SlideShare une entreprise Scribd logo

ICIC 2013 New Product Introductions GenomeQuest

•
•
Dr. Haxel Consult
Dr. Haxel Consult
Technologie
1  sur  5
Télécharger pour lire hors ligne
Henk Heus, Ph.D. IP SEQUENCE SEARCH
THE QUESTION AND THE ANSWER CCCCGATCCTGGGGCAGAGGCGGCCTCTGGATCAT ACATATG 5 granted patents with a sequence mentioned in the claims with over 70% identity to the query
HOW IT WAS DONE
HOW IT WAS DONE
PRODUCT OVERVIEW  GQ-Pat database coverage / / / / ST.25 listings and sequences in text, tables, and figures 217 million sequences 437 thousand documents in 182 thousand INPADOC families 25 authorities US, CN, WO, EP, KR, JP, IN, CA, etc.  Easy to use web interface Multiple sequence search algorithms (genePAST) Result filtering capabilities Word and Excel exports Automated search alerts Result sharing within your team  Used by almost all big pharma and ag companies worldwide     

Recommandé

ICIC 2013 Conference Proceedings Sebastian Radestock
ICIC 2013 Conference Proceedings Sebastian RadestockICIC 2013 Conference Proceedings Sebastian Radestock
ICIC 2013 Conference Proceedings Sebastian RadestockDr. Haxel Consult
 
ICIC 2014 New Product Introduction Questel
ICIC 2014 New Product Introduction QuestelICIC 2014 New Product Introduction Questel
ICIC 2014 New Product Introduction QuestelDr. Haxel Consult
 
ICIC 2013 New Product Introductions Dolcera
ICIC 2013 New Product Introductions DolceraICIC 2013 New Product Introductions Dolcera
ICIC 2013 New Product Introductions DolceraDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Uwe Rosemann TIB
ICIC 2013 Conference Proceedings Uwe Rosemann TIBICIC 2013 Conference Proceedings Uwe Rosemann TIB
ICIC 2013 Conference Proceedings Uwe Rosemann TIBDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Krishna Molecular Connections
ICIC 2013 Conference Proceedings Krishna Molecular ConnectionsICIC 2013 Conference Proceedings Krishna Molecular Connections
ICIC 2013 Conference Proceedings Krishna Molecular ConnectionsDr. Haxel Consult
 
ICIC 2013 New Product Introductions Linguamatics
ICIC 2013 New Product Introductions LinguamaticsICIC 2013 New Product Introductions Linguamatics
ICIC 2013 New Product Introductions LinguamaticsDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Antony Williams Royal Society of Chemistry
ICIC 2013 Conference Proceedings Antony Williams Royal Society of ChemistryICIC 2013 Conference Proceedings Antony Williams Royal Society of Chemistry
ICIC 2013 Conference Proceedings Antony Williams Royal Society of ChemistryDr. Haxel Consult
 
ICIC 2013 New Product Introductions BizInt
ICIC 2013 New Product Introductions BizIntICIC 2013 New Product Introductions BizInt
ICIC 2013 New Product Introductions BizIntDr. Haxel Consult
 

Recommandé

ICIC 2013 Conference Proceedings Sebastian Radestock
ICIC 2013 Conference Proceedings Sebastian RadestockICIC 2013 Conference Proceedings Sebastian Radestock
ICIC 2013 Conference Proceedings Sebastian RadestockDr. Haxel Consult
 
ICIC 2014 New Product Introduction Questel
ICIC 2014 New Product Introduction QuestelICIC 2014 New Product Introduction Questel
ICIC 2014 New Product Introduction QuestelDr. Haxel Consult
 
ICIC 2013 New Product Introductions Dolcera
ICIC 2013 New Product Introductions DolceraICIC 2013 New Product Introductions Dolcera
ICIC 2013 New Product Introductions DolceraDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Uwe Rosemann TIB
ICIC 2013 Conference Proceedings Uwe Rosemann TIBICIC 2013 Conference Proceedings Uwe Rosemann TIB
ICIC 2013 Conference Proceedings Uwe Rosemann TIBDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Krishna Molecular Connections
ICIC 2013 Conference Proceedings Krishna Molecular ConnectionsICIC 2013 Conference Proceedings Krishna Molecular Connections
ICIC 2013 Conference Proceedings Krishna Molecular ConnectionsDr. Haxel Consult
 
ICIC 2013 New Product Introductions Linguamatics
ICIC 2013 New Product Introductions LinguamaticsICIC 2013 New Product Introductions Linguamatics
ICIC 2013 New Product Introductions LinguamaticsDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Antony Williams Royal Society of Chemistry
ICIC 2013 Conference Proceedings Antony Williams Royal Society of ChemistryICIC 2013 Conference Proceedings Antony Williams Royal Society of Chemistry
ICIC 2013 Conference Proceedings Antony Williams Royal Society of ChemistryDr. Haxel Consult
 
