1. The Role of Novel Silver(I) Complexes as potential Chemotherapeutics
Jake Gill
BSc Biomolecular Science
School of Biological Sciences
Dublin Institute of Technology
Kevin Street
Dublin 8
This project was submitted in part fulfilment of the BSc Biomolecular Science, Dublin Institute of
Technology

2. i
Abstract
A previous study by Thornton., (2012) led to the synthesis of novel silver(I) compound MD4 and MD5
and the hypothesis that these compounds are moderately cytotoxic possibly due to their avid DNA
binding and nuclease cleaving properties. This hypothesis explored using the same novel silver(I)
compounds MD4 and MD5 with the same drug controls of cisplatin and MXT in THP-1 monocyte cells.
Initial cytotoxic profiles ofthe THP-1 cells exposed to all 4 complexes was generated by the MTT assay
to calculate the IC25 concentrations of each complex for the DNA damage studies. This was 68.69µM
(24 hour) and 14.94µM (48 hour) for MD4 and MD5 was 29.80µM (24 hour) and 14.94µM (48 hour)
showing MD5 to be the most active complex. Double strand break (DSB) formation abilities of the
compounds was analysed by measuring fluorescent H2AX foci in THP-1 cells exposed to the 4
complexes for 24hr and 48hrs. Results were consolidated by both flow cytometry and confocal
microscopical analysis. Cisplatin showed DSB formation ofthe same levels at both time points (plateau
after 24hours) whereas MD4 and MD5 only showed significant DSB formation after 24 hours which was
similar to and exceeding cisplatin DSB levels. Furthermore, pro-apoptotic Bim and apoptosome forming
initiator Caspase 9 was also seen to be upregulated in THP-1 cells exposed to cisplatin early at 24
hours (but not 48 hours), and later significantly in MD5 and MD4. Interestingly drug control MXT did not
show DSB forming abilities but did show moderate upregulation ofBim, Caspase 9 and synergistic Bcl2
suggesting a role for apoptosis in its mode of action with the mitochondria a key player. Perhaps ROS
signals apoptosis for MXT rather than DNA damage as seen with cisplatin, MD4 and MD5.
Furthermore, Il-6 was seen to be upregulated in THP-1 cells exposed to MD4 which is suggestive of an
inflammatory response which warrants further investigation.
To conclude, this study demonstrated thatthere is exciting potential of these novel silver(I) complexes
(MD4 and MD5) as alternative chemotherapeutic drugs to cisplatin since they have the same biological

3. ii
mode of action by binding to DNA and initiating apoptosis. This study showed demonstrated that they
have greater activity than cisplatin.

4. iii
Acknowledgements
I would like to thank my supervisor Dr. Orla Howe who constantly guided me throughoutthis projectand
also gave me the opportunity to take on such a challenging project.
A big thank you to Garret Rochford and Dr. Jane Byrant who were never far away to help me
throughout this project.
I would also like to thank my friends, my family, my girlfriend, Louise for their love and support.
A mention to everyone in the DT226a WhatsApp group which kept me entertained throughout the three
months.
I would like to thank the guys in Bach16 who were very accommodating with allocating me time off for
project work.
Not to forget Monster Energy.

5. iv
Abbreviations
OH - Hydroxyl Radicals
3-MPA - 3-mercaptopropioinc acid
Bcl-2 – B-cell lymphoma 2
BLM – Bleomycin
COX – Cyclooxygenase
CT-DNA – Calf Thymus DNA
DCFH-DA - 2’,7’-Dichlorofluorescin Diacetate
DMSO – Dimethyl Sulfoxide
DNA – Deoxyribonucleic acid
DSB – Double Stranded Break
dsDNA – Double Stranded DNA
EtBr – Ethidium Bromide
H2O2 - Hydrogen Peroxide
IL – Interleukin
IO2 - Singlet Oxygen
MAPK - Mitogen Activated Protein Kinase
MXT – Mitoxantrone
NFκB – Nuclear Factor κ B
NSAID – Non-steroidal Anti-inflammatory Drugs
O2
- - Superoxide Anions
PEB - Platinum, Epoposide and Bleomycin
PGH – Prostaglandin
RNA – Ribonucleic acid
ROS – Reactive Oxygen Species
X-IAP - X-Chromosome Linked Inhibitor of Apoptosis
γH2AX – phosphorylation of Ser 139 on H2AX histone
PBS – Phosphate Buffer Saline
RT-PCR – Real Time Polymerase Chain Reaction

