – Personal history of ovarian cancer – One or more close male relatives with breast cancer – Two or more female relatives with breast cancer especially at age <50 on either maternal or paternal side – One or more close female relatives with ovarian cancer – Specific ethnicity as stated previously along with family history • REMEMBER: The family member who had the cancer diagnosis should always be tested FIRST if possible.
  • 22. Family History Considerations • One-half of BRCA carriers inherit the mutation from their father • Ovarian cancer is a very important indicator • Early onset breast cancer is more important than the number of affected family members Science 2003:302(5645):643-6
  • 23. New Considerations • Triple Negative Breast Cancer: – Research has shown that women who have breast cancer not sensitive to hormones or a drug called Herceptin are more inclined to have the BRCA gene even without a family history. – Testing is indicated if you have triple negative breast cancer under age 60 • Pancreatic Cancer: – If two or more people in the family have had pancreatic cancer that may be a criteria for testing – The gene will be found in 17-19% of those families
  • 24. Prevalence of BRCA Mutations – Non Jewish www.brcacalculator.com Ovarian cancer in one relative, no breast cancer <50 21.1%23.1%8.8% Ovarian cancer, no breast cancer 16.9%15.8%6.8% Breast cancer <50 5.6%4.5%2.8% No breast or ovarian cancer Breast cancer <50, no ovarian cancer No breast cancer <50 or ovarian cancer Patient‟s History Family History
  • 25. Prevalence of Mutations in Ashkenazi Jewish Individuals www.brcacalculator.com 42.0%37.0%22.2% Ovarian cancer, no breast cancer 38.8%24.2%12.0% Breast cancer <50 15.6%13.7%6.9% No breast or ovarian cancer Breast cancer <50, no ovarian cancer No breast cancer <50 or ovarian cancer Patient‟s History Family History Ovarian cancer in one relative, no breast cancer <50
  • 26. Genetic Testing • Benefits – Allows for individualized medical management – Accurate risk assessment – Alleviates uncertainty and anxiety • Limitations – Genetic testing for BRCA1 and BRCA2 does not identify all causes of hereditary breast or ovarian cancer © 2007 Myriad Genetic Laboratories, Inc.
  • 27. Interpreting Test Results • Positive for a deleterious mutation • No mutation detected (negative test) – Mutation has been previously identified in the family – No known mutation in the family or the family hasn‘t been tested • Genetic variant of uncertain significance © 2007 Myriad Genetic Laboratories, Inc.
  • 28. Positive for a Deleterious Mutation • BRCA-associated cancer risks • 50% chance for first degree relatives to have the same mutation – Children – Siblings – Parents • Test relatives for identified familial mutation © 2007 Myriad Genetic Laboratories, Inc.
  • 29. Negative Test (no mutation detected) • Does not mean that the patient cannot or will not develop breast cancer. • Only means that they are not at risk for developing hereditary breast cancer related to the BRCA mutations for which they were tested.
  • 30. Negative Test (no mutation detected) • Family History is positive for the gene • General population cancer risks—if no cancer history on the other side of the family • Avoid unnecessary screening/surgery • Can‘t pass on the gene • Family History is negative or unknown for the gene • Most difficult to interpret • Risk is based on total family history and can still be significant. © 2007 Myriad Genetic Laboratories, Inc.
  • 31. Family History & BRCA Positive and Negative CancerRisks% 50 Age (Years) 30 50 70 Positive for deleterious BRCA mutation 100 Risk based on family history Negative for familial BRCA mutation Reprinted with permission from Ponder B: Genetic Testing for Cancer Risk. Science 1997; 278:1050-4. Copyright 1997 American Association for the Advancement of Science
  • 32. Genetic Variant of uncertain significance • Clinical significance not yet known. It is neither positive or negative. • Manage based on personal and family cancer history. • May be further clarified, and then re- classified as positive or negative later on as more information is identified. © 2007 Myriad Genetic Laboratories, Inc.