ICIC 2013 New Product Introductions BizInt
ICIC 2013 New Product Introductions BizIntICIC 2013 New Product Introductions BizInt
ICIC 2013 New Product Introductions BizIntDr. Haxel Consult
 
ICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions MinesoftICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions MinesoftDr. Haxel Consult
 
ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation Dr. Haxel Consult
 
ICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent SearchersICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent SearchersDr. Haxel Consult
 
ICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChemICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChemDr. Haxel Consult
 
ICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction GridlogiscICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction GridlogiscDr. Haxel Consult
 
ICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuestICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuestDr. Haxel Consult
 
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...Dr. Haxel Consult
 
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...Dr. Haxel Consult
 
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...Dr. Haxel Consult
 
ICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction InfotrieveICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction InfotrieveDr. Haxel Consult
 
ICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CASICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CASDr. Haxel Consult
 
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities Dr. Haxel Consult
 
ICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexisICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexisDr. Haxel Consult
 
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...Dr. Haxel Consult
 
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recallICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recallDr. Haxel Consult
 
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering ManagementAI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering ManagementDr. Haxel Consult
 
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...Dr. Haxel Consult
 
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...Dr. Haxel Consult
 
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...Dr. Haxel Consult
 
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...Dr. Haxel Consult
 
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...Dr. Haxel Consult
 
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...Dr. Haxel Consult
 

Contenu connexe

En vedette

ICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions MinesoftICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions MinesoftDr. Haxel Consult
 
ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation Dr. Haxel Consult
 
ICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent SearchersICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent SearchersDr. Haxel Consult
 
ICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChemICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChemDr. Haxel Consult
 
ICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction GridlogiscICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction GridlogiscDr. Haxel Consult
 
ICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuestICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuestDr. Haxel Consult
 
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...Dr. Haxel Consult
 
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...Dr. Haxel Consult
 
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...Dr. Haxel Consult
 
ICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction InfotrieveICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction InfotrieveDr. Haxel Consult
 
ICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CASICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CASDr. Haxel Consult
 
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities Dr. Haxel Consult
 
ICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexisICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexisDr. Haxel Consult
 
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...Dr. Haxel Consult
 
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recallICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recallDr. Haxel Consult
 

En vedette (15)

ICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions MinesoftICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions Minesoft
 
ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation
 
ICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent SearchersICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent Searchers
 
ICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChemICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChem
 
ICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction GridlogiscICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction Gridlogisc
 
ICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuestICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuest
 
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
 
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
 
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
 
ICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction InfotrieveICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction Infotrieve
 
ICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CASICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CAS
 
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
 
ICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexisICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexis
 
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
 
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recallICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
 

Plus de Dr. Haxel Consult

AI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering ManagementAI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering ManagementDr. Haxel Consult
 
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...Dr. Haxel Consult
 
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...Dr. Haxel Consult
 
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...Dr. Haxel Consult
 
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...Dr. Haxel Consult
 
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...Dr. Haxel Consult
 
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...Dr. Haxel Consult
 
AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...Dr. Haxel Consult
 
AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...Dr. Haxel Consult
 
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...Dr. Haxel Consult
 
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...Dr. Haxel Consult
 
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...Dr. Haxel Consult
 
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...Dr. Haxel Consult
 
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...Dr. Haxel Consult
 
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...Dr. Haxel Consult
 
AI-SDV 2022: Copyright Clearance Center
AI-SDV 2022: Copyright Clearance CenterAI-SDV 2022: Copyright Clearance Center
AI-SDV 2022: Copyright Clearance CenterDr. Haxel Consult
 
AI-SDV 2022: New Product Introductions: CENTREDOC
AI-SDV 2022: New Product Introductions: CENTREDOCAI-SDV 2022: New Product Introductions: CENTREDOC
AI-SDV 2022: New Product Introductions: CENTREDOCDr. Haxel Consult
 
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...Dr. Haxel Consult
 
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...Dr. Haxel Consult
 

Plus de Dr. Haxel Consult (20)

AI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering ManagementAI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
 
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
 
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
 
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
 
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
 
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
 
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
 
AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...
 
AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...
 
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...
 
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...
 
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...
 
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...
 
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...
 
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...
 
AI-SDV 2022: Copyright Clearance Center
AI-SDV 2022: Copyright Clearance CenterAI-SDV 2022: Copyright Clearance Center
AI-SDV 2022: Copyright Clearance Center
 
AI-SDV 2022: Lighthouse IP
AI-SDV 2022: Lighthouse IPAI-SDV 2022: Lighthouse IP
AI-SDV 2022: Lighthouse IP
 
AI-SDV 2022: New Product Introductions: CENTREDOC
AI-SDV 2022: New Product Introductions: CENTREDOCAI-SDV 2022: New Product Introductions: CENTREDOC
AI-SDV 2022: New Product Introductions: CENTREDOC
 
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...
 