6. v
PGH2 – Prostaglandin
Dach - 1,2-di-aminocyclohexane

7. vi
Table of Contents
Abstract...................................................................................................................................i
Acknowledgements...........................................................................................................iii
Abbreviations.....................................................................................................................iv
1.0 Introduction.........................................................................................................................1
1.1 Cancer................................................................................................................................ 1
1.2 Therapy for Cancer.............................................................................................................. 2
1.3 Metal based drugs for Chemotherapy.................................................................................... 2
1.3.1 Cisplatin and its mode of action....................................................................................... 3
1.4 Alternative metal based drugs............................................................................................... 6
1.4.1 Metallonucleases...........................................................................................................7
1.4.2 Novel Copper Based Metallonucleases............................................................................ 7
1.4.3 Novel Silver(I) based chemotherapeutics.........................................................................8
1.5 Biological evaluation of alternative metal based drugs........................................................... 10
1.5.1 Cytotoxicity and tumour selectivity................................................................................. 11
1.5.2 Generation of Reactive Oxygen Species........................................................................ 11
1.5.3 DNA binding and cleaving properties............................................................................. 12
1.6 Hypothesised biological effects in Novel silver compounds .................................................... 14
1.6.1 Chemical structures ..................................................................................................... 14
1.6.2. Cytotoxicity analysis.................................................................................................... 16

8. vii
1.6.3 Potential Generation of ROS by MD4 and MD5 .............................................................. 16
1.6.4 DNA binding activity of MD4 and MD5 ........................................................................... 17
1.6.5 Potential Nuclease Activity ........................................................................................... 19
1.6.6 Potential anti-inflammatory activity ................................................................................ 20
1.7 Hypothesis ofproject for novel silver compounds.................................................................. 22
1.7.1 Induction of DNA damage by the silver(I) complexes ...................................................... 23
1.7.2 Induction of Apoptosis by silver (I) complexes ................................................................ 25
1.7.3 Anti-inflammatory responses of silver (I) compounds ...................................................... 29
1.8 Project synopsis and future directions.................................................................................. 30
2.0 Materials and Methods....................................................................................................31
2.1 Novel Silver(I) drugs........................................................................................................... 31
2.1.1 Solubilisation of Silver(I) drugs and clinically available controls ........................................ 31
2.1.2 Viscosity testing on drug complexes.............................................................................. 32
2.2 Cell culturing methods of THP-1 Cell Line ............................................................................ 33
2.2.1 THP-1 Cells ................................................................................................................ 33
2.2.2 Culturing conditions THP-1 Cell Line ............................................................................. 33
2.2.3 Cell Counting and Plating............................................................................................. 34
2.3 MTT Cytotoxicity Analysis................................................................................................... 35
2.3.1 MTT assay on THP-1 cells ........................................................................................... 35
2.3.2 Spectrophotometric analysis......................................................................................... 36
2.3.3 Statistical analysis ....................................................................................................... 36

9. viii
2.4 Gamma H2AX foci induction and analysis............................................................................ 37
2.4.1 Gamma H2AX assay on THP-1 cells............................................................................. 37
2.4.2 Flow cytometric analysis............................................................................................... 38
2.4.3 Confocal analysis ........................................................................................................ 38
2.5 Gene expression analysis in THP-1 cells ............................................................................. 39
2.5.1 RNA isolation.............................................................................................................. 40
2.5.2 RNA Quantification ...................................................................................................... 41
2.5.3 cDNA synthesis........................................................................................................... 41
2.5.4 High-throughput Real-time PCR analysis....................................................................... 42
2.5.5 Analysis of Gene Expression Data ................................................................................ 42
3.0 Results .............................................................................................................................43
3.1 Metal based complexes...................................................................................................... 43
3.1.1 Viscosity results........................................................................................................... 43
3.2 Cytotoxicity of Silver (I) compounds MD4 and MD5 compared to Cisplatin and MTX controls
using the MTT Assay............................................................................................................... 45
3.3 ƴH2AX.............................................................................................................................. 48
3.3.1 Flow Cytometery Results.............................................................................................. 48
3.3.2 Confocal Microscopy.................................................................................................... 56
3.4 Gene Expression............................................................................................................... 61
3.4.1 RNA Quantification of cell extracts exposed to average IC25........................................... 61
3.4.2 RT-PCR analysis of apoptotic gene expression in THP-1 cells exposed to the complexes at
24 and/or 48 hour exposures ................................................................................................ 63

