SlideShare a Scribd company logo
1 of 40
Download to read offline
Gene network inference




Alberto de la Fuente
    alf@crs4.it
CRS4 Bioinformatica
“Systems Genetics”
                                 (ALF lab)

              Andrea Pinna



             Nicola Soranzo



             Vincenzo de Leo



 GENOTYPE
     +                          PHENOTYPE
ENVIROMENT
ALF lab activities


• Gene network inference



• Systems Genetics simulator



• Differential networking in disease
Overview of the
                                    presentation

• Introduction to Gene networks

• Gene network inference

• Differential networking in disease
Overview of the
                                   presentation

• Introduction to Gene networks

• Gene network inference

• Differential networking in disease
Molecular genetics 101
GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAG
ATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTT
AGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATT
AAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAA
TATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAA
GAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATA
AACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCT
TACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGA
GAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAA
AGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCA
TTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGT
CTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCAT
AAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAAT
GGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTAT
ACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAG
TGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAA
AACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAAT
GAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACA
GAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGG
CAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAA
ATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGA
GAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATAC
AGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATT
GAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAG
CAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCA
CTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAG
GCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGG
GCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGC
What are Gene networks?
ACTIVATOR 1   ACTIVATOR 2   REPRESSOR 1


       A1           A2          R1




                    T1



                TARGET 1
What are Gene networks?

                           Metabolic space

            Metabolite 1                 Metabolite 2




                        Protein space
            Protein 2

                  Complex 3:4
                                   Protein 4

Protein 1                   Protein 3




              Gene 2

                                Gene 3
Gene 1
               Gene space                      Gene 4
What are Gene networks?

                                    1      0    01  0
                                                  
                                    1      1    00  0
                                A = 0      1    10  0
X1        X2        X3                            
                                    0      0    10  1
                                    0      1 0 0 1
                                                  

     X5        X4
                                 a11 0         0         0   a15 
                                                                 
                                 a21 a22       0         0    0 
                           AW =  0 a32         a33    0       0 
                                                                 
                                 0    0        a43   a44      0 
                                                                 
                                 0 a52          0     0      a55 
Gene expression data




Matrix representation
of data:
          X p×n
 (p = #genes, n = #observations)
Overview of the
                                    presentation

• Introduction to Gene networks


• Gene network inference

• Differential networking in disease
Inferring Gene Networks
                                                = inverse problem
                                           = system identification
“~omics” data




                    algorithms


                                                          = f (x, k )
                  Correlation, partial                 dx
                correlation, regression,               dt
                    linear Ordinary
                Differential Equations,
                  graphical Gaussian
                 models, perturbation
                       analysis…
Where are the non-zeros?

                                    1      0    01  0
                                                  
                                    1      1    00  0
                                A = 0      1    10  0
X1        X2        X3                            
                                    0      0    10  1
                                    0      1 0 0 1
                                                  

     X5        X4
                                 a11 0         0         0   a15 
                                                                 
                                 a21 a22       0         0    0 
                           AW =  0 a32         a33    0       0 
                                                                 
                                 0    0        a43   a44      0 
                                                                 
                                 0 a52          0     0      a55 
Experimental strategies

‘Observational data’
  Repeated measurements of a given tissue/cell type
    without experimental intervention
     ALLOWS ONLY FOR INFERRING UNDIRECTED NETWORKS


‘Perturbation data’
  Creating targeted perturbations and measuring
    systems dynamic responses (steady states or
    time-series)
     ALLOWS FOR INFERRING DIRECTED NETWORKS
Observational data




                                                Gene C activity level
Gene B activity level




                        Gene A activity level                               Gene A activity level
Correlation ≠ Causation




    A       B
                                   C
A       B       A       B      A       B
Perturbation data


     Wild type
Over-expression Gene 1
Over-expression Gene 2
Over-expression Gene 3

Over-expression Gene n




                 Stress
Perturbation analysis
Perturbation analysis
Measure gene-expression in unperturbed (WT) state
Perturb each gene and measure gene-expression responses


                                               Perturb X2


                   Perturb X1
                   (over-express,
                   knock-down)




                                                            All perturbed
Perturbation analysis
Distinguish direct from indirect edges:
   Algebraic relation between the deviation matrix X (perturbed levels –
      wild type levels) and the network matrix (encoding the network A of
      direct interactions)




