Van criekinge next_generation_epigenetic_profling_vvumc_uploaded
•
0 j'aime•1,647 vues
This document discusses next generation epigenetic profiling using methylation-based biomarkers. It provides an overview of epigenetics and methylation in oncology. It then discusses MDxHealth's next-generation epigenetic biomarkers and methylation-based companion diagnostics. As an example, it summarizes research on MGMT promoter methylation predicting benefit from DNA-alkylating chemotherapy in glioblastoma patients.
Recommandé
Recommandé
Contenu connexe
Tendances
Tendances (20)
En vedette
En vedette (20)
Similaire à Van criekinge next_generation_epigenetic_profling_vvumc_uploaded
Similaire à Van criekinge next_generation_epigenetic_profling_vvumc_uploaded (20)
Plus de Prof. Wim Van Criekinge
Plus de Prof. Wim Van Criekinge (20)
Dernier
Dernier (20)
Van criekinge next_generation_epigenetic_profling_vvumc_uploaded
- 2. Next Generation Epigenetic Profiling Wim Van Criekinge 14th november 2013, Boston (US) 20th november 2013, Amsterdam
- 3. Overview Epigene,cs – Introduc*on – Methyla*on & Oncology – Biomarkers MDxHealth – NEXT-‐GENera*on Epigene*c Biomarkers – Methyla*on Based CDx
- 6. Historically, Cancer Was Considered to be Driven Mostly by Gene,c Changes GENETIC § Muta*ons in p53 Example: Replica,on errors § Ac*va*ng muta*ons in RAS § Muta*ons or amplifica*ons of the X X Altered DNA sequence Altered DNA/mRNA/proteins HER-‐2 gene § Chromosomal transloca*ons in Oncogenesis myeloid cells and the genera*on of the BCR-‐ABL fusion protein Tumor
- 7. Epigene,c Changes are Important in Causing Cancer GENETIC EPIGENETIC Example: Chroma,n modifica,on errors Example: Replica,on errors X X Altered DNA sequence Altered DNA/mRNA/proteins Altered chroma,n structure Oncogenesis Altered levels of mRNA/proteins Tumor
- 8. Example of Methyla,on vs Muta,on: Colon & Breast Cancer 120 100 80 Dx 60 40 CDx 20 0 Methylated Mutated Source: Schuebel et al 2007 76-100 51-75 21-50 1-20
- 9. MGMT Biology O6 Methyl-Guanine Methyl Transferase Essential DNA Repair Enzyme Removes alkyl groups from damaged guanine bases Healthy individual: -‐ MGMT is an essen*al DNA repair enzyme Loss of MGMT ac*vity makes individuals suscep*ble to DNA damage and prone to tumor development Glioblastoma pa,ent on alkylator chemotherapy: -‐ Pa*ents with MGMT promoter methyla*on show have longer PFS and OS with the use of alkyla*ng agents as chemotherapy
- 10. MGMT Promoter Methylation Predicts Benefit form DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation 25 Median Overall Survival 21.7 months 20 15 plus temozolomide 12.7 months radiotherapy 10 radiotherapy 5 0 Non-Methylated MGMT Gene Methylated MGMT Gene Adapted from Hegi et al. NEJM 2005 352(10):1036-‐8. Study with 207 pa*ents
- 11. Clinical Valida,on of MDxHealth assay RTOG 0525 Study § MGMT was measured prospec*vely in the RTOG 0525 study § MGMT used to balance the arms of the study as there is an advantage to overall survival and progression free survival being MGMT methyla*on § Physicans goal in this study was to compare current temozolomide schedule (Arm 1) vs a dose-‐dense administra*on of temozolomide(Arm2). § The dose dense schedule was hypothesized as being able to overcome the unmethylated MGMT tumors by overwhelming the tumor with alkyla*on. § The dose dense schedule did not work.
- 12. Outcomes by MGMT Status-‐ MDxHealth Assay 100 Dead Total 162 244 Methylated Unmethylated 433 516 p (2-sided) =< 0.0001 HR (95% CI) =1.74 (1.45, 2.08) 75 Progression-free Survival (%) Overall Survival (%) 100 50 25 0 0 Patients at Risk Methy 244 Unmethy 516 12 24 36 Months after Randomization 168 104 37 295 106 28 48 6 6 Dead Total 202 244 Methylated Unmethylated 486 516 p (2-sided) =< 0.0001 HR (95% CI) =1.63 (1.38, 1.92) 75 50 25 0 0 Patients at Risk Methy 244 Unmethy 516 12 24 36 Months after Randomization 99 55 19 108 40 14 48 3 4 However the study did show that the MDxHealth assay was able to show the benefit to OS and PFS with the MGMT methylated cohort. Confiden*al ASCO 2011, Mark R. Gilbert, MD 12
- 13. Overview Epigene,cs – Introduc*on – Methyla*on & Oncology – Biomarkers MDxHealth – NEXT-‐GENera*on Epigene*c Biomarkers Can we rediscover MGMT ? What does the epigenome look like ?
