SlideShare une entreprise Scribd logo
1  sur  64
Télécharger pour lire hors ligne
Growing is Forever, a film by Jesse Rosten
Building a new biology
watermelon eggplant carrot
banana corn broccoli
http://www.hhmi.org/biointeractive/dog-breeding
oil palm plantation
Genetically Engineered U.S. Domestic Product (2012)
http://www.nature.com/nbt/journal/v34/n3/abs/nbt.3491.html
http://en.wikipedia.org/wiki/Subtilisin
=
1x
~20x
~200,000x
~1980, better soap cut US domestic hot water
heating by up to 10% (or 100,000 bbl oil per day)
7
Graphic c/o "Synthetic Aesthetics,” MIT Press (2014)
http://www.apsnet.org/edcenter/intropp/lessons/viruses/Pages/PapayaRingspotvirus.aspx
Dennis
Gonsalves
11
12Free .PDF of full briefing via DOI 1721.1/38455
13
http://ai.eecs.umich.edu/people/conway/VLSI/MIT78/MIT78.html
Lynn Conway’sVLSI course (1978)
14Free .PDF of full briefing via DOI 1721.1/38455
15
Graphic from "Synthetic Aesthetics" MIT Press (2014)
TAATACGACTCACTATAGGGAGA
Gene & Genome Constr. = #1 Tech. of 21st Ctry.
From abstract
information to
physical, living
DNA designs.
2003: $4/bp
2015: $0.04/bp
2027: $0.0004/bp?
16
Luxo Jr., Pixar Animation Studios
http://www.wired.com/2013/04/how-pixar-used-moores-law-to-predict-the-future/
“When the group moved to California to become part of Lucasfilm,
we got close to making a computer-animated movie again in the
mid-1980s — this time about a monkey with godlike powers but a
missing prefrontal cortex. We had a sponsor, a story treatment, and
a marketing survey. We were prepared to make a screen test: Our
hot young animator John Lasseter had sketched numerous studies
of the hero monkey and had the sponsor salivating over a glass-
dragon protagonist.
But when it came time to harden the deal and run the numbers for
the contracts, I discovered to my dismay that computers were still
too slow: The projected production cost was too high and the
computation time way too long. We had to back out of the deal.
This time, we [knew enough] to correctly apply Moore’s Law — [] we
had to wait another five years to start making the first movie. And
sure enough, five years later Disney approached us to make Toy
Story.” — Alvy Ray Smith
http://en.wikipedia.org/wiki/Moore%27s_law
http://www.synthesis.cc/cgi-bin/mt/mt-search.cgi?blog_id=1&tag=Carlson%20Curves
DNA sequencing (read) & synthesis (write)
are improving faster than silicon-based fab.
DNA sequencing (read) & synthesis (write)
are improving faster than silicon-based fab.
OK GO, on treadmills
https://www.youtube.com/watch?v=dTAAsCNK7RA
How should we organize ourselves to synthesize
a first human genome? Should we? Stay tuned.
25
http://nas-sites.org/synbioroadmap/
Growing is Forever, a film by Jesse Rosten
Building anew, biology
http://www.livingplanetindex.org/projects?main_page_project=AboutTheIndex&home_flag=1
Past ~45 years, humans x 2, animals / 2
The living bridges of Cherrapunji, India are made from the roots of the Ficus elastica tree. (http://rootbridges.blogspot.com/)
Reproducing,
growing, &
healing materials
~90 terawatts;
pre-distributed
Massively functional
Living ramifications
Biology is nature’s
nanotechnology
Take infectious & other
diseases off the table
Provide for all
of humanity
Stabilize & recover
natural biodiversity
Enable a culture
of citizenship
Understand life
via building
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
You are what you eat!
We eat what we are...
SISSEL TOLAAS
CHRISTINA AGAPAKIS
SISSEL TOLAAS
CHRISTINA AGAPAKIS
www.syntheticaesthetics.org
Cambridge iGEM 2009
46
Photo by Roger Lancaster (http://www.flickr.com/photos/rogeral/5813079061/); educational fair use
48
49
50
51
52
53
54
55
56
57
58
59
The living bridges of Cherrapunji, India are made from the roots of the Ficus elastica tree. (http://rootbridges.blogspot.com/)
Reproducing,
growing, &
healing materials
~90 terawatts;
pre-distributed
Massively functional
Living ramifications
Biology is nature’s
nanotechnology
Take infectious & other
diseases off the table
Provide for all
of humanity
Stabilize & recover
natural biodiversity
Enable a culture
of citizenship
Understand life
via building

Contenu connexe

Dernier

TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catchers
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor CatchersTechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catchers
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catcherssdickerson1
 
Transport layer issues and challenges - Guide
Transport layer issues and challenges - GuideTransport layer issues and challenges - Guide
Transport layer issues and challenges - GuideGOPINATHS437943
 
An experimental study in using natural admixture as an alternative for chemic...
An experimental study in using natural admixture as an alternative for chemic...An experimental study in using natural admixture as an alternative for chemic...
An experimental study in using natural admixture as an alternative for chemic...Chandu841456
 
