1. … The plague is on the walls of the house
with ingrained streaks, greenish or
reddish … and the dust that they scrape
off they shall pour out in an unclean place
outside the city.
Leviticus 14

2. microbial culturing
(conventional & d2e)
field biology DNA detection
(in a house) (pyrosequencing)
comprehensive DNA
barcode databases

11. Penicillium italicum
Kent Loeffler / Kathie Hodge
Cornell Mushroom Blog

12. Stachybotrys

14. Classical indoor moulds in the Eumycota
Common mycobiota: 100-200 species
Eurotiomycetes
• Penicillium and Aspergillus
Dothideomycetes
• Alternaria
• Cladosporium
Sordariomycetes
• Fusarium
• Stachybotrys
Wallemiomycetes
• Wallemia

15. Wallemia sebi

16. IM-BOL Global house dust survey
• What is the indoor fungal diversity on a world scale?
• What is the correlation in the profile of species detected by
different methods?
• Are we talking about unculturable or uncultured organisms?
• What is the biological significance of the species detected?

17. Next generation DNA sequencing
• Millions of sequences directly from a sample
– Culture independent
• In fungi, usually ITS +/- 28S
• Many platforms
and technologies
– 454 pyrosequencing
– Illumina sequencing
– Ion Torrent
18S 5.8S
5.8S
8 25-
25-28S
IGS ITS1
S
ITS1 ITS2
ITS2
S IGS

18. Global dust survey: Pyrosequencing results
ITS (1 and 2) LSU
• 7,032 OTUs
Sequence Length 397 bp 445 bp • 56% represented once
Mean
Total Reads 288,361 282,883
(204,000) (183,000)
Amend et al., 2010. Proc. Nat. Acad. Sci. 107, 13748-13753.

19. Hoekstra et al. 1994. In Health implications of fungi in
indoor environments. ed. Samson et al. pp. 169-177.

20. Wallemiomycetes
Sordariomycetes
Leotiomycetes
Dothideomycetes Eurotiomycetes Tremellomycetes
Classical isolation study - Netherlands
454 pyrosequencing study – Northern hemisphere
dy Nort
y
?
Data reformatted from:
Hoekstra et al. 1994. In Health implications of fungi in
indoor environments. ed. Samson et al. pp. 169-177.
Amend et al., 2010. Proc. Nat. Acad. Sci. 107, 13748-
13753.

21. 454 sequences … Cladosporium
Alignment minus 170 bases
Reference alignment from TreeBase: Schubert et al. 2009. Persoonia,
22: 111-122.
Full alignment

22. 454 sequences… Alternaria
Reference alignment from: Pryor, B. M., and Gilbertson, R. L.
2000. Mycological Research 104: 1312-1321.

23. 454 sequences … Epicoccum
In house ITS data plus GenBank data

24. … a problem with unidentified sequences
FX2FH6V03C9FN4 – ID = Dikarya
ATCCCTACCTGATCCGAGGTCAACCGTAGAAATGGGGGTTTCTGGAGGCGGGCGGCGCCGAACCTGGAAAGCTGGAGAATTTAC
TACGCTTGAGGTTCAACACCACCGCCGAGGCCTTTAGGGAGCGTCCGCGACAGGGACGGCACCCAATACCAAGCAGGGCTTGAA
GGTTGATAATGACGCTCGAACAGGCATGCTCCCCGGAATACCAGGGAGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATT
CTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAG

25. Dilution to Extinction (d2e)

30. ‘High throughput’ isolation from global dust samples

31. Cryptocoryneum rilstonei

32. Triadelphia uniseptata

33. Bartheletia paradoxa

35. Keith’s house. Pyro-fungi.
LCA analysis
600 unique DNA sequences
53 unassigned to taxonomic order (<10%)

36. Keith’s house. Pyro-fungi.

37. Fusarium sambucinum dry rot of potato
(teleomorph: Gibberella pulicaris)

38. Fusarium oxysporum wilt of basil

39. Keith’s house. Pyro-fungi.

41. Friday Afternoon Mycologist / Kathie Hodge / Kent Loeffler
Cornell Mushroom Blog

49. Keith’s house. Pyro-fungi.
Conifer endophytes
600 unique sequences
53 unassigned to taxonomic order (<10%)

50. www.cbs.knaw.nl/indoor
• now includes classical isolations only
• d2e isolations to be added
• to be linked with MoBEDAC

51. IM-Bol conclusions
• Vast increase in indoor fungal species diversity on the
global scale
• Enhanced importance of the class Dothideomycetes
– especially Epicoccum, Phoma and Alternaria
• Confirmed importance of the class Eurotiomycetes
– especially Penicillium and Aspergillus
• Confirmed significance of the genus Wallemia
– undoubtedly several species rather than one

52. Concluding thoughts
• Identifications in environmental DNA studies
– Very sensitive to data gaps and taxonomic imprecision
– Especially Last Common Ancestor analysis
– Results can vary day by day!
• Dilution to extinction
– Very labour intensive
– Isolates common as well as rare, unusual fungi
– Including species not detected by pyrosequencing
• Determining biological significance requires multifaceted
approach
– Living growing moulds vs transients or dead cells
– Are all fungi really detected by 454 sequencing?

54. microbial culturing
(conventional & d2e)
field biology DNA detection
(in a house) (pyrosequencing)
comprehensive DNA
barcode databases

55. pyrosequencing
direct observation
culturing

56. pyrosequencing
direct observation
alternative culturing culturing

60. Thanks to
IM-BOL:
The Indoor Alfred P. Sloan Foundation of Life
Mycota Barcode
Real moulds and virtual moulds in your house
Genome Canada, NSERC, Canadian Network for DNA
Barcoding, Consortium for the Barcode of Life
Keith A. Seifert, Joey Tanney, Kalima Mwange, Hai Nguyen, Ed Whitfield
Biodiversity, Agriculture & Agri-Food Canada, Ottawa, Canada
ECORC colleagues: Tom Graefenhan, Wen Chen, Chris Lewis,
Robert A. Samson, Martin Meijer, Vincent Robert
André Lévesque
CBS Fungal Biodiversity Centre, Utrecht, the Netherlands
Thomas D. Bruns, Anthony Amend
Plant & Microbial Biology, University of California at Berkeley, USA
Keith Seifert keith.seifert@agr.gc.ca