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...
 

Dernier

2024 April Patch Tuesday
2024 April Patch Tuesday2024 April Patch Tuesday
2024 April Patch TuesdayIvanti
 
TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024Lonnie McRorey
 
From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .Alan Dix
 
[Webinar] SpiraTest - Setting New Standards in Quality Assurance
[Webinar] SpiraTest - Setting New Standards in Quality Assurance[Webinar] SpiraTest - Setting New Standards in Quality Assurance
[Webinar] SpiraTest - Setting New Standards in Quality AssuranceInflectra
 
So einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdfSo einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdfpanagenda
 
Moving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdfMoving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdfLoriGlavin3
 
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptxThe Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptxLoriGlavin3
 
Decarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a realityDecarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a realityIES VE
 
Connecting the Dots for Information Discovery.pdf
Connecting the Dots for Information Discovery.pdfConnecting the Dots for Information Discovery.pdf
Connecting the Dots for Information Discovery.pdfNeo4j
 
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...AliaaTarek5
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity PlanDatabarracks
 
How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.Curtis Poe
 
Take control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteTake control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteDianaGray10
 
Data governance with Unity Catalog Presentation
Data governance with Unity Catalog PresentationData governance with Unity Catalog Presentation
Data governance with Unity Catalog PresentationKnoldus Inc.
 
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc
 
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesHow to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesThousandEyes
 
Generative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdfGenerative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdfIngrid Airi González
 
Generative AI for Technical Writer or Information Developers
Generative AI for Technical Writer or Information DevelopersGenerative AI for Technical Writer or Information Developers
Generative AI for Technical Writer or Information DevelopersRaghuram Pandurangan
 
UiPath Community: Communication Mining from Zero to Hero
UiPath Community: Communication Mining from Zero to HeroUiPath Community: Communication Mining from Zero to Hero
UiPath Community: Communication Mining from Zero to HeroUiPathCommunity
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxLoriGlavin3
 

Dernier (20)

2024 April Patch Tuesday
2024 April Patch Tuesday2024 April Patch Tuesday
2024 April Patch Tuesday
 
TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024TeamStation AI System Report LATAM IT Salaries 2024
TeamStation AI System Report LATAM IT Salaries 2024
 
From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .
 
[Webinar] SpiraTest - Setting New Standards in Quality Assurance
[Webinar] SpiraTest - Setting New Standards in Quality Assurance[Webinar] SpiraTest - Setting New Standards in Quality Assurance
[Webinar] SpiraTest - Setting New Standards in Quality Assurance
 
So einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdfSo einfach geht modernes Roaming fuer Notes und Nomad.pdf
So einfach geht modernes Roaming fuer Notes und Nomad.pdf
 
Moving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdfMoving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdf
 
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptxThe Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
The Fit for Passkeys for Employee and Consumer Sign-ins: FIDO Paris Seminar.pptx
 
Decarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a realityDecarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a reality
 
Connecting the Dots for Information Discovery.pdf
Connecting the Dots for Information Discovery.pdfConnecting the Dots for Information Discovery.pdf
Connecting the Dots for Information Discovery.pdf
 
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity Plan
 
How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.
 
Take control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteTake control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test Suite
 
Data governance with Unity Catalog Presentation
Data governance with Unity Catalog PresentationData governance with Unity Catalog Presentation
Data governance with Unity Catalog Presentation
 
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
 
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesHow to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
 
Generative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdfGenerative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdf
 
Generative AI for Technical Writer or Information Developers
Generative AI for Technical Writer or Information DevelopersGenerative AI for Technical Writer or Information Developers
Generative AI for Technical Writer or Information Developers
 
UiPath Community: Communication Mining from Zero to Hero
UiPath Community: Communication Mining from Zero to HeroUiPath Community: Communication Mining from Zero to Hero
UiPath Community: Communication Mining from Zero to Hero
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
 

ICIC 2013 New Product Introductions GenomeQuest

  • 1. Henk Heus, Ph.D. IP SEQUENCE SEARCH
  • 2. THE QUESTION AND THE ANSWER CCCCGATCCTGGGGCAGAGGCGGCCTCTGGATCAT ACATATG 5 granted patents with a sequence mentioned in the claims with over 70% identity to the query
  • 3. HOW IT WAS DONE
  • 4. HOW IT WAS DONE
  • 5. PRODUCT OVERVIEW  GQ-Pat database coverage / / / / ST.25 listings and sequences in text, tables, and figures 217 million sequences 437 thousand documents in 182 thousand INPADOC families 25 authorities US, CN, WO, EP, KR, JP, IN, CA, etc.  Easy to use web interface Multiple sequence search algorithms (genePAST) Result filtering capabilities Word and Excel exports Automated search alerts Result sharing within your team  Used by almost all big pharma and ag companies worldwide     