                                                                         −1
      a11 0      0    0     a15   ∆x11   0      0      0     ∆x15 
                                                                  
      a21 a22    0    0      0   ∆x21 ∆x22      0      0     ∆x25 
      0 a       a33   0      0  =  ∆x31 ∆x32   ∆x33    0     ∆x35 
           32
                                                                   
      0    0    a43   a44   a54   ∆x41 ∆x42    ∆x43   ∆x44   ∆x45 
      0    0     0     0    a55   0      0      0      0     ∆x55 
                                                                  
Linear modeling approach

                   d∆xi   n
                        = ∑ aij ∆x j + ∆u i
                    dt    j


        n                                n
   0 = ∑ aij ∆x j + ∆ui                 ∑ a ∆xij   j   = − ∆ui
        j                                j

                          JX = −U

 J = {aij } Effect of gene j on rate of change of gene i
 U = {u kk } Diagonal perturbation matrix
X = {xik } Change in gene i expression after perturbation k


              J = − UX −1
             R = U −1 J = − X −1
Further reading




                                                        Trends Genet. 2002 Aug;18(8):395-8




Scheinine, A., Mentzen, W., Pieroni E., Fotia, G., Maggio, F., Mancosu, G. and de la
Fuente, A. (2009) Inferring Gene Networks: Dream or nightmare? Part 2: Challenges 4
and 5. Annals of the New York Academy of Sciences 1158: 287301
Perturbation analysis
Perturbation analysis

Weight estimation for edge i→j: change in the
mRNA level xi,j of gene j after knockout of gene i
Z-score:

                    xi , j = x⋅, j
         Wi , j =
                        s⋅, j
Transitive reduction

The edge weight measures the total causal effect of
a gene on another gene: direct or mediated?
                     G1      G2    G3


                              X
The initial network can have many feed-forward
loops
  Not essential for reachability
  We want to remain with only “essential” edges
Further reading




Pinna, A., Soranzo, N. and de la Fuente, A. (2010) From Knockouts to Networks:
Establishing Direct Cause-Effect Relationships through Graph Analysis, PLoS ONE 5(10),
e12912 (DREAM4 Special Collection)
Figure 7 from: GeneNetWeaver: In silico benchmark generation and performance profiling of
network inference methods. Schaffter T, Marbach D, Floreano D. Bioinformatics (2011) 27 (16):
2263-2270.
Overview of the
                                    presentation

• Introduction to Gene networks

• Gene network inference


• Differential networking in disease
Disease studies




                           ?
Group 1 (healthy tissue,        Group 2 (tumor tissue,
treated with medicine,         not treated with medicine,
  tumor stage X, etc.)            tumor stage Y, etc.)
‘Differential expression’


 ?
‘Differential networking’


                        = f (x, k)
                 s   dx
        ri   thm     dt
    o
alg




                      ?
 algorit
        hms
                           = f (x, k)
                        dx
                        dt
‘Differential networking’
Differential co-expression



Healthy




 Sick




                                     (                 )
                              p     p
                     1
                           × ∑ ∑ rijhealty − rijsick
                                                       2
          D=
               p ( p − 1) 2 i =1 j =i +1
GenExpReg database

                          NCBI RefSeq
                        (32735 mRNAs)


  NCBI Gene                                          mirBase 18
(43448 genes)                                   (1921 mature miRNAs)

