SlideShare a Scribd company logo
1 of 22
‫الرحمن‬ ‫هللا‬ ‫بسم‬
‫الرحیم‬
1
Expression of N-terminal seven
amino acids peptide of fibrin
(β–peptide) on surface of M13KO7
phage
Supervisor: Dr. Hossein Khanahmad
Aref Farrokhi Fard
aarreeff@ymail.com
2
Introduction
3
Vascular accidents
• Acute myocardial infarction
• Cerebrovascular accident (CVA) or acute
cerebral infarction
• Pulmonary thromboembolism
4
5
Fibrinolytic drugs for therapy
 Urokinase (UK)
 Streptokinase (SK)
 Recombinant Tissue plasminogen activator
(rTPA)
Side effects:
• Low efficiency
• Hemorrhage
6
Clot targeting for preventing side
effects and elevating the fibrinolysis
efficiency
Local enrichment using fibrin targeting : Specific anti fibrin
antibody(MA-15C5), 59D8):
 Chemical conjugation
 Fusion protein(Ab-E)
Nanobody
Scfv FabWhole Ab
Fv
fragment
7
Material and methods
8
9
fibrinogen beta chain isoform 1
preproprotein [Homo sapiens]
Beta-peptide as an antigen
Gly-His-Arg-Pro-Leu-Asp-Lys
FSARGHRPLDKKREE
45-52
NCBI Reference Sequence: NP_005132.2
10
11
Bam HI
2220
BsrG I
10211119 bp
12
7550 bp
GTCTGTACACCGTTCATCTGTCC
TGGATCCTCATTAAAGCCAGAA
1301..1522
1579..2853
gene="V"
CDS 843..1106
13
After overlap PCR
1. Agarose gel electrophoresis of PCR product
2. Gel extraction
3. Ligation between ABC fragment and plasmid
backbone
1179 bp
8729 bp
14
7550 bp
15
After transformation to top10
Plasmid extraction from transformed top10 bacteria
Transformation of phage genome to TG1
PCR on recombinant phage genome
Confirmation by sequencing
Obtaining phages from culture for SDS PAGE
16
SDS PAGE
17
18
19
Thank you for your attention
20
21
22

More Related Content

What's hot (20)

Coa 180179
Coa 180179Coa 180179
Coa 180179
 
Oral anticoagulants
Oral anticoagulantsOral anticoagulants
Oral anticoagulants
 
Cytarabine
CytarabineCytarabine
Cytarabine
 
Coa 180181
Coa 180181Coa 180181
Coa 180181
 
Coa 180180
Coa 180180Coa 180180
Coa 180180
 
Small molecule targeted therapy
Small molecule targeted therapySmall molecule targeted therapy
Small molecule targeted therapy
 
What is acalabrutinib(acp 196)
What is acalabrutinib(acp 196)What is acalabrutinib(acp 196)
What is acalabrutinib(acp 196)
 
Antithrombotic anticoagulants
Antithrombotic anticoagulantsAntithrombotic anticoagulants
Antithrombotic anticoagulants
 
Antiplatelet Drugs
Antiplatelet DrugsAntiplatelet Drugs
Antiplatelet Drugs
 
Cotrimoxazole
CotrimoxazoleCotrimoxazole
Cotrimoxazole
 
Class antiplatelet
Class antiplateletClass antiplatelet
Class antiplatelet
 
Pcsk 9 inhibitors
Pcsk 9 inhibitorsPcsk 9 inhibitors
Pcsk 9 inhibitors
 
24.antiplatelet drugs
24.antiplatelet drugs 24.antiplatelet drugs
24.antiplatelet drugs
 
Evolocumab - New drug to lower ‘LDL' cholesterol
Evolocumab - New drug to lower ‘LDL' cholesterolEvolocumab - New drug to lower ‘LDL' cholesterol
Evolocumab - New drug to lower ‘LDL' cholesterol
 
Noac mine [autosaved]
Noac mine [autosaved]Noac mine [autosaved]
Noac mine [autosaved]
 
Platelet derived mi r-223 promotes a phenotypicswitch in arterial injury repair
Platelet derived mi r-223 promotes a phenotypicswitch in arterial injury repairPlatelet derived mi r-223 promotes a phenotypicswitch in arterial injury repair
Platelet derived mi r-223 promotes a phenotypicswitch in arterial injury repair
 