  • 33. Managing Hereditary Cancer Risk • Surveillance • Chemoprevention • Prophylactic surgery *Individual risk reduction may vary based on personal health history
  • 34. Screening for Ovarian Cancer • Screening for Familial Ovarian Cancer – Poor Survival – Most cancers are diagnosed at Stage 3 and 4 – Transvaginal U.S. & CA 125 are ineffective in detecting tumors at a sufficiently early stage to influence survival. Only detect 57% stage 1 – Ovarian cancer is 1/8 as common as breast, but 3 times more lethal • Should be followed by an OB/GYN
  • 35. Prophylactic Oophorectomy • Recommend bilateral salpingo- oophorectomy (BSO) at age 35 or after childbearing is complete – ~96% ovarian cancer risk reduction in BRCA carriers – Can reduce breast cancer risk by up to 68% for both BRCA1 and BRCA2 mutation carriers if the woman is pre- menopausal JAMA. 2006;296:185-92 Clin Oncol. 2005 Mar 10;23(8):1656-63
  • 36. Prophylactic Ovarian removal - Bilateral Oophorectomy (BSO) • Does HRT increase cancer risk after oophorectomy (ovarian removal)? – No measurable effect with ―short term usage‖ of Estrogen alone – Estrogen until menopausal age – 50 • Unopposed estrogen does increase the risk of uterine cancer. Adding a hysterectomy to the BSO would eliminate that risk, however, a much bigger operation.
  • 37. Surveillance for Breast Cancer www.nccn.org Cancer Procedure Age to begin Frequency Breast self-exam 18 yrs Monthly Clinical breast exam 25 yrs Twice a year Mammography 25 yrs Yearly MRI 25 yrs Yearly
  • 38. Screening with MRI in BRCA patients • JAMA, 2004: MRI most sensitive in detecting cancer and can decrease mortality in high risk women. • Adequacy of screening women with BRCA mutations with only Mammo was not shown to be good enough even if the women had fatty or low-dense breasts. • Waiting a year between screening is too long – BRCA patient‘s cancers grow faster than sporadic cancers.
  • 39. Chemoprevention of Breast Cancer Tamoxifen • Selective Estrogen Receptor Modulator (SERM) – it blocks hormones from affecting breast cells • Affected BRCA carriers: 50% decrease for contralateral breast cancer • Unaffected BRCA2 carriers: 62% decrease in the risk of cancer • Unaffected high-risk: 45% decrease • Risks – increased risk of uterine cancer and clotting. Low risk in women who took the medication under age 50 Int J Cancer. 2006;118(9):2281-4 Lancet 2000;356:1876-81
  • 40. Prophylactic Mastectomy • Greater than 90% breast cancer risk reduction in BRCA carriers. May be has high as 95-98% reduction • 100 women having prophylactic surgery 1995- 2006 • 18/100 had abnormal lesions • 3 invasive cancer • 8 in situ cancer • 7 ADH •Eur J Surg Oncol 2008, April 21
  • 41. Reconstruction after Mastectomy has come a long way Postoperative left mastectomy – left latissimus flap and implant Pre-operative view
  • 43. Insurance Coverage of Genetic Testing • All major carriers provide coverage for genetic testing • Established guidelines – Medicare – Most major carriers – Some insurance companies have genetic exclusions and will not pay no matter what the indication - rare • Cost: $3,350 • Cost if known family mutation: $450 • Supreme Court ruling may allow other companies to compete and the price may go down © 2007 Myriad Genetic
  • 44. Genetic Discrimination • Federal and state laws prohibit the use of genetic information as a ‗pre-existing condition‘ – Federal HIPAA legislation – The majority of states have additional laws • Over 175,000 clinical tests performed to date • No documented cases of genetic discrimination AJHG 2000;66:293
  • 45. Gina Legislation • U.S. President George W. Bush signed into law May 21, 2008 the first civil rights legislation of the new millennium, the Genetic Information Nondiscrimination Act (GINA). • GINA is the first and only federal legislation that will provide protections against discrimination based on an individual‘s genetic information in health insurance coverage and employment settings.