                        GenExpReg



 FANTOM4 EdgeExpressDB                 TargetScanHuman 6.1
       + Transmir 1.2               (669760 miRNA regulations)
   (46602 TF regulations)
In silico evaluation
Lung cancer miRNAs?
     Bhattacharjee,A. et al. (2001) Classification of human lung carcinomas by
     mRNA expression profiling reveals distinct adenocarcinoma subclasses. Proc.
     Natl Acad. Sci., 98, 13790-13795.
Family name        Seed    N. of target genestarget P-value for Notes on LungCancer3, 10000 permutations
                                        N. of in TargetScan with at least one conserved site
                                                    genes also GSCA
                                                                in LungCancer3 dataset
miR-1293           GGGUGGU           73          23     0.0022
miR-28/28-3p       ACUAGAU           77          19     0.0024 upregulated in serum copy number of lung cancer patients w.r.t. healthy [1]
miR-1244           AGUAGUU          147          53     0.0027
miR-1269           UGGACUG           77          21     0.0048
miR-1224/1224-5p   UGAGGAC           88          34     0.0050
miR-578            UUCUUGU          229          65     0.0052
miR-1305           UUUCAAC          414        106      0.0060
miR-433            UCAUGAU          207          63     0.0061
                                                                highly specific marker for squamous cell lung carcinoma [2] and non-small cell
                                                                lung cancer [3]; located in a region amplified in lung cancer; upregulated in
miR-205            CCUUCAU          288          92     0.0063 lung cancer tissues w.r.t. noncancerous lung tissues [4]
miR-1237           CCUUCUG          177          42     0.0082
miR-520a-5p/525-5p UCCAGAG          296          79     0.0085
miR-582-3p         AACUGGU           97          46     0.0086
miR-568            UGUAUAA          308          85     0.0087
miR-432            CUUGGAG          133          37     0.0090 member of miR-127 cluster, which is downregulated in tumors [5]
miR-524-3p/525-3p AAGGCGC            38          10     0.0091
miR-513c           UCUCAAG          223          64     0.0094
miR-370            CCUGCUG          239          52     0.0096 downregulated after lung development [6]

[1] Chen, X., et al. - Cell Res. 18(10) pp. 997–1006 – 2008
[2] Lebanony, D., et al. - J. Clinical Oncology 27(12) – pp. 2030-2037 – 2009
[3] Markou, A., et al. – Clin. Chem. 54(10) – pp. 1696-1704 – 2008
[4] Yanaihara, N., et al. - Cancer Cell 9(3) – pp. 189-198 – 2006
[5] Saito, Y., et al. - Cancer Cell 9(6) – pp. 435-443 – 2006
[6] Williams, A. E., et al. - Dev. Dyn. 236(2) – pp. 572-580 – 2007
IMPROVER
IMPROVER
Thank you for your
        attention

More Related Content

Similar to Gene network inference

Copy of 7.digital basicsa
Copy of 7.digital basicsaCopy of 7.digital basicsa
Copy of 7.digital basicsa
Chethan Nt
 
Faster, More Effective Flowgraph-based Malware Classification
Faster, More Effective Flowgraph-based Malware ClassificationFaster, More Effective Flowgraph-based Malware Classification
Faster, More Effective Flowgraph-based Malware Classification
Silvio Cesare
 
Correlation of dts by er. sanyam s. saini me (reg) 2012-14
Correlation of dts by  er. sanyam s. saini  me  (reg) 2012-14Correlation of dts by  er. sanyam s. saini  me  (reg) 2012-14
Correlation of dts by er. sanyam s. saini me (reg) 2012-14
Sanyam Singh
 
Gene Extrapolation Models for Toxicogenomic Data
Gene Extrapolation Models for Toxicogenomic DataGene Extrapolation Models for Toxicogenomic Data
Gene Extrapolation Models for Toxicogenomic Data
Nacho Caballero
 

Similar to Gene network inference (18)

T tests anovas and regression
T tests anovas and regressionT tests anovas and regression
T tests anovas and regression
 
Models
ModelsModels
Models
 
Discrete and Continuous Random Variables
Discrete and Continuous Random VariablesDiscrete and Continuous Random Variables
Discrete and Continuous Random Variables
 
Lect аі 2 n net p2
Lect аі 2 n net p2Lect аі 2 n net p2
Lect аі 2 n net p2
 
U1.4-RVDistributions.ppt
U1.4-RVDistributions.pptU1.4-RVDistributions.ppt
U1.4-RVDistributions.ppt
 
Stephen Friend Norwegian Academy of Science and Letters 2011-11-02
Stephen Friend Norwegian Academy of Science and Letters 2011-11-02Stephen Friend Norwegian Academy of Science and Letters 2011-11-02
Stephen Friend Norwegian Academy of Science and Letters 2011-11-02
 
Session 2
Session 2Session 2
Session 2
 
Multi-Party Computation for the Masses
Multi-Party Computation for the MassesMulti-Party Computation for the Masses
Multi-Party Computation for the Masses
 