Past, Present and Future of Generative AI
Past, Present and Future of Generative AIPast, Present and Future of Generative AI
Past, Present and Future of Generative AIabhishek36461
 
Arduino_CSE ece ppt for working and principal of arduino.ppt
Arduino_CSE ece ppt for working and principal of arduino.pptArduino_CSE ece ppt for working and principal of arduino.ppt
Arduino_CSE ece ppt for working and principal of arduino.pptSAURABHKUMAR892774
 
Sachpazis Costas: Geotechnical Engineering: A student's Perspective Introduction
Sachpazis Costas: Geotechnical Engineering: A student's Perspective IntroductionSachpazis Costas: Geotechnical Engineering: A student's Perspective Introduction
Sachpazis Costas: Geotechnical Engineering: A student's Perspective IntroductionDr.Costas Sachpazis
 
Mine Environment II Lab_MI10448MI__________.pptx
Mine Environment II Lab_MI10448MI__________.pptxMine Environment II Lab_MI10448MI__________.pptx
Mine Environment II Lab_MI10448MI__________.pptxRomil Mishra
 
welding defects observed during the welding
welding defects observed during the weldingwelding defects observed during the welding
welding defects observed during the weldingMuhammadUzairLiaqat
 
The SRE Report 2024 - Great Findings for the teams
The SRE Report 2024 - Great Findings for the teamsThe SRE Report 2024 - Great Findings for the teams
The SRE Report 2024 - Great Findings for the teamsDILIPKUMARMONDAL6
 
Risk Assessment For Installation of Drainage Pipes.pdf
Risk Assessment For Installation of Drainage Pipes.pdfRisk Assessment For Installation of Drainage Pipes.pdf
Risk Assessment For Installation of Drainage Pipes.pdfROCENODodongVILLACER
 
Class 1 | NFPA 72 | Overview Fire Alarm System
Class 1 | NFPA 72 | Overview Fire Alarm SystemClass 1 | NFPA 72 | Overview Fire Alarm System
Class 1 | NFPA 72 | Overview Fire Alarm Systemirfanmechengr
 
Indian Dairy Industry Present Status and.ppt
Indian Dairy Industry Present Status and.pptIndian Dairy Industry Present Status and.ppt
Indian Dairy Industry Present Status and.pptMadan Karki
 
Introduction to Machine Learning Unit-3 for II MECH
Introduction to Machine Learning Unit-3 for II MECHIntroduction to Machine Learning Unit-3 for II MECH
Introduction to Machine Learning Unit-3 for II MECHC Sai Kiran
 
US Department of Education FAFSA Week of Action
US Department of Education FAFSA Week of ActionUS Department of Education FAFSA Week of Action
US Department of Education FAFSA Week of ActionMebane Rash
 
CCS355 Neural Networks & Deep Learning Unit 1 PDF notes with Question bank .pdf
CCS355 Neural Networks & Deep Learning Unit 1 PDF notes with Question bank .pdfCCS355 Neural Networks & Deep Learning Unit 1 PDF notes with Question bank .pdf
CCS355 Neural Networks & Deep Learning Unit 1 PDF notes with Question bank .pdfAsst.prof M.Gokilavani
 
Work Experience-Dalton Park.pptxfvvvvvvv
Work Experience-Dalton Park.pptxfvvvvvvvWork Experience-Dalton Park.pptxfvvvvvvv
Work Experience-Dalton Park.pptxfvvvvvvvLewisJB
 
Instrumentation, measurement and control of bio process parameters ( Temperat...
Instrumentation, measurement and control of bio process parameters ( Temperat...Instrumentation, measurement and control of bio process parameters ( Temperat...
Instrumentation, measurement and control of bio process parameters ( Temperat...121011101441
 

Dernier (20)

Design and analysis of solar grass cutter.pdf
Design and analysis of solar grass cutter.pdfDesign and analysis of solar grass cutter.pdf
Design and analysis of solar grass cutter.pdf
 
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catchers
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor CatchersTechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catchers
TechTAC® CFD Report Summary: A Comparison of Two Types of Tubing Anchor Catchers
 
Transport layer issues and challenges - Guide
Transport layer issues and challenges - GuideTransport layer issues and challenges - Guide
Transport layer issues and challenges - Guide
 
An experimental study in using natural admixture as an alternative for chemic...
An experimental study in using natural admixture as an alternative for chemic...An experimental study in using natural admixture as an alternative for chemic...
An experimental study in using natural admixture as an alternative for chemic...
 