  • 46. How do you test? • Talk to your Primary Care Physician – Your Doctor may feel comfortable with the discussion and go ahead and test you; or they may send you to a breast specialist to discuss your risks and whether the test is right for you. – The test is either blood or saliva – The results are available in 2-3 weeks if insurance approves • Genetic Counselors – If your BRCA test is negative but you have a very strong FH – may need additional testing • Other rare mutations exist – p53. pTEN/MMAC1 • Dr Jennifer Klemp in Kansas City: 913-588-7750
  • 47. Summary/Case Presentations 1. BRCA 1 and 2 gene increase the risk of breast and ovarian cancer significantly 2. ―Red Flags‖ such as multiple women with breast or ovarian cancer in a family, especially at a young age clue us in to the possibility that the gene may be present 3. A blood and saliva test is available to identify the gene 4. Options are available to improve screening and decrease risk in women who have the gene © 2007 Myriad Genetic
  • 48. Rachel, age 40 – no cancer
  • 50. Rachel--Ovarian Recommendations • Her risk of ovarian cancer is 40-50% • She is 40 and has completed child- bearing – Recommend: bilateral oophorectomy (ovary removal) +/- hysterectomy – Ovarian removal decreases her risk of breast cancer by over 50% – Unopposed Estrogen for 10 years okay, but it increases her risk of uterine cancer if she doesn‘t have a hysterectomy
  • 51. Rachel – Breast Recommendations • Risk of Breast Cancer: 50-87% • Options – Increase screening with Mammogram and MRI yearly separated by 6 months – Above + Tamoxifen for 5 years to decrease her risk by 50% – Bilateral prophylactic mastectomies with or without reconstruction
  • 52. Rachel – Family Recommendations • Consider testing her Brother – If he tests Negative then his daughter couldn‘t inherit the gene from him • Rachel‘s Children – each has a 50:50 chance of inheriting the gene.
  • 54. Heather • Heather is at risk because her p Aunt had breast cancer at a young age • The best person to test would be – Heather‘s Aunt – the person affected by cancer • If her aunt is positive then I would test – Heather‘s Father • If he is positive then I would test – Heather
  • 55. Heather • Heather‘s aunt was positive • Heather‘s Dad was negative • What is Heather‘s risk? – 10-13%, same as the general population • Does she or her brother or sister need to be tested? – No, their Dad was negative • Does her uncle and other two aunts need to be tested? – Yes, they all have a 50:50 chance of having the gene.
  • 56. Conclusion • The BRCA gene is rare, but can significantly increase the risk of breast and ovarian cancer in patient‘s who have this mutation. • In patients who meet criteria, the test can easily be done. • If positive, there are many options available to follow and potentially prevent cancer.

Notes de l'éditeur

  1. Good afternoon, my name is Patty Tenofsky and I am a breast surgeon at the Via Christi Clinic. I will be discussing Breast Cancer Genetic Testing- It is right for you?
  2. Angelina Jolie said yes it was right for her, making this a very timely and popular recent topic.
  3. This is Angelina Jolie’s mother – Marcheline Bertrand pictured in 2001 at age 50, about the time she was diagnosed with ovarian cancer.
  4. This is a quote from her in a letter to the editor in the New York Times, 5/14/13. Her family history is quite extensive. Her mother had previously battled breast cancer, but then developed ovarian cancer at age 49 and died of the disease at age 56Her GM died of ovarian cancer as well at age 45Her m aunt (Her mother’s sister) died of breast cancer at age 61 just this year.Angelina Jolie is 37 years old and does not have cancer, but she chose to have preventative double mastectomies when she found out that she had the BRCA 1 gene. She has said in interview that she plans to have her ovaries removed when she is certain she does not want to have any more children.
  5. Another famous actress Christian Applegate was being followed very carefully for breast cancer because of family history. She was diagnosed with an early stage of breast cancer at age 36. She was also found to have the BRCA 1 gene like Angelina Jolie. She chose to undergo bilateral mastectomies as well.
  6. In order to know about the breast cancer gene, we first have to know a little about breast and ovarian cancer statistics. In the U.S., there is 200,000 cases of breast cancer/year. That is a 10-13% lifetime risk of developing breast cancer if you are a woman. The two most important risk factors for breast cancer is being a woman and getting older.Other risk factors include FH, Early age at first menstrual cycle, late or no pregnancy, hormone replacement medication, alcohol use, obesity, and lack of exerciseThere are approximately 25,000 cases of ovarian cancer per year which gives a lifetime risk of &lt;2%
  7. The vast majority of breast cancers will occur in women who have NO family history of breast cancer and are not linked to heredity or genetics. These nonhereditary cancers are called Sporadic Breast Cancers and are the most common type of breast cancer (see pie chart). The risk of breast cancer increases as a woman ages. It is less likely to occur before age 50. If you live to 90 then your risk of developing breast cancer is 1 in 8 or about 13% even with no family history. Therefore, ALL women over age 40 should be screened for breast cancer with mammograms, even if they have no family history.25% of woman will develop breast cancer with a family history , but there is no known genetic abnormality. Only 10% will develop breast cancer with a mutation of the BRCA gene. It is rare.