Copy of 7.digital basicsa
Copy of 7.digital basicsaCopy of 7.digital basicsa
Copy of 7.digital basicsa
 
Causally regularized machine learning
Causally regularized machine learningCausally regularized machine learning
Causally regularized machine learning
 
Faster, More Effective Flowgraph-based Malware Classification
Faster, More Effective Flowgraph-based Malware ClassificationFaster, More Effective Flowgraph-based Malware Classification
Faster, More Effective Flowgraph-based Malware Classification
 
Correlation of dts by er. sanyam s. saini me (reg) 2012-14
Correlation of dts by  er. sanyam s. saini  me  (reg) 2012-14Correlation of dts by  er. sanyam s. saini  me  (reg) 2012-14
Correlation of dts by er. sanyam s. saini me (reg) 2012-14
 
Gene Extrapolation Models for Toxicogenomic Data
Gene Extrapolation Models for Toxicogenomic DataGene Extrapolation Models for Toxicogenomic Data
Gene Extrapolation Models for Toxicogenomic Data
 
Multi Level Modelling&Weights Workshop Kiel09
Multi Level Modelling&Weights Workshop Kiel09Multi Level Modelling&Weights Workshop Kiel09
Multi Level Modelling&Weights Workshop Kiel09
 
Soft computing
Soft computingSoft computing
Soft computing
 
Neural network & its applications
Neural network & its applications Neural network & its applications
Neural network & its applications
 
Symmetrical2
Symmetrical2Symmetrical2
Symmetrical2
 
Simple Matrix Factorization for Recommendation in Mahout
Simple Matrix Factorization for Recommendation in MahoutSimple Matrix Factorization for Recommendation in Mahout
Simple Matrix Factorization for Recommendation in Mahout
 

More from CRS4 Research Center in Sardinia

More from CRS4 Research Center in Sardinia (20)

The future is close
The future is closeThe future is close
The future is close
 
The future is close
The future is closeThe future is close
The future is close
 
Presentazione Linea B2 progetto Tutti a Iscol@ 2017
Presentazione Linea B2 progetto Tutti a Iscol@ 2017Presentazione Linea B2 progetto Tutti a Iscol@ 2017
Presentazione Linea B2 progetto Tutti a Iscol@ 2017
 
Iscola linea B 2016
Iscola linea B 2016Iscola linea B 2016
Iscola linea B 2016
 
Sequenziamento Esomico. Maria Valentini (CRS4), Cagliari, 18 Novembre 2015
Sequenziamento Esomico. Maria Valentini (CRS4), Cagliari, 18 Novembre 2015Sequenziamento Esomico. Maria Valentini (CRS4), Cagliari, 18 Novembre 2015
Sequenziamento Esomico. Maria Valentini (CRS4), Cagliari, 18 Novembre 2015
 
Near Surface Geoscience Conference 2015, Turin - A Spatial Velocity Analysis ...
Near Surface Geoscience Conference 2015, Turin - A Spatial Velocity Analysis ...Near Surface Geoscience Conference 2015, Turin - A Spatial Velocity Analysis ...
Near Surface Geoscience Conference 2015, Turin - A Spatial Velocity Analysis ...
 
GIS partecipativo. Laura Muscas e Valentina Spanu (CRS4), Cagliari, 21 Ottobr...
GIS partecipativo. Laura Muscas e Valentina Spanu (CRS4), Cagliari, 21 Ottobr...GIS partecipativo. Laura Muscas e Valentina Spanu (CRS4), Cagliari, 21 Ottobr...
GIS partecipativo. Laura Muscas e Valentina Spanu (CRS4), Cagliari, 21 Ottobr...
 
