Presented by Jimmy Smith, Shirley Tarawali, Iain Wright, Suzanne Bertrand, Polly Ericksen, Delia Grace and Ethel Makila at a side event at the 6th Africa Agriculture Science Week, Accra, Ghana, 15-20 July 2013
Apidays New York 2024 - The value of a flexible API Management solution for O...
Livestock research for Africa’s food security and poverty reduction
1. Livestock research for Africa’s food security and
poverty reduction
Jimmy Smith, Shirley Tarawali, Iain Wright, Suzanne Bertrand, Polly
Ericksen, Delia Grace and Ethel Makila
The 6th Africa Agriculture Science Week, Accra, Ghana, 15-20 July 2013
10. Growth scenarios for livestock systems
• ‘Strong growth’
– Where good market access and
increasing productivity provide
opportunities for continued
smallholder participation.
• ‘Fragile growth’
– Where remoteness, marginal land
resources or agroclimatic
vulnerability restrict intensification.
• ‘High growth with externalities’
– Fast changing livestock systems
potentially damaging the
environment and human health
• Different research and development
challenges for poverty, food
security, health and
nutrition, environment
11. Mission
(Purpose)
WHY ILRI exists
WHAT ILRI does
HOW the strategy is
operationalized
Strategic objectives
(informed by strategic issues
– external and internal
environment))
Critical success factors
performance areas
overlapping
do NOT map to structure
Key elements
12. Mission and vision
ILRI envisions a world where all people have
access to enough food and livelihood options to
fulfill their potential.
ILRI’s mission is to improve food and nutritional
security and to reduce poverty in developing
countries through research for efficient, safe and
sustainable use of livestock—ensuring better
lives through livestock.
13. What’s new?
• Long term strategy
• Outcomes and impacts
(accountable; attribution;
alignment)
• Diversity: trajectories; species;
ILRI strengths; partners
• Livestock ‘goods’ and ‘bads’
• Mainstreaming gender; human
health
• Clientele: Beyond livestock
producers; partners; capacity
development
14. ILRI acts in three (mutually reinforcing) areas
• To prove that better use of livestock can make
a big difference in enough people’s lives
through improved practice.
• To influence decision-makers so that they will
increase investment in livestock systems.
• To ensure there is sufficient capacity in
developing countries and among investors to
use increased investment effectively and
efficiently.
15. Strategic objective 1
ILRI and its partners will
develop, test, adapt and
promote science-based
practices that—being
sustainable and scalable—
achieve better lives
through livestock.
16. Strategic objective 2
ILRI and its partners will provide
compelling scientific evidence in
ways that persuade decision-
makers—from farms to
boardrooms and parliaments—
that smarter policies and bigger
livestock investments can deliver
significant socio-economic, health
and environmental dividends to
both poor nations and
households.
17. Strategic objective 3
ILRI and its partners will
work to increase capacity
amongst ILRI’s key
stakeholders and the
institute itself so that they
can make better use of
livestock science and
investments for better
lives through livestock.
19. • The biomass crisis in
intensifying smallholder
systems
• Vulnerability and risk in
drylands
• Food safety and aflatoxins
• Vaccine biosciences
• Mobilizing biosciences for a
food-secure Africa
21. The biomass crisis in intensifying
smallholder systems
Why does it matter?
• Increasing livestock populations are putting pressure on
demand for feed and increasing the competition for biomass
• Feed is at the interface of positive and negative effects of
livestock
• Supports intensification , income and employment
• Major input cost – feed:product price ratio increasing
• Biomass production is major user of natural resources (land, water)
• Increased intensification increases feed efficiency and
reduces GHG emissions, water use, biomass use
22. The biomass crisis in intensifying
smallholder systems
What are we doing about it?
Supporting sustainable intensification to produce more product
from less biomass. Using a value chain approach to: 1) make
better use of existing feed resources, 2) produce more and
better feeds; 3) encourage and facilitate feed
trading, processing and small scale business enterprises
around feed
• Tools for assessing feed resources and for prioritizing feed
interventions
• Select, breed and disseminate improved food-feed crops and forages
and identify new feed ingredients
• Identify feed surplus: deficit areas, facilitate fodder markets and
design context specific feed processing approaches
• Consider environmental impacts, including competition for biomass
(e.g. soil OM) in smallholder systems and GHG and water implications
23. The biomass crisis in intensifying
smallholder systems
What is the next frontier?
• What will the trajectory of demand be in Africa and what are the
implications for biomass use?
• Transitions vs sustainability
• Technical vs. institutional solutions e.g.
• Cellulolytic biomass upgrading?
• More efficient livestock value chains?
• Questions for discussion
• What are the options for sustainable intensification through livestock
feeding?
• How can we best deal with the competition for biomass between livestock
feeding and soil fertility?
25. Vulnerability and risk in drylands
Why does it matter?
• Lots of livestock produced in the
drylands
• E.g. 80% if red meat consumed in
Kenya
• Risk inherent to dryland livestock
production and risks are increasing
• Renewed commitment from
governments and donors to build
resilience
• Complex systems require
innovative solutions from research
and development
26. Vulnerability and risk in drylands
What are we doing about it?