  8. The official name of the BRCA mutation is the Hereditary Breast and Ovarian Cancer Syndrome. The syndrome is characterized by a significantly increased risk of breast and ovarian cancer, but it is RARE: only 1 in 800 people will have it. That means we would have to have 8 roomfuls of people like you to find one mutation on average. BUT, it’s more common if you have a Jewish background – which will discuss in a bit. You will learn that most cases are caused by a mutation in the BRCA 1 or 2 gene. We will discuss it’s characteristics, testing and treatment. Hopefully at the conclusion of our discussion you will understand more about the decision Angelina Jolie made and if genetic testing is something you need to be concerned about.
  9. One of the easier mutations to understand is sickle cell anemiaIn Sickle Cell Anemia there is only 1 letter that is out of place and it completely alters the person’s Red Blood Cell.If you look at the top normal chain – the letters spellGTG- ValineCAC-HistidineCTG-LeucineACT-ThreonineCCT-ProlineGAG-Glutamic AcidGAG-Glutamic AcidNow look at the Lower DNA chain: It is all the same except a T is substituted for an A and GTG spells valine not Glutamic acid. That alters the RBC shape so that it is Sickled instead of donut shaped. It cannot carry oxygen as well and therefore the patient develops sickle cell anemia.
  10. The purpose of the previous gene was to make the Red Blood Cells that carry our oxygen. The purpose of the BRCA gene on the other hand is to make proteins that fight changes in your DNA that can occur when normal cells divide. These proteins seek out and eliminate errors that occur. In other words it is a cancer fighter gene. If a change occurs in your normal DNA, then the cell and DNA start to divide rapidly and can become cancer cells. Think of them as speeders on the highway. The purpose of BRCA is to act as a highway patrol man to stop the speeders and not allow them to proceed on to become cancer. There are many of these repair highway patrolmen throughout your DNA – this is just one of them. If your BRCA gene is mutated – it is like the highway patrolmen has a flat tire and is stuck on the side of the road. He can’t catch the speeders and they can go on to become cancer. If the BRCA gene isn’t right this alteration interferes with normal gene activity and makes the person with the altered gene more susceptible to developing breast or ovarian cancer.
  11. This type of mutation is considered autosomal dominant which means that if one of your parents have the gene then you have a 50:50 chance of having the mutation.We are all born with 2 copies of our genes. One from our Mom and one from our Dad. In this slides the little b means normal BRCA gene and the capital B means a mutated BRCA gene. The father has 2 normal BRCA genes and the Mother has one normal and one mutated BRCA gene. The mutated gene is dominant, so the mother has the BRCA syndrome.Look at the 4 children now:1st Daughter – She got the mutated gene from her mother and the normal gene from her father – she is therefore BRCA +2nd Daughter – Normal genes from both parents and therefore she is BRCA-3rd Son – He got the mutated gene from his mother and is therefore BRCA +4th Son – He got two normal genes and is therefore BRCA –Statistics say that if there are 4 children two would be positive and two would be negative. But each child has a 50:50 chance. You could flip a coin 4 times and turn up heads each time. So it would be possible that all 4 could be positive or negative. The only way to know would be to test.
