L’altération du flux de glucose dans les
chondrocytes humains arthrosiques par le
Alan Baho, Centre de re...
• Matériels et Méthodes:
 Culture cellulaire: chondrocytes OA
 Flux de glucose: incorporation de
I. L’arthrose(OA)
• Une maladie dégénérative de
•destruction graduel du cartilage articulaire.
II. HNE: 4-hydroxynonénal
•HNE: produit final de la peroxydation de lipides.
•Résulte de la peroxydation non ...
III. L’importance de glucose
•Les chondrocytes: cellules hautement glycolytiques.
•Le glucose:
I. Source d’én...
IV. L’hypothèse
Le HNE perturbe le flux de glucose
dans les chondrocytes OA en
influencant la régulation des GLUT-1
et -9 ...
• Culture cellulaire et sélection de spécimens:
•Les spécimens de cartilage :patients atteints d’OA.
•Isolation de chondro...
•Transcription inverse et PCR temps réel :
1. Isolation de l’ARN total: TRIzol®
2. Dosage de l’ARN: RiboGreen RNA quantita...
Résultats et Discussion
I. l’effet de 10 µM de HNE en fonction du temps d’incubation sur
l’influx du [3H] 2-DG dans les ch...
Résultats et Discussion
II. L’effet de 10µM de HNE en fonction du temps d’incubation sur
l’expression A) d’ARNm et B) prot...
Résultats et Discussion
III. L’effet de 10 µM de HNE en fonction du temps d’incubation sur l’expression
A) d’ARNm et B) pr...
Résultats et Discussion
L’effet de 10 µM de HNE en fonction du temps d’incubation sur l’expression
protéique et d’ARNm de ...
•Une forte diminution de flux de glucose en présence du
HNE dans les chondrocytes OA peut être expliquée :
La d...
•Dr. Mouhamed benderdour et son équipe : Sherry Chen et France Vaillancourt.
•La société d’Arthrite qui a fi...
•Wieland, H. A., M. Michaelis, et al. (2005). Osteoarthritis [mdash] an untreatable disease? Nat
Rev Drug Disco...
Prochain SlideShare
Chargement dans…5


61 vues

Publié le

0 commentaire
0 j’aime
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Nombre de vues
Sur SlideShare
Issues des intégrations
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive


  1. 1. L’altération du flux de glucose dans les chondrocytes humains arthrosiques par le 4-hydroxynonénal Alan Baho, Centre de recherches de l’hôpital du Sacré-Cœur de Montréal (Université de Montréal). Sous la direction de: Dr.Mohamed Benderdour 09/09/2008
  2. 2. Plan • Matériels et Méthodes:  Culture cellulaire: chondrocytes OA  Flux de glucose: incorporation de [3H]2-déoxyglucose  Techniques :Western blot et RT-PCR temps réel •Résultats et Discussion •Conclusion •Remerciements et Références • Introduction: I. L’arthrose (OA). II. 4-hydroxynonénal (HNE). III. l’importance de glucose et son transporteur. IV. Hypothèse 09/09/2008 2
  3. 3. I. L’arthrose(OA) • Une maladie dégénérative de l’articulation: •destruction graduel du cartilage articulaire. •Inflammation : sécretion de cytokines (IL-1 β et TNF-α). • Le stress oxydatif : •ROS. •Peroxydation de lipides. • 65% de la population de plus de 60 ans souffre de l'arthrose. 09/09/2008source: Nat Rev Drug Discov. 4: 331-344. 3
  4. 4. II. HNE: 4-hydroxynonénal 09/09/2008 4 •HNE: produit final de la peroxydation de lipides. •Résulte de la peroxydation non enzymatique des acides gras ω-6-polyinsaturés. •↑[HNE] dans les tissus articulaire OA. •un aldéhyde hautement réactif.
  5. 5. 09/09/2008 5 III. L’importance de glucose •Les chondrocytes: cellules hautement glycolytiques. •Le glucose: I. Source d’énergie essentielle. II. précurseur de protéoglycanes. •Les transporteurs de glucose (GLUTs): L’étape limitant du métabolisme du glucose. Riches en cystéine. 3 types exprimés chez les chondrocytes: GLUT-1,-3 et-9. Nat Rev Mol Cell Biol. 3: 267-277 •Les GLUTs et l’OA.
  6. 6. IV. L’hypothèse Le HNE perturbe le flux de glucose dans les chondrocytes OA en influencant la régulation des GLUT-1 et -9 aux niveaux d’expression d’ARNm et protéique. 09/09/2008 6
  7. 7. • Culture cellulaire et sélection de spécimens: •Les spécimens de cartilage :patients atteints d’OA. •Isolation de chondrocytes: digestion enzymatique séquentielle •Stimulation :10 μM de HNE en fonction de temps • n=8, (64 ± 8 ans) • L’incorporation du [3H]2-déoxyglucose (2DG): • La radioactivité mesurée dans l’extrait cellulaire des chondrocytes • Lecture de radioactivité par le compteur de β. • Normalisation par rapport à la concentration des protéines totales. Matériels et Méthodes 09/09/2008 7 • Immunobuvardage de type western : • gel d’agarose de 4-12% (SDS-PAGE) • Transfert sur une membrane de nitrocellulose. •Premier anticorps: IgG anti- GLUT-1et -9 human de lapin.
  8. 8. •Transcription inverse et PCR temps réel : 1. Isolation de l’ARN total: TRIzol® 2. Dosage de l’ARN: RiboGreen RNA quantitation kit . 3. Transcription inverse et PCR temps réel : en utilisant des trousses commerciales Amorce Longueur de la séquence Sens 5’-3’ Anti-Sens 5’-3’ GAPDH 104 GCCTCAAGATCATCAGCAATGCCT TGTGGTCATGAGTCCTTCCACGAT GLUT-1 134 ATCCTCATTG CCGTGGTGCT ACGATGCCAGAGCCGATGGT GLUT-9 229 ACTGAGACCCATGGCAAGGAA GAGTGTCTGGGTCTATTGGA Matériels et Méthodes 09/09/2008 8
  9. 9. Résultats et Discussion I. l’effet de 10 µM de HNE en fonction du temps d’incubation sur l’influx du [3H] 2-DG dans les chondrocytes OA : C 2h 4h 8h 16h 0 10 20 30 40 50 60 70 80 90 100 110 *** *** *** Temps d'incubation (h) %del'influxde[3 H]2-DG • Diminution progressive et significative pour atteindre un niveau de 7% par rapport au contrôle à 16h.(n=3) 09/09/2008 9
  10. 10. Résultats et Discussion II. L’effet de 10µM de HNE en fonction du temps d’incubation sur l’expression A) d’ARNm et B) protéique de la GLUT-1 dans les chondrocytes OA : 0 2 4 8 16 24 0 10 20 30 40 50 60 70 80 90 100 110 B GLUT-1 -Actine 0 2 4 8 16 24 Temps d'incubation (h) GLUT1 (%ducontrôle)0 2 4 8 16 24h 0 10 20 30 40 50 60 70 80 90 100 110 *** *** *** *** A Temps d'incubation (h) GLUT1 (%ducontrôle) 09/09/2008 10
  11. 11. Résultats et Discussion III. L’effet de 10 µM de HNE en fonction du temps d’incubation sur l’expression A) d’ARNm et B) protéique de la GLUT-9 dans les chondrocytes OA : 0 2 4 8 16 24 0 10 20 30 40 50 60 70 80 90 100 110 120 * *** ** ** B 0 2 4 8 16 24 GLUT9 -Actine Temps d'incubation (h) GLUT9 (%ducontrôle) 0 2 4 8 16 24 0 10 20 30 40 50 60 70 80 90 100 110 ** ***** *** *** A Temps d'incubation (h) GLUT9 (%ducontrôle) 09/09/2008 11
  12. 12. Résultats et Discussion L’effet de 10 µM de HNE en fonction du temps d’incubation sur l’expression protéique et d’ARNm de la GLUT-1 et 9 dans les chondrocytes OA : • Diminution important de l’expression d’ARNm : 1. Diminution de la stabilité des ARNm des GLUTs 2. L’inactivation de certaine voie de signalisation de GLUT-1 et -9. 09/09/2008 12 Diminution de l’expression protéique.
  13. 13. Conclusion •Une forte diminution de flux de glucose en présence du HNE dans les chondrocytes OA peut être expliquée : La diminution d’expression protéique et d’ARNm de GLUT-1 et -9. Donc, le HNE possède la capacité d’altérer le métabolisme des chondrocytes OA 09/09/2008 13
  14. 14. Remerciements •Dr. Mouhamed benderdour et son équipe : Sherry Chen et France Vaillancourt. •La société d’Arthrite qui a financé ce projet. 09/09/2008 14
  15. 15. Références •Wieland, H. A., M. Michaelis, et al. (2005). Osteoarthritis [mdash] an untreatable disease? Nat Rev Drug Discov. 4: 331-344. •Poole AR, Kojima T, Yasuda T, et al. (2001). Composition and structure of articular cartilage. A template for tissue repair. Clin Ortho-paed Rel Res 39S:S26–S33. •Poli, G., R. J. Schaur, et al. (2008). 4-Hydroxynonenal: A membrane lipid oxidation product of medicinal interest. Medicinal Research Reviews. 28: 569-631. •Mobasheri, A., S. J. Vannucci, et al. (2002). "Glucose transport and metabolism in chondrocytes: a key to understanding chondrogenesis, skeletal development and cartilage degradation in osteoarthritis." Histology and histopathology 17(4): 1239-67. •Bryant, N. J., R. Govers, et al. (2002). Regulated transport of the glucose transporter GLUT4. Nat Rev Mol Cell Biol. 3: 267-277. 09/09/2008 15
  16. 16. Question? 09/09/2008 16