Phenomenon of Vasomotor Reversal of Dale
Phenomenon of Vasomotor Reversal of DalePhenomenon of Vasomotor Reversal of Dale
Phenomenon of Vasomotor Reversal of Dale
 
Anticoagulant agents
Anticoagulant agentsAnticoagulant agents
Anticoagulant agents
 
Small molecule inhibitors
Small molecule inhibitorsSmall molecule inhibitors
Small molecule inhibitors
 
24.antiplatelet drugs
24.antiplatelet drugs24.antiplatelet drugs
24.antiplatelet drugs
 

Similar to Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

Protein-protein interaction
Protein-protein interactionProtein-protein interaction
Protein-protein interactionsigma-tau
 
New Cayman Chemical Products - Sept 24th, 2013
New Cayman Chemical Products - Sept 24th, 2013New Cayman Chemical Products - Sept 24th, 2013
New Cayman Chemical Products - Sept 24th, 2013Cayman Chemical
 
Metabolic investigation of segmental overgrowth: new insights in pathogenic m...
Metabolic investigation of segmental overgrowth: new insights in pathogenic m...Metabolic investigation of segmental overgrowth: new insights in pathogenic m...
Metabolic investigation of segmental overgrowth: new insights in pathogenic m...BiologInc
 

Similar to Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage (6)

Polymophism in the promoter
Polymophism in the promoterPolymophism in the promoter
Polymophism in the promoter
 
Envisioning the Future of Emerging Nonfactor Therapies in Hemophilia A and B:...
Envisioning the Future of Emerging Nonfactor Therapies in Hemophilia A and B:...Envisioning the Future of Emerging Nonfactor Therapies in Hemophilia A and B:...
Envisioning the Future of Emerging Nonfactor Therapies in Hemophilia A and B:...
 
Seminario Biologia Molecular
Seminario Biologia MolecularSeminario Biologia Molecular
Seminario Biologia Molecular
 
Protein-protein interaction
Protein-protein interactionProtein-protein interaction
Protein-protein interaction
 
New Cayman Chemical Products - Sept 24th, 2013
New Cayman Chemical Products - Sept 24th, 2013New Cayman Chemical Products - Sept 24th, 2013
New Cayman Chemical Products - Sept 24th, 2013
 
Metabolic investigation of segmental overgrowth: new insights in pathogenic m...
Metabolic investigation of segmental overgrowth: new insights in pathogenic m...Metabolic investigation of segmental overgrowth: new insights in pathogenic m...
Metabolic investigation of segmental overgrowth: new insights in pathogenic m...
 

More from Aref Farokhi Fard

CPP-Mediated Delivery of Cas9 RNP
 CPP-Mediated Delivery of Cas9 RNP CPP-Mediated Delivery of Cas9 RNP
CPP-Mediated Delivery of Cas9 RNPAref Farokhi Fard
 
Genome editing delivery systems
Genome editing delivery systemsGenome editing delivery systems
Genome editing delivery systemsAref Farokhi Fard
 
كاريوتايپينگ انسان
كاريوتايپينگ انسانكاريوتايپينگ انسان
كاريوتايپينگ انسانAref Farokhi Fard
 
Adenosine deaminase (ADA) immunodeficiency
Adenosine deaminase (ADA) immunodeficiencyAdenosine deaminase (ADA) immunodeficiency
Adenosine deaminase (ADA) immunodeficiencyAref Farokhi Fard
 
Recommendations to assure the quality, safety and efficacy of tetanus vaccines
Recommendations to assure the quality, safety and efficacy of tetanus vaccines Recommendations to assure the quality, safety and efficacy of tetanus vaccines
Recommendations to assure the quality, safety and efficacy of tetanus vaccines Aref Farokhi Fard
 
Isothermal Nucleic Acid Amplification Techniques
Isothermal Nucleic Acid Amplification TechniquesIsothermal Nucleic Acid Amplification Techniques
Isothermal Nucleic Acid Amplification TechniquesAref Farokhi Fard
 

More from Aref Farokhi Fard (12)

CPP-Mediated Delivery of Cas9 RNP
 CPP-Mediated Delivery of Cas9 RNP CPP-Mediated Delivery of Cas9 RNP
CPP-Mediated Delivery of Cas9 RNP
 
Genome editing by PNA
Genome editing by PNAGenome editing by PNA
Genome editing by PNA
 
Poly glutamic acide
Poly glutamic acidePoly glutamic acide
Poly glutamic acide
 
Genome editing delivery systems
Genome editing delivery systemsGenome editing delivery systems
Genome editing delivery systems
 