10. ix
3.4.3 RT-PCR analysis of inflammatory gene expression in THP-1 cells exposed to the complexes
at 24 and/or 48 hour exposures............................................................................................. 68
4.0 Discussion........................................................................................................................70
5.0 Appendices......................................................................................................................74
Appendix 5.1: Working Protocols .............................................................................................. 74
5.1.1 Solubilisation of Metal based drugs ............................................................................... 74
5.1.2 Aseptic Technique for Cell Culturing.............................................................................. 74
5.1.3 THP-1 Growth Characteristics....................................................................................... 75
5.1.4 Subculturing of THP-1 cells .......................................................................................... 75
5.1.5 THP-1 Cell Counting for experimental procedures .......................................................... 76
5.1.6 MTT Assay protocol..................................................................................................... 77
5.1.7 γH2AX Focus Assay.................................................................................................... 78
5.1.8 Gene Expression protocols........................................................................................... 81
Appendix 5.2: Reagents........................................................................................................... 85
5.2.1 Cell culture reagents.................................................................................................... 85
5.2.2 Control chemotherapeutic drugs ................................................................................... 85
5.2.3 MTT assay reagents .................................................................................................... 85
5.2.4 γH2AX assay reagents................................................................................................. 86
5.2.5 Gene expression reagents............................................................................................ 87
Appendix 5.3: Raw Data .......................................................................................................... 89
5.3.1 MTT Assay Data.......................................................................................................... 89

11. x
5.3.2 ƴH2AX.......................................................................................................................105
5.3.3 Gene Expression Raw data .........................................................................................126
6.0 References.....................................................................................................................130

12. 1
1.0 Introduction
1.1 Cancer
Cancer is caused by a particular cell in the body losing its ability to control its replication and apoptotic
abilities. Cells in the body which have lost this function undergo unregulated cell division and growth
which leads to the formation of tumours. Tumours can be benign or malignant with the latter type
producing tumours that are fast growing and can metastasize around to body to other tissues. There
are many different types of cancer and they are classed by their cellular and tissue origin such as
Adenocarcinoma which is cancer of glandular cells, Carcinoma which is cancer of the epithelial cells,
Lymphoma which is cancer of immune cells and Leukaemia and sarcoma which are known cancers of
erythrocytes and skeletal muscle or bone respectively (National Cancer Institute, 2014). Cancer is
caused by mutations of genes which control the cell cycle and apoptosis, also known as programmed
cell death. Mutations can be genetically inherited or induced by carcinogens such as ionizing radiation,
chemicals or induced by viruses. Mutations can silence key genes responsible for the regulation of the
cell cycle such as p53 or cause the over expression ofgenes responsible for cell division. In 2012 there
were 8.2 million cancer related deaths, 32.6 million people living with cancer (within 5 years of
diagnosis) and 14.1 million new cases of cancer worldwide (WHO, 2014). Such high prevalence of
cancer worldwide has led to the development of treatment in many forms. Because mutated
deoxyribonucleic acid (DNA) in cells is the root cause of cancer, chemotherapeutic drugs are often
developed to target DNA in order to induce cell death or disrupt the mutation in the cells of a tumour
site.

13. 2
1.2 Therapy for Cancer
Surgery is used in many ways to help cancer patients and it is the oldest form of cancer therapy.
Surgery can result in the total removal of the tumour or it can help the metastatic grade, stage and
diagnosis ofthe type of cancer. However, often when a tumour has metastasised from its tissue site of
origin it becomes inoperable, particularly if the tumour spreads to the lymphatic system for example.
Radiotherapy in conjunction with surgery is another type of cancer therapy. Ionizing radiations
consisting of either X-rays or γ-rays are used to cause damage to the cancer cells DNA indirectly by
free radicals (OH or H+). Free radicals are caused by the interaction of ionizing radiation with other
molecules; mainly water, since 80% of cells consist of water (Podgorsak & Kainz, 2006).
Immunotherapy is another treatment available for cancer and involves the modification of the immune
system with the overall aim of causing an immune response to the neoplastic cell at the beginning of
cancer development. Treatment of the cancer early will prevent the growth and metastasis of the
tumour and reduce the overall damage to the surrounding tissue. An example of an immunotherapy
drug is Trastuzumab commonly known as Herceptin, and it is used in a form of monoclonal antibody
therapy particularly for breast cancer that interferes with the Her-2/neu receptor which is found to be
over expressed in 10-20% of breast cancers (Köninki et al., 2010) and leads to a disruption in tumour
growth.
1.3 Metal based drugs for Chemotherapy
The use of metals and metal complexes as chemotherapeutic drugs for different cancers is of
increasing importance for current and future treatment plans. Metals are considered inorganic and offer
a more diverse chemistry and therefore enhance their therapeutic application. Metal based drugs have
a central metal ion which is usually the key feature of the drugs mechanism of action. The first type of
metal based drugs synthesised were platinum based,the mostsuccessful of these being Cisplatin (cis-
diamminedichloroplatinum(II)).