- 14. MBD_Seq Condensed Chroma*n DNA Sheared DNA Sheared Immobilized Methyl Binding Domain
- 15. MBD_Seq Immobilized Methyl binding domain MgCl2 Next Gen Sequencing GA Illumina: 100 million reads
- 16. Quality evalua*on of Methyl Binding Domain based kits for enrichment DNA-‐methyla*on sequencing De Meyer et al (2013) Plos One Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
- 17. MBD_Seq MGMT = dual core
- 18. BRCA1, a bidirec,onal promoter 18
- 20. Zooming into Exon 1 20
- 21. Zooming into Exon 1 21
- 22. Zooming into Exon 1 22
- 23. Genome-‐wide methyla,on …. by next genera,on sequencing # markers 1-‐2 million methyla*on cores MBD_Seq Discovery # samples
- 24. Where is the mC ? GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
- 26. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
- 27. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Dense methylated needed for transcrip*onal silencing Are there alleles with all three posi4ons methylated ?
- 28. Deep Sequencing unmethylated alleles methylated alleles less methyla*on more methyla*on GCATCGTGACTTACGACTGATCGATGGATGCTAGCAT!
- 29. Deep Sequencing MGMT Heterogenic complexity
- 30. Data integra,on with DEEP Sequencing, Infinium, Reac,va,on, (direc,onal) Expression …
- 32. 9 10 11 12 13 14 15 16 17 BI T21 (BRCA1 MUT) BI T22 (BRCA1 MUT) BLC BLC BLC BLC BLC BLC BLC
- 33. 13 BLC 14 BLC 15 BLC 16 BLC 17 BLC 18 BLC 19 IVM 20 DKO
- 34. Genome-‐wide methyla,on …. by next genera,on sequencing # markers MBD_Seq Discovery BT_Seq Verifica*on Valida*on # samples
- 35. Gene,c tes,ng Whole-genome Bisulphite seq Probes (450-27K) Enrichment Targeted Panels MSP bp Full genome 109 108 107 106 Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 105 104 103 102 101 1
- 36. Gene,c tes,ng Instrument and Assay providers G E N E T I C Whole-genome sequencing Enrichment seq (Exome) Enrichment Targeted Panels PCR bp Full genome 109 108 107 106 105 104 103 CLIA Lab service providers Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 102 101 1
- 37. Today E P I G E N E T I C Whole-genome Bisulphite seq Enrichment seq (MBD, RRBS) Whole-genome sequencing Probes (450-27K) MSP Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels PCR bp Full genome 109 108 107 106 RUO sequencing Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 105 104 103 102 101 1 Clinical PCR
- 38. New Methods… E P I G E N E T I C Whole-genome Bisulphite seq Enrichment seq (MBD, RRBS) Whole-genome sequencing Probes (450-27K) MSP Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels PCR bp Full genome 109 108 107 106 RUO sequencing Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 105 104 103 102 101 1 Clinical PCR
- 39. Molecular Unifica,on E P I G E N E T I C Whole-genome Bisulphite seq Enrichment seq (MBD, RRBS) Whole-genome sequencing Probes (450-27K) Ultra Deep Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels Deep Seq bp Full genome 109 RUO 108 107 106 105 104 103 Sequencing Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 102 101 1 Clinical
- 40. 80.00% 60.00% 20.00% 0% IV Co p ies 50 55 60 65 Percentage Methylation Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 70 /A 45 ies 40 op 35 6.7 2 4.89 7 3.3 3.34 7 1. 0.9735 0.83 0.61 0.56 0.07 DKO CT B 7 30 75 80 TC 25 85 90 GM 20 95 M 15 100 SP 5 10 M 0 M 2 171 97.32 162 .71 22.1.54 18. 3 15.7 33 14 5 8. .87 Amount 40.00%
- 41. Molecular Unifica,on E P I G E N E T I C Whole-genome Bisulphite seq Enrichment seq (MBD, RRBS) Whole-genome sequencing Probes (450-27K) Ultra Deep Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels Deep Seq bp Full genome 109 RUO 108 107 106 105 104 103 Sequencing Confidential Information | ©2013 MDxHealth Inc. All rights reserved. 102 101 1 Clinical
- 42. Epi-‐health: comprehensive epigene,c profiling § Key genes – For all know epigene*c genes – For all important gene classes (CT genes, immune-‐response)
- 43. 440 cancer-‐related genes genes are known to be epigene*cally altered in human solid cancers based on recent scien*fic and clinical literature. Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
- 44. Heyn, H. H. & Esteller, M. M. DNA methylation profiling in the clinic: applications and challenges. Nat. Rev. Genet. 13, 679–692 (2012). 44
- 45. Epigenetic Alterations Associated with Cancer Therapy Response PCFT – folate transport (MTX) WRN
- 46. Kinases, CT genes …. 46
- 47. Epi-‐health: comprehensive epigene,c profiling § Key genes – For all know epigene*c genes – For all important gene classes (CT genes, immune-‐response) § Key regions – Iden*fied by mining epigenomes
- 48. Data integra,on Correla,on tracks expression expression Corr =-1 Corr = 1 methylation methylation
- 49. Correla,on track in GBM @ MGMT +1 -1
- 50. Epi-‐health: comprehensive epigene,c profiling § Key genes – For all know epigene*c genes – For all important gene classes (CT genes, immune-‐response) § Key regions – Iden*fied by mining epigenomes § Approach – Acceptable amounts of clinical material – TAT/cost § Analysis – Ac*onable interpreta*on – Get gene*c data as a bonus
- 51. Molecular Unifica,on E P I Whole-genome Bisulphite seq G E N E T I C Whole-genome sequencing Enrichment seq (MBD, RRBS) Probes (450-27K) Ultra Deep Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels Deep Seq bp Full genome 109 108 RUO 107 106 105 104 103 Sequencing 102 101 1 Clinical