  12. These are the “Red Flags” for women and men who do not have cancer, but are at risk – like Angelina Jolie.
  13. Research on women who have a certain type of cancer called triple negative has shown a very high risk of carrying the breast cancer gene – even without a family history. Triple negative means that the cancer was NOT sensitive to estrogen, progesterone, or Herceptin. If a women has a triple negative breast cancer under age 60 then she is a candidate for testing.Unfortunately, Pancreatic cancer has also been linked to this gene. If two or more people in the family have had pancreatic cancer, this could be a criteria for testing and the gene could be found in 17-19% of those families.The risk of pancreatic cancer is only 0.05 % by age 50 and is .5% by age 70.With the BRCA gene it increases that risk to .5% and 5%Overall it increases the risk of pancreatic cancer 3.5 to 10x over the general population.If you have pancreatic cancer and no family history your risk of having the gene is 5-10%SO the BRCA gene has been linked to breast, ovarian, pancreatic and prostate cancer in men
  14. Now that we have a positive BRCA test there are three main management strategies. SurveillanceChemopreventionProphylactic surgery
  15. If your ovaries are removed, then you will go into menopause. Is it safe to take HRT when you still have breasts with the BRCA gene. Surprisingly it is safe for a short period of time 10-15 years or until natural menopause age. But, only with unopposed estrogen NOT with combination with progesterone. Unfortunately unopposed estrogen increases the risk of uterine cancer. Adding a hysterectomy to BSO would eliminate that risk but is a bigger operation.
  16. The last picture showed mastectomies without reconstruction. Reconstruction has come a long way. In this picture the woman had a mastectomy on one side and has her native breast on the other. Her nipple was removed. Notice that the match is pretty good and the newly created nipple looks fairly normal.
  17. Even newer is nipple sparing mastectomies which in smaller breasted women can give an exceptionally good cosmetic result with preventative surgery. The incision is hidden below the breast so it looks like the breasts are scarless.
  18. Because of concern that genetic mutations could be potentially used against persons who have them, President George Bush signed into law the GINA legislation (Genetic Information Nondiscrimination Act). It is considered a civil rights law and protects persons against losing their health care or their job due to finding a genetic mutation.
  19. If you have red flags – and are concerned about the BRCA mutation – what do you do?Talk to your PCPThey may test or send you to a breast specialist to discuss it further.If your family history is extensive and the test is negative it may be beneficial to see a genetic counselor to see if there are other rare mutations such as p53 or pten. The closest breast genetic counselor is Dr. Klemp in KC
  20. Let’s do a case together: This is Rachel and she is 40. This is her family tree. She has 2 sisters who are affected by cancer – breast and ovarian, a niece with breast her own mother with ovarian. Her mother has passed. Rachel is at significant risk for the BRCA gene mutation. Rachel’s sisters were tested and were positive so they want to test Rachel at the same site of mutation has her sisters.
  21. Here is her test result. She unfortunately is also positive. Remember we get a normal gene from our one parent and the bad gene from the other parent. This is her DNA test showing the deletion of AG at the 185 position. This is one of the most common BRCA one mutations known.
  22. She is positive so let’s discuss what to do about her ovarian cancer risk which is 40-50%.The recommendation would be ovarian removal with or without a hysterectomyOvarian removal decreases risk of breast cancer by over 50%Estrogen is okay but will increase her risk of uterine cancer if she doesn’t have a hysterectomy
  23. Now we discuss her breast options. Remember her risk of cancer is 50-87% depending on what she does with her ovaries and if she goes on tamoxifen.Her options are:ScreeningScreening + tamoxifenPreventative mastectomies.
  24. Her sister both tested positive. Her Brother can consider testing. If he is negative then he can not pass it to his daughter which can lower her anxiety of developing breast and ovarian cancerAs for Rachel’s children – they all have a 50:50 chance of inheriting the gene.
  25. Heather is 38 and has a paternal aunt who had breast cancer at age 41. Is Heather at risk and who would you test if you could test any of these patients?
  26. Why test her aunt – Because if she is positive then her 3 siblings could be tested to see if they inherited the gene. It would also help heather know that the gene does run in her family Why test her Dad first? Because there are three children and if he is positive they are all at risk but if he is negative then none are at risk.
  27. The BRCA gene is rare, but can significantly increase the risk of both breast and ovarian cancer in patient’s who have this mutation.In patient’s who meet criteria, the test can easily be doneIf positive, there are many options available to follow and potentially prevent cancer
  28. This a poster from an old movie staring Madeline Kahn and Gilda Radner. (FIRST FAMILY, 1980) Both women were Jewish and both died of ovarian cancer at young ages. It is very likely that they both had BRCA mutations, but they died before science discovered the genes. The hope is that now that we know about these mutations, we can test and hopefully we can prevent deaths such as with these women.