14. 3
1.3.1 Cisplatin and its mode of action
Cisplatin is the most studied and prescribed chemotherapeutic drug. Cisplatin is a platinum based
metal-ion drug originally used as an antimicrobial agent. It is a relatively small molecule comprised of
11 atoms. Its chemical structure is a central platinum atom surrounded by two chlorine and two
ammonia side chains. Cisplatin is an active chemotherapeutic in its cis conformation, however in its
isomeric trans conformation it is chemotherapeutically inactive; the two isomeric forms of
Diamminedichloroplatinum (II) are illustrated below in Figure 1.1
Figure 1.1: Isomeric forms of Diamminedichloroplatinum (II) (Zlatanova, Yaneva, & Leuba, 1998).
The introduction of Cisplatin to cancer treatment in the 1970s was revolutionarily and has led to the
successful treatment of numerous cancer cases. Combined treatmentof Cisplatin and radiotherapy has
been shown to be more successful then radiotherapy alone in non-small cell lung cancer, carcinomas
of the cervix uteri, head and neck cancer and other tumours such as oesophageal carcinomas (Sak et
al., 2009). Cisplatin has been revolutionarily in the treatment of metatastic testicular cancer, as
approximately 70-80% of patients with the disease achieve a complete remission after three to four
cycles of combination cisplatin therapy (Okemeyer et al., 1999). The combination therapy is known as

15. 4
PEB (Platinum, Epoposide and Bleomycin) followed by secondary surgery, however even though the
prognosis is greatly increased for a patient there can be therapy related complications such as acute
and chronic nephrotoxicity caused by cisplatin (Hartmann, Kollmannsberger, Kanz, & Bokemeyer,
1999).
The biological mode of action of Cisplatin in cancer treatment is that it interacts directly with DNA and
mediates the inhibition of DNA synthesis, the suppression of ribonucleic acid (RNA) transcription and
the subsequent induction of apoptosis (Siddik, 2003). Upon interaction with DNA, Cisplatin forms DNA
adducts, which is the drug bound covalently to DNA which creates an altered bulky structure at the site
of binding. Primarily intrastrand 1,2 crosslink adducts are formed primarily with DNA sites containing
purine bases, particularly either two adjacent guanines (65%), an adenine and an adjacent guanine
(25%) or with two guanines separated by one or more bases (10%) (Macciò & Madeddu, 2013); which
lead to the formation of DNA double strand breaks (DSB). DSBs are the most lethal type of DNA
damage, and their inefficient or inaccurate repair can create mutations and chromosomal translocations
that induce genomic instability and ultimately cancer development (Yuan, Adamski, & Chen, 2013). In
addition to being a cause of cancer, DSB induction is paradoxically an effective treatment for cancer.
As cisplatin and other chemotherapeutic agents act by introducing sufficient DSBs into cancer cells to
activate cell death pathways such as apoptosis (Helleday, Petermann, Lundin, Hodgson, & Sharma,
2008).
Although Cisplatin has been a revelation in cancer treatment, there are concerns at the amount of
toxicity that the drug can cause in the human body due to possible accumulation of the metal platnium.
It has been documented that long term treatment with high concentrations of Cisplatin has led to
nephrotoxicity in patients treated for testicular cancer (Hanigan & Devarajan, 2003; Macciò & Madeddu,
2013). Nephrotoxicity is the damage caused to the renal system due to the exposure of cisplatin.
Cisplatin induced renal damage is associated with several patterns of histological changes within the
renal system such as acute focal necrosis of the distal convoluted tubules and collecting ducts,

