Ce diaporama a bien été signalé.
Nous utilisons votre profil LinkedIn et vos données d’activité pour vous proposer des publicités personnalisées et pertinentes. Vous pouvez changer vos préférences de publicités à tout moment.
Dmitry Schigel
Virve Viertiö
University of Helsinki
On the wings of bark beetles:
Ips typographus and fungal arrival
to sp...
Outline
• Project: colonization gates
• GBIF.org and databases
• Student projects & Ips story
• Teaching dead wood in 2016
Dmitry Schigel: 2012-2015
Academy of Finland
Colonization gates and establishment
of wood-decaying fungi in European Spruc...
GBIF.org
Note new e-mail address: dschigel@gbif.org
GBIF BY THE NUMBERS
652,948,064
species occurrence
records
15,882
datasets
804
data-publishing
institutions
• http://www.g...
 O1 spatial and temporal aspects TIME
early colonization events SPACE
 O2 role of Coleoptera as vectors BEETLE
of wood-d...
Colonization gates: BEETLES & STUDENTS
Maria Faticov, MSc
University of Helsinki
fungivory and host use
Virve Viertiö,
Uni...
9
Colonization
of a new
resource
Fungal arrival to trees
• spores and mycelia
• Going thourgh defence
mechanisms of a tree...
Pheromone traps
• emptied once a
week all
summer
• beetles to zip-
lock bags and to
the freezer
• traps washed
with soap w...
Air control
• to separate fungi
from the air only vs.
the trap catch
= air + beetles
• Eppendorfs with
fungal spores vs.
g...
>sample1
TTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATACAATTCGGTCGGCGGGAAGGAGGGGGAG
CTGTCGCTGGCCTTGTGGCATGTGCACGCTCTCTTTGGAACGTCG...
• Two sites
• 8 traps checked
• May to October
• Air samples as controls
• Fungal DNA present
• sorting and counting compl...
14
• Using DNA, tens of fungal species / OTUs were detected in
every beetle and air sample
• Molecular identification and ...
University of Helsinki
Finland
Moscow State University
Russia
Swedish University
of Agricultural Sciences
2016: Nordic – R...
Education and outreach
• Polypores of the Białowieża forest Oct 2013
• Biodiversity in dead wood, Helsinki Nov 2013
• Next...
FUNGAL ECOLOGY MATHEMATICAL BIOLOGY GROUP
http://blogs.helsinki.fi/deadwoodmeeting
registration until 20 May, may close earlier
SX invertebrate teacher,
Conditions:
teaching for a cup of rice
(& travel, & accomodation)
Photo: Dmitry Schigel,
Virve Viertiö
Thank you!
Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. I...
Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. I...
Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. I...
Prochain SlideShare
Chargement dans…5
×

Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. IX symposium on the conservation of saproxylic beetles, Genk, Belgium; oral presentation.

144 vues

Publié le

Project: colonization gates
GBIF.org and databases
Student projects & Ips story
Teaching dead wood in 2016

Publié dans : Sciences
  • Identifiez-vous pour voir les commentaires

  • Soyez le premier à aimer ceci

Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. IX symposium on the conservation of saproxylic beetles, Genk, Belgium; oral presentation.

  1. 1. Dmitry Schigel Virve Viertiö University of Helsinki On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland
  2. 2. Outline • Project: colonization gates • GBIF.org and databases • Student projects & Ips story • Teaching dead wood in 2016
  3. 3. Dmitry Schigel: 2012-2015 Academy of Finland Colonization gates and establishment of wood-decaying fungi in European Spruce In Southern Finland Metsäkulma, Mäntsälä Rörstrand, Sipoo X = 2014 Basel -> GBIF
  4. 4. GBIF.org Note new e-mail address: dschigel@gbif.org
  5. 5. GBIF BY THE NUMBERS 652,948,064 species occurrence records 15,882 datasets 804 data-publishing institutions • http://www.gbif.org | 01 APR 2016
  6. 6.  O1 spatial and temporal aspects TIME early colonization events SPACE  O2 role of Coleoptera as vectors BEETLE of wood-decaying fungi colonizing living trees GBIF <- DATA Colonization gates
  7. 7. Colonization gates: BEETLES & STUDENTS Maria Faticov, MSc University of Helsinki fungivory and host use Virve Viertiö, University of Helsinki MSc project on fungal dispersal by insects
  8. 8. 9 Colonization of a new resource Fungal arrival to trees • spores and mycelia • Going thourgh defence mechanisms of a tree Animal vectors
  9. 9. Pheromone traps • emptied once a week all summer • beetles to zip- lock bags and to the freezer • traps washed with soap water • catch 2013: total 73 000 beetles 10 Pics: D. Schigel
  10. 10. Air control • to separate fungi from the air only vs. the trap catch = air + beetles • Eppendorfs with fungal spores vs. greywater from the beetle washing 11 Pics: Virve Viertiö
  11. 11. >sample1 TTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATACAATTCGGTCGGCGGGAAGGAGGGGGAG CTGTCGCTGGCCTTGTGGCATGTGCACGCTCTCTTTGGAACGTCGGTCGTCTTTCATATTTTCACCAGTG CACCCAATGTAGGATGCCTCTCCTCCGGGAGGGGGGACCTATGTCTTTTTCAGACGCCCCCACAGTTTA >sample2 GAAAGTCTCAGAATGTTTACTATCGTCGAACCATGACTTCCAGGAGACGTGGGTCGGCGAGATAAAAG TTATCACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATG TAATGTGAATTGCAGATCTACAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCCTCGGTGTTCCG >sample3 PCR: Fungal ITS1 and ITS2 regions primers ITS1F – ITS4
  12. 12. • Two sites • 8 traps checked • May to October • Air samples as controls • Fungal DNA present • sorting and counting completed • DNA extracted -> PCR, Sequncing Virve Viertiö MSc student MSc project
  13. 13. 14 • Using DNA, tens of fungal species / OTUs were detected in every beetle and air sample • Molecular identification and statistical analysis ongoing • Which species of wood decomposing fungi will form a community here in 10, 20, 50 years?
  14. 14. University of Helsinki Finland Moscow State University Russia Swedish University of Agricultural Sciences 2016: Nordic – Russian Boreal Biodiversity and Data Education Network
  15. 15. Education and outreach • Polypores of the Białowieża forest Oct 2013 • Biodiversity in dead wood, Helsinki Nov 2013 • Next-gen seq sample prep course, Uppsala Jun 2014 • Biodiversity informatics and data management Jul 2014 • Polypore course, Russia Aug 2014 • Polypore course, Finland: ForBio Sep 2014 • Dead wood meeting, Lammi: SIU May 2015 * * * • Dead wood meeting & course Lammi, FIN Aug 2016 • Polypores as indicator species Lammi, FIN Sep 2016 • Biodiversity data skills Tartu, EST Nov 2016
  16. 16. FUNGAL ECOLOGY MATHEMATICAL BIOLOGY GROUP
  17. 17. http://blogs.helsinki.fi/deadwoodmeeting registration until 20 May, may close earlier
  18. 18. SX invertebrate teacher, Conditions: teaching for a cup of rice (& travel, & accomodation)
  19. 19. Photo: Dmitry Schigel, Virve Viertiö Thank you!

×