• Hosting a Technical Consortium to support investment
plans for resilience
• Active partner in the Drylands CRP
• Piloting Index – Based Livestock Insurance
• Northern Kenya, Ethiopia
• Promoting equitable commercialization
• Fostering better land management
27. Vulnerability and risk in drylands
What is the next frontier?
• How can commercial pastoral livestock production
lead to growth in risk-prone drylands?
• Is there a long term role for livestock insurance in
pastoral production systems?
29. Food safety and aflatoxins
Why does it matter?
• FBD is the most common
disease in the world
• FBD is the most serious
agriculture associated
disease
• FBD is not just about
illness: also livestock
sector, trade and
environmental impacts
30. Food safety and aflatoxins
What are we doing about it?
• Targeting interventions to 9
high value, high
nutrition, high risk livestock
& fish chains
• Working with crop-centers
to strengthen public health
aspects of aflatoxins
31. Food safety and aflatoxins
The big questions?
• How to assure food safety
in informal markets where
most of the poor buy &
sell?
• How to wed food safety
and nutrition?
• Do aflatoxins stunt
children as well as killing
and causing liver cancer?
33. ILRI will initially focus on five prioritized diseases
African swine fever (ASF) – swine
African disease threatens the global $150 billion/year pig industry
Contagious bovine pleuropneumonia (CBPP) – cattle
Regional losses to CBPP amount to ~ $60 million/year
East Coast fever (ECF) – cattle
Regional losses exceed $300 million/year; kills ~ 1million cattle/year
Peste de petits ruminants (PPR) – small ruminants
Losses in Kenya alone amount to ~ $13 million/year
Rift Valley Fever (RVF) – small ruminants, cattle and human
2006/7 outbreak in Kenya cost ~ $30 million
309 human cases in Kenya, Somalia and Tanzania; 140 deaths
Vaccines save livestock and contribute to
food security and poverty alleviation
Importance of animal health control in Africa
34. Vaccine Biosciences: new science
platforms, new opportunities
Optimizing existing vaccines
Thermostabilization of attenuated viral vaccines
Establishing quality control and process improvement
Reverse vaccinology and immunology
Identification of vaccine antigens
Assessing protein and gene-based vaccine formulations
Pathogen & livestock genomics
Host and pathogen gene expression profiles
Pathogen population structure
Synthetic genomics
Manipulating bacterial genomes
Attenuating viruses by genome engineering
ACTGGTACGTAGGGCATCGA
TCGACATGATAGAGCATATA
GCATGACGATGCGATCGACA
GTCGACAGCTGACAGCTGAG
GGTGACACCAGCTGCCAGCT
GGACCACCATTAGGACAGAT
GACCACACACAAATAGACGA
TTAGGACCAGATGAGCCACA
TTTTAGGAGGACACACACCA
Bioinformatics
tools
Predict gene
sequences and
list candidate
vaccine antigens
Test experimental vaccine
Clone genes of
vaccine interest
(100’s of genes)
Filter genes via
immunological
assays
Pathogen genome mining
(1000’s of genes)
Molecular immunology
tools to assess immune
responses in cattle
(10’s genes)
35. Vaccinology capacity in Africa?
Marke ng
Market
assessment
Proof-of-principle
laboratory/field
Clinical
development
Manufacturing
Product development partnershipsResearch partnerships
Disease selec on Lead vaccine molecules Vaccine op miza on Scaled-up produc on Delivery
NARS, Universi es, ARIs, Regional and
sub-regional R&D organiza ons, PPP
Target product profile Phase I, II, III trials Regulatory processes Con nued monitoring
PPP, Private sector, Regional networks, FAO, OIE, PANVAC,
AU-IBAR, NARs, NGOs
How do we stimulate and sustain an African vaccine R & D pathway to achieve impact?
How can we grow a biotech and vaccine manufacturing sector in Africa?
37. Building biosciences capacity in Africa
Why?
• Small holder agriculture is crucial for Africa
• For the last 25 years the productivity of
small farmers has declined
• Availability and widespread use of quality
farm inputs & technologies developed
through biotechnology can improve
productivity
38. Building biosciences capacity in Africa
What?
Capacity buildingCollaborative research
Food safety
& security
Income
generation
Increased
trade
Climate
change Environmental
sustainability
Technologies
and services
39. Building biosciences capacity in Africa
• How can we build bio-sciences
capacity in Africa to move
from research results to
development impacts?
• How can we keep the BecA-ILRI
Hub relevant to the research
needs and context of African
scientists?
40. The presentation has a Creative Commons licence. You are free to re-use or distribute this work, provided credit is given to ILRI.
better lives through livestock
ilri.org
Editor's Notes
There MUST be a CGIAR logo or a CRP logo. You can copy and paste the logo you need from the final slide of this presentation. Then you can delete that final slide To replace a photo above, copy and paste this link in your browser: http://www.flickr.com/photos/ilri/sets/72157632057087650/detail/ Find a photo you like and the right size, copy and paste it in the block above.