Alfonso Damiano (Università di Cagliari) ICT per Smart Grid
Alfonso Damiano (Università di Cagliari) ICT per Smart Grid Alfonso Damiano (Università di Cagliari) ICT per Smart Grid
Alfonso Damiano (Università di Cagliari) ICT per Smart Grid
 
Big Data Infrastructures - Hadoop ecosystem, M. E. Piras
Big Data Infrastructures - Hadoop ecosystem, M. E. PirasBig Data Infrastructures - Hadoop ecosystem, M. E. Piras
Big Data Infrastructures - Hadoop ecosystem, M. E. Piras
 
Big Data Analytics, Giovanni Delussu e Marco Enrico Piras
 Big Data Analytics, Giovanni Delussu e Marco Enrico Piras  Big Data Analytics, Giovanni Delussu e Marco Enrico Piras
Big Data Analytics, Giovanni Delussu e Marco Enrico Piras
 
Dinamica Molecolare e Modellistica dell'interazione di lipidi col recettore P...
Dinamica Molecolare e Modellistica dell'interazione di lipidi col recettore P...Dinamica Molecolare e Modellistica dell'interazione di lipidi col recettore P...
Dinamica Molecolare e Modellistica dell'interazione di lipidi col recettore P...
 
Innovazione e infrastrutture cloud per lo sviluppo di applicativi web e mobil...
Innovazione e infrastrutture cloud per lo sviluppo di applicativi web e mobil...Innovazione e infrastrutture cloud per lo sviluppo di applicativi web e mobil...
Innovazione e infrastrutture cloud per lo sviluppo di applicativi web e mobil...
 
ORDBMS e NoSQL nel trattamento dei dati geografici parte seconda. 30 Sett. 2015
ORDBMS e NoSQL nel trattamento dei dati geografici parte seconda. 30 Sett. 2015ORDBMS e NoSQL nel trattamento dei dati geografici parte seconda. 30 Sett. 2015
ORDBMS e NoSQL nel trattamento dei dati geografici parte seconda. 30 Sett. 2015
 
Sistemi No-Sql e Object-Relational nella gestione dei dati geografici 30 Sett...
Sistemi No-Sql e Object-Relational nella gestione dei dati geografici 30 Sett...Sistemi No-Sql e Object-Relational nella gestione dei dati geografici 30 Sett...
Sistemi No-Sql e Object-Relational nella gestione dei dati geografici 30 Sett...
 
Elementi di sismica a riflessione e Georadar (Gian Piero Deidda, UNICA)
Elementi di sismica a riflessione e Georadar (Gian Piero Deidda, UNICA)Elementi di sismica a riflessione e Georadar (Gian Piero Deidda, UNICA)
Elementi di sismica a riflessione e Georadar (Gian Piero Deidda, UNICA)
 
Near Surface Geoscience Conference 2014, Athens - Real-­time or full­‐precisi...
Near Surface Geoscience Conference 2014, Athens - Real-­time or full­‐precisi...Near Surface Geoscience Conference 2014, Athens - Real-­time or full­‐precisi...
Near Surface Geoscience Conference 2014, Athens - Real-­time or full­‐precisi...
 
SmartGeo/Eiagrid portal (Guido Satta, CRS4)
SmartGeo/Eiagrid portal (Guido Satta, CRS4)SmartGeo/Eiagrid portal (Guido Satta, CRS4)
SmartGeo/Eiagrid portal (Guido Satta, CRS4)
 
Luigi Atzori Metabolomica: Introduzione e review di alcune applicazioni in am...
Luigi Atzori Metabolomica: Introduzione e review di alcune applicazioni in am...Luigi Atzori Metabolomica: Introduzione e review di alcune applicazioni in am...
Luigi Atzori Metabolomica: Introduzione e review di alcune applicazioni in am...
 
Mobile Graphics (part2)
Mobile Graphics (part2)Mobile Graphics (part2)
Mobile Graphics (part2)
 
Mobile Graphics (part1)
Mobile Graphics (part1)Mobile Graphics (part1)
Mobile Graphics (part1)
 

Recently uploaded

Structuring Teams and Portfolios for Success
Structuring Teams and Portfolios for SuccessStructuring Teams and Portfolios for Success
Structuring Teams and Portfolios for Success
UXDXConf
 

Recently uploaded (20)

TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...
TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...
TEST BANK For, Information Technology Project Management 9th Edition Kathy Sc...
 
The Metaverse: Are We There Yet?
The  Metaverse:    Are   We  There  Yet?The  Metaverse:    Are   We  There  Yet?
The Metaverse: Are We There Yet?
 