16. 5
dilatation of convoluted tubules and formation of casts and a reduction in the glomerular filtration rate
(Hartmann et al., 1999). Cisplatin is administered via intravenous infusion. Once it has entered the
bloodstream it is met with a high concentration of chloride in the plasma. Plasma itself contains the
protein albumin to which its thiol groups directly bind to the drug leading to the well documented side
effects where a relatively low concentration of the drug reaching and entering the cell causing
nephrotoxicty due to the platinum ion being in a active dichloride state (Trynda-Lemiesz & Luczkowski
2004, Bodur 2010). This binding also leads to a relatively low concentration of the drug reaching the
intracellular environment, as the free cisplatin enters the cell through passive diffusion or through active
transport via copper transport proteins (Ishida, McCormick, Smith-McCune, & Hanahan, 2010).

17. 6
1.4 Alternative metal based drugs
The inorganic nature of metal ion based drugs as well as the success of cisplatin in the treatment of
cancer has led to the development of alternative metal ion based chemotherapeutics. Different drugs
have been synthesised based around a neutral, square-planar platinum(II) containing two cis-amines
and two leaving groups (Hannon, 2007). This structure gives a high probability of activity and therefore
a good strategy for the development of novel metal based drugs. Carboplatin was the first drug to be
synthesised based on the chemistry of cisplatin. It differs by having bidentate dicarboxylate in place of
the two leaving chloride groups (Hannon, 2007) (See Figure 1.2). More recently in 2004, Oxaliplatin
was accepted into clinical use, this being the third platinum based drug to be accepted. Oxaliplatin
benefits cancer treatment as it can be used to treat colorectal cancer, opposed to cisplatin and
carboplatin and other cisplatin resistant cancers. Oxaliplatin has its amines incorporated into a 1,2-di-
aminocyclohexane (dach) framework (Hannon, 2007). Figure 1.2 demonstrates the three clinical drugs
based on platinum chemistry with the platinum group clearly evident in the middle of each structure.
Figure 1.2: Contrast between the chemical structures of Cisplatin, Carboplatin and Oxaliplatin.

18. 7
1.4.1 Metallonucleases
Metal-containing reagents that chemically modify supercoiled DNA are often referred to as artificial
metallonucleases (Kellett, McCann, Howe, O’Connor, & Devereux, 2012). Bleomycin (BLM), a clinical
chemotherapeutic derived from Streptomyces verticillus is one such artificial metallonuclease
(Vanderwall et al., 1997). Fe2+BLM or Cu2+BLM, are known to tightly bind to DNA before inducing
chemical scission of the deoxyribose ring of DNA through a biochemical reaction with oxygen to
produce superoxide and hydroxide free radicals which cleave DNA (Kellett et al., 2012).
1.4.2 Novel Copper Based Metallonucleases
The first generation synthetic metallonucleases was [Cu(phen)2]2+, has led to the development of
further generations of drugs based on its chemistry. This is due to its dependency on exogenous
reductant to generate the active species such as L-Ascorbic Acid (Kellett, O’Connor, et al., 2011).
Collaboration with the Dublin Institute of Technology (DIT) and Dublin City University (DCU) has led to
the development of one such generation of metallonucleases which can function independent of
exogenous reductant. The metallonuclease is [Cu(phen)2(phthalate)] (phthalate = o-, m-, p-phthalate).
See Figure 1.3 for the chemical structure which shows two copper groups in blue with 2 surrounding
phenanthrolines on either side in grey with phthalate ligands. Variations of this structure were
synthesised through the named collaboration above and their cytotoxic and genotoxic properties
measured and compared to cisplatin.

19. 8
Figure 1.3: 3D Chemical structure of is [Cu(phen)2(phthalate)]
Studies conducted have shown that [Cu(phen)2(phthalate)] displays excellent chemotherapeutic
potential against colon, breast and cancer cell lines in vitro (Kellett, O’Connor, et al., 2011). These
drugs also show the induction of reactive oxygen species (ROS), high DNA binding properties, self
cleaving endonuclease activity (without the aid of oxidants or reductants) and the formation of double
strand breaks (DSBs). measuring ƴH2AX foci induction (Kellett, O’Connor, et al., 2011; Kellett et al.,
2012; Prisecaru et al., 2013) however the drug itself has poor solubility in water.
1.4.3 Novel Silver(I) based chemotherapeutics
Recently a series ofnovel silver based chemotherapeutics were synthesised in a PhD research study
conducted by Laura Thornton in DIT and in collaboration with Institute Technology Tallaght (ITT)A
broad range ofsilver(I)compounds were synthesised with different lengths of ligands (CH2)n where n =
1-10 Biological analysis ofthese compounds demonstrated two key compounds named MD4 and MD5
which show promising applications as potential chemotherapeutic drugs due to (a) their physical
properties such as solubility and non-photo sensitivity and (b) biological properties that include medium
cytotoxicity, DNA binding and cleaving activities and potential anti-inflammatory properties. These

20. 9
compounds form the basis of this research project to consolidate this hypothesis and explore the
biological mode of action in further detail.
..