Biofilm reactors
Biofilm reactorsBiofilm reactors
Biofilm reactors
 
Infliximab
InfliximabInfliximab
Infliximab
 
Enzyme inhibition
Enzyme inhibitionEnzyme inhibition
Enzyme inhibition
 
كاريوتايپينگ انسان
كاريوتايپينگ انسانكاريوتايپينگ انسان
كاريوتايپينگ انسان
 
Peptide nucleic acid
Peptide nucleic acidPeptide nucleic acid
Peptide nucleic acid
 
Adenosine deaminase (ADA) immunodeficiency
Adenosine deaminase (ADA) immunodeficiencyAdenosine deaminase (ADA) immunodeficiency
Adenosine deaminase (ADA) immunodeficiency
 
Recommendations to assure the quality, safety and efficacy of tetanus vaccines
Recommendations to assure the quality, safety and efficacy of tetanus vaccines Recommendations to assure the quality, safety and efficacy of tetanus vaccines
Recommendations to assure the quality, safety and efficacy of tetanus vaccines
 
Isothermal Nucleic Acid Amplification Techniques
Isothermal Nucleic Acid Amplification TechniquesIsothermal Nucleic Acid Amplification Techniques
Isothermal Nucleic Acid Amplification Techniques
 

Recently uploaded

Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune WaterworldsBiogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune WaterworldsSérgio Sacani
 
development of diagnostic enzyme assay to detect leuser virus
development of diagnostic enzyme assay to detect leuser virusdevelopment of diagnostic enzyme assay to detect leuser virus
development of diagnostic enzyme assay to detect leuser virusNazaninKarimi6
 
Conjugation, transduction and transformation
Conjugation, transduction and transformationConjugation, transduction and transformation
Conjugation, transduction and transformationAreesha Ahmad
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPirithiRaju
 
FAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
FAIRSpectra - Enabling the FAIRification of Spectroscopy and SpectrometryFAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
FAIRSpectra - Enabling the FAIRification of Spectroscopy and SpectrometryAlex Henderson
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPirithiRaju
 
Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Silpa
 
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...chandars293
 
GBSN - Microbiology (Unit 1)
GBSN - Microbiology (Unit 1)GBSN - Microbiology (Unit 1)
GBSN - Microbiology (Unit 1)Areesha Ahmad
 
Dubai Call Girls Beauty Face Teen O525547819 Call Girls Dubai Young
Dubai Call Girls Beauty Face Teen O525547819 Call Girls Dubai YoungDubai Call Girls Beauty Face Teen O525547819 Call Girls Dubai Young
Dubai Call Girls Beauty Face Teen O525547819 Call Girls Dubai Youngkajalvid75
 
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.Nitya salvi
 
Call Girls Ahmedabad +917728919243 call me Independent Escort Service
Call Girls Ahmedabad +917728919243 call me Independent Escort ServiceCall Girls Ahmedabad +917728919243 call me Independent Escort Service
Call Girls Ahmedabad +917728919243 call me Independent Escort Serviceshivanisharma5244
 
PSYCHOSOCIAL NEEDS. in nursing II sem pptx
PSYCHOSOCIAL NEEDS. in nursing II sem pptxPSYCHOSOCIAL NEEDS. in nursing II sem pptx
PSYCHOSOCIAL NEEDS. in nursing II sem pptxSuji236384
 
300003-World Science Day For Peace And Development.pptx
300003-World Science Day For Peace And Development.pptx300003-World Science Day For Peace And Development.pptx
300003-World Science Day For Peace And Development.pptxryanrooker
 
Grade 7 - Lesson 1 - Microscope and Its Functions
Grade 7 - Lesson 1 - Microscope and Its FunctionsGrade 7 - Lesson 1 - Microscope and Its Functions
Grade 7 - Lesson 1 - Microscope and Its FunctionsOrtegaSyrineMay
 
Locating and isolating a gene, FISH, GISH, Chromosome walking and jumping, te...
Locating and isolating a gene, FISH, GISH, Chromosome walking and jumping, te...Locating and isolating a gene, FISH, GISH, Chromosome walking and jumping, te...
Locating and isolating a gene, FISH, GISH, Chromosome walking and jumping, te...Silpa
 