Syngulon - Selection technology May 2024.pdf
Syngulon - Selection technology May 2024.pdfSyngulon - Selection technology May 2024.pdf
Syngulon - Selection technology May 2024.pdf
 
FDO for Camera, Sensor and Networking Device – Commercial Solutions from VinC...
FDO for Camera, Sensor and Networking Device – Commercial Solutions from VinC...FDO for Camera, Sensor and Networking Device – Commercial Solutions from VinC...
FDO for Camera, Sensor and Networking Device – Commercial Solutions from VinC...
 
Connecting the Dots in Product Design at KAYAK
Connecting the Dots in Product Design at KAYAKConnecting the Dots in Product Design at KAYAK
Connecting the Dots in Product Design at KAYAK
 
Structuring Teams and Portfolios for Success
Structuring Teams and Portfolios for SuccessStructuring Teams and Portfolios for Success
Structuring Teams and Portfolios for Success
 
Powerful Start- the Key to Project Success, Barbara Laskowska
Powerful Start- the Key to Project Success, Barbara LaskowskaPowerful Start- the Key to Project Success, Barbara Laskowska
Powerful Start- the Key to Project Success, Barbara Laskowska
 
A Business-Centric Approach to Design System Strategy
A Business-Centric Approach to Design System StrategyA Business-Centric Approach to Design System Strategy
A Business-Centric Approach to Design System Strategy
 
The Value of Certifying Products for FDO _ Paul at FIDO Alliance.pdf
The Value of Certifying Products for FDO _ Paul at FIDO Alliance.pdfThe Value of Certifying Products for FDO _ Paul at FIDO Alliance.pdf
The Value of Certifying Products for FDO _ Paul at FIDO Alliance.pdf
 
THE BEST IPTV in GERMANY for 2024: IPTVreel
THE BEST IPTV in  GERMANY for 2024: IPTVreelTHE BEST IPTV in  GERMANY for 2024: IPTVreel
THE BEST IPTV in GERMANY for 2024: IPTVreel
 
WSO2CONMay2024OpenSourceConferenceDebrief.pptx
WSO2CONMay2024OpenSourceConferenceDebrief.pptxWSO2CONMay2024OpenSourceConferenceDebrief.pptx
WSO2CONMay2024OpenSourceConferenceDebrief.pptx
 
The UX of Automation by AJ King, Senior UX Researcher, Ocado
The UX of Automation by AJ King, Senior UX Researcher, OcadoThe UX of Automation by AJ King, Senior UX Researcher, Ocado
The UX of Automation by AJ King, Senior UX Researcher, Ocado
 
What's New in Teams Calling, Meetings and Devices April 2024
What's New in Teams Calling, Meetings and Devices April 2024What's New in Teams Calling, Meetings and Devices April 2024
What's New in Teams Calling, Meetings and Devices April 2024
 
ECS 2024 Teams Premium - Pretty Secure
ECS 2024   Teams Premium - Pretty SecureECS 2024   Teams Premium - Pretty Secure
ECS 2024 Teams Premium - Pretty Secure
 
AI revolution and Salesforce, Jiří Karpíšek
AI revolution and Salesforce, Jiří KarpíšekAI revolution and Salesforce, Jiří Karpíšek
AI revolution and Salesforce, Jiří Karpíšek
 
Unpacking Value Delivery - Agile Oxford Meetup - May 2024.pptx
Unpacking Value Delivery - Agile Oxford Meetup - May 2024.pptxUnpacking Value Delivery - Agile Oxford Meetup - May 2024.pptx
Unpacking Value Delivery - Agile Oxford Meetup - May 2024.pptx
 
Top 10 Symfony Development Companies 2024
Top 10 Symfony Development Companies 2024Top 10 Symfony Development Companies 2024
Top 10 Symfony Development Companies 2024
 
WebAssembly is Key to Better LLM Performance
WebAssembly is Key to Better LLM PerformanceWebAssembly is Key to Better LLM Performance
WebAssembly is Key to Better LLM Performance
 
Measures in SQL (a talk at SF Distributed Systems meetup, 2024-05-22)
Measures in SQL (a talk at SF Distributed Systems meetup, 2024-05-22)Measures in SQL (a talk at SF Distributed Systems meetup, 2024-05-22)
Measures in SQL (a talk at SF Distributed Systems meetup, 2024-05-22)
 
Linux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdf
Linux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdfLinux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdf
Linux Foundation Edge _ Overview of FDO Software Components _ Randy at Intel.pdf
 

Gene network inference