Past, Present and Future of Generative AI
Past, Present and Future of Generative AIPast, Present and Future of Generative AI
Past, Present and Future of Generative AI
 
Arduino_CSE ece ppt for working and principal of arduino.ppt
Arduino_CSE ece ppt for working and principal of arduino.pptArduino_CSE ece ppt for working and principal of arduino.ppt
Arduino_CSE ece ppt for working and principal of arduino.ppt
 
Sachpazis Costas: Geotechnical Engineering: A student's Perspective Introduction
Sachpazis Costas: Geotechnical Engineering: A student's Perspective IntroductionSachpazis Costas: Geotechnical Engineering: A student's Perspective Introduction
Sachpazis Costas: Geotechnical Engineering: A student's Perspective Introduction
 
Mine Environment II Lab_MI10448MI__________.pptx
Mine Environment II Lab_MI10448MI__________.pptxMine Environment II Lab_MI10448MI__________.pptx
Mine Environment II Lab_MI10448MI__________.pptx
 
welding defects observed during the welding
welding defects observed during the weldingwelding defects observed during the welding
welding defects observed during the welding
 
The SRE Report 2024 - Great Findings for the teams
The SRE Report 2024 - Great Findings for the teamsThe SRE Report 2024 - Great Findings for the teams
The SRE Report 2024 - Great Findings for the teams
 
🔝9953056974🔝!!-YOUNG call girls in Rajendra Nagar Escort rvice Shot 2000 nigh...
🔝9953056974🔝!!-YOUNG call girls in Rajendra Nagar Escort rvice Shot 2000 nigh...🔝9953056974🔝!!-YOUNG call girls in Rajendra Nagar Escort rvice Shot 2000 nigh...
🔝9953056974🔝!!-YOUNG call girls in Rajendra Nagar Escort rvice Shot 2000 nigh...
 
Risk Assessment For Installation of Drainage Pipes.pdf
Risk Assessment For Installation of Drainage Pipes.pdfRisk Assessment For Installation of Drainage Pipes.pdf
Risk Assessment For Installation of Drainage Pipes.pdf
 
Class 1 | NFPA 72 | Overview Fire Alarm System
Class 1 | NFPA 72 | Overview Fire Alarm SystemClass 1 | NFPA 72 | Overview Fire Alarm System
Class 1 | NFPA 72 | Overview Fire Alarm System
 
Indian Dairy Industry Present Status and.ppt
Indian Dairy Industry Present Status and.pptIndian Dairy Industry Present Status and.ppt
Indian Dairy Industry Present Status and.ppt
 
young call girls in Rajiv Chowk🔝 9953056974 🔝 Delhi escort Service
young call girls in Rajiv Chowk🔝 9953056974 🔝 Delhi escort Serviceyoung call girls in Rajiv Chowk🔝 9953056974 🔝 Delhi escort Service
young call girls in Rajiv Chowk🔝 9953056974 🔝 Delhi escort Service
 
Introduction to Machine Learning Unit-3 for II MECH
Introduction to Machine Learning Unit-3 for II MECHIntroduction to Machine Learning Unit-3 for II MECH
Introduction to Machine Learning Unit-3 for II MECH
 
US Department of Education FAFSA Week of Action
US Department of Education FAFSA Week of ActionUS Department of Education FAFSA Week of Action
US Department of Education FAFSA Week of Action
 
CCS355 Neural Networks & Deep Learning Unit 1 PDF notes with Question bank .pdf
CCS355 Neural Networks & Deep Learning Unit 1 PDF notes with Question bank .pdfCCS355 Neural Networks & Deep Learning Unit 1 PDF notes with Question bank .pdf
CCS355 Neural Networks & Deep Learning Unit 1 PDF notes with Question bank .pdf
 
Work Experience-Dalton Park.pptxfvvvvvvv
Work Experience-Dalton Park.pptxfvvvvvvvWork Experience-Dalton Park.pptxfvvvvvvv
Work Experience-Dalton Park.pptxfvvvvvvv
 
Instrumentation, measurement and control of bio process parameters ( Temperat...
Instrumentation, measurement and control of bio process parameters ( Temperat...Instrumentation, measurement and control of bio process parameters ( Temperat...
Instrumentation, measurement and control of bio process parameters ( Temperat...
 

En vedette

2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by HubspotMarius Sescu
 
Everything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPTEverything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPTExpeed Software
 
Product Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage EngineeringsProduct Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage EngineeringsPixeldarts
 
How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthThinkNow
 
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfAI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfmarketingartwork
 
PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024Neil Kimberley
 
Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)contently
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024Albert Qian
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsKurio // The Social Media Age(ncy)
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Search Engine Journal
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summarySpeakerHub
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next Tessa Mero
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentLily Ray
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best PracticesVit Horky
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project managementMindGenius
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...RachelPearson36
 

En vedette (20)

2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot
 
Everything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPTEverything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPT
 
Product Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage EngineeringsProduct Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage Engineerings
 
How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental Health
 
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfAI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
 
Skeleton Culture Code
Skeleton Culture CodeSkeleton Culture Code
Skeleton Culture Code
 
PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024
 
Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search Intent
 
How to have difficult conversations
How to have difficult conversations How to have difficult conversations
How to have difficult conversations
 
Introduction to Data Science
Introduction to Data ScienceIntroduction to Data Science
Introduction to Data Science
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best Practices
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project management
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
 

Building Anew, Biology