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Service
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts ServiceJustdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Service
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Servicemonikaservice1
 
pumpkin fruit fly, water melon fruit fly, cucumber fruit fly
pumpkin fruit fly, water melon fruit fly, cucumber fruit flypumpkin fruit fly, water melon fruit fly, cucumber fruit fly
pumpkin fruit fly, water melon fruit fly, cucumber fruit flyPRADYUMMAURYA1
 
Introduction to Viruses
Introduction to VirusesIntroduction to Viruses
Introduction to VirusesAreesha Ahmad
 

Recently uploaded (20)

Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune WaterworldsBiogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
 
development of diagnostic enzyme assay to detect leuser virus
development of diagnostic enzyme assay to detect leuser virusdevelopment of diagnostic enzyme assay to detect leuser virus
development of diagnostic enzyme assay to detect leuser virus
 
Conjugation, transduction and transformation
Conjugation, transduction and transformationConjugation, transduction and transformation
Conjugation, transduction and transformation
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
 
FAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
FAIRSpectra - Enabling the FAIRification of Spectroscopy and SpectrometryFAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
FAIRSpectra - Enabling the FAIRification of Spectroscopy and Spectrometry
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
 
Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.Proteomics: types, protein profiling steps etc.
Proteomics: types, protein profiling steps etc.
 
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
High Class Escorts in Hyderabad ₹7.5k Pick Up & Drop With Cash Payment 969456...
 
GBSN - Microbiology (Unit 1)
GBSN - Microbiology (Unit 1)GBSN - Microbiology (Unit 1)
GBSN - Microbiology (Unit 1)
 
Dubai Call Girls Beauty Face Teen O525547819 Call Girls Dubai Young
Dubai Call Girls Beauty Face Teen O525547819 Call Girls Dubai YoungDubai Call Girls Beauty Face Teen O525547819 Call Girls Dubai Young
Dubai Call Girls Beauty Face Teen O525547819 Call Girls Dubai Young
 
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
 
Call Girls Ahmedabad +917728919243 call me Independent Escort Service
Call Girls Ahmedabad +917728919243 call me Independent Escort ServiceCall Girls Ahmedabad +917728919243 call me Independent Escort Service
Call Girls Ahmedabad +917728919243 call me Independent Escort Service
 
PSYCHOSOCIAL NEEDS. in nursing II sem pptx
PSYCHOSOCIAL NEEDS. in nursing II sem pptxPSYCHOSOCIAL NEEDS. in nursing II sem pptx
PSYCHOSOCIAL NEEDS. in nursing II sem pptx
 
300003-World Science Day For Peace And Development.pptx
300003-World Science Day For Peace And Development.pptx300003-World Science Day For Peace And Development.pptx
300003-World Science Day For Peace And Development.pptx
 
Grade 7 - Lesson 1 - Microscope and Its Functions
Grade 7 - Lesson 1 - Microscope and Its FunctionsGrade 7 - Lesson 1 - Microscope and Its Functions
Grade 7 - Lesson 1 - Microscope and Its Functions
 
Locating and isolating a gene, FISH, GISH, Chromosome walking and jumping, te...
Locating and isolating a gene, FISH, GISH, Chromosome walking and jumping, te...Locating and isolating a gene, FISH, GISH, Chromosome walking and jumping, te...
Locating and isolating a gene, FISH, GISH, Chromosome walking and jumping, te...
 
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Service
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts ServiceJustdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Service
Justdial Call Girls In Indirapuram, Ghaziabad, 8800357707 Escorts Service
 
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
 
pumpkin fruit fly, water melon fruit fly, cucumber fruit fly
pumpkin fruit fly, water melon fruit fly, cucumber fruit flypumpkin fruit fly, water melon fruit fly, cucumber fruit fly
pumpkin fruit fly, water melon fruit fly, cucumber fruit fly
 
Introduction to Viruses
Introduction to VirusesIntroduction to Viruses
Introduction to Viruses
 

Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

Editor's Notes

  1. MKHLLLLL Gly-His-Arg-Pro-Leu-Asp-Lys
  2. http://openwetware.org/wiki/E._coli_genotypes
  3. M13KO7 is an M13 derivative which carries the mutation Met40Ile in gII, with the ori from P15A and the kana resistance gene from Tn903 both inserted within the M13 ori. M13KO7 is able to replicate in the absence of phagemid DNA.
  4. Bode C, Matsueda G, Hui K, Haber E: Antibody-directed urokinase: A specific fibrinolytic agent. Science 1985; 229:765-767