21. 10
1.5 Biological evaluation of alternative metal based drugs
Cisplatin and other metal based drugs such as Copper, Silver and Manganese possess differentmodes
of action. The difference in function may be key as certain cancers are resistant to the mode of action
of current anti-cancer drugs such as SKOV-3, which are human ovarian cancer cell lines which possess
resistance to cisplatin. The mode of actions of the drugs may be different but they can have the same
overall biological outcome with the aim, to induce DNA damage induce apoptosis and cause the cell to
die. Figure 1.4 below depicts the main modes of action of the potential anti-cancer drugs in cells
Figure 1.4: Cellular targets for potential metal based anti-cancer drugs (Thornton, 2012).

22. 11
1.5.1 Cytotoxicity and tumour selectivity
Cytotoxicity assays are widely used in In vitro toxicology studies. The LDH leakage assay, a protein
assay, the neutral red and the MTT assay are the most common employed for the detection of
cytotoxicity or cell viability following exposure to toxic substances. MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-
diphenyltet-razolium bromide) is a water soluble tetrazolium salt, which is converted to an insoluble
purple formazan by cleavage of the tetrazolium ring by succinate dehydrogenase within the
mitochondria. The formazan product is impermeable to the cell membranes and therefore it
accumulates in healthy cells (Fotakis & Timbrell, 2006). This method is far superior to the previously
mentioned methods because it is easy-to-use, safe and has a high reproducibility rate.
Tumour selectivity is a cytotoxicity analysis performed on tumour versus non-tumour cells, to compare
cytoxicity results to determine ifthe cytotoxic agentis selective to tumour cells or not. Kellet, O’Connor.,
et al (2011) analysed dinuclear copper and manganese bis-phenanthroline dicarboxylate octanedioate
complexes for tumour selectivity across a range ofprogressive colorectal human derived cancer cells;
HT29, SW480 and SW620 versus a non-cancerous normal human keratinocyte line; HaCaT. The
Manganese complex was found to be 9.25 times less cytotoxic towards the non-cancerous cell line
when compared to HT29 and the Copper complex was 700 times less cytotoxic towards the non-
cancerous cell line when compared to HT29; indicating that the phenanthroline and its metal adducts
can increase the activity of p53, which initiates apoptosis even in cancerous cell line which have a
mutation of the p53 (tumour suppressor gene) such as HT29 (Kellett, O’Connor, et al., 2011).
1.5.2 Generation of Reactive Oxygen Species
The ability of a metal based drug to cause cytotoxicity through generation of Reactive Oxygen Species
(ROS) is one of the mechanisms of action currently being studied as a potential anti-cancer treatment.
Active species such superoxide anions (O2
-), hydrogen peroxide (H2O2), hydroxyl radicals (OH) and

23. 12
singlet oxygen (IO2) have the ability when formed intracellularly to induce DNA damage to the cell and
in turn induce apoptosis of the cell. A recent study by Kellet et al., 2011 looked at the potential of
dinuclear copper and a manganese bis-phenanthroline, dicarboxylate, octanedioate, based complexes;
[Cu2(µ2-oda)(phen)4](ClO4)2 and [Mn2(µ2-oda)(phen)4(H2O)2(oda)2]2-[Mn2(µ2- oda)(phen)4(H2O)2]2+. The
study showed that both complexes possessed extensive cytotoxicity and avid DNA binding activity. The
coinciding cellular ROS generation study showed that the manganese based complex (2) was an
exceptional generator of ROS within colon cancer cells (Kellett, O’Connor, et al., 2011).
A study conducted by Prisecaru et al., 2012 also analysed the potential of the metallonuclease di-
copper(II) cation, [Cu2(l-terephthalate)(1,10-phen)4]2+ (S1). Unlike first generation synthetic
metallonuclease [Cu(phen)2]2+, and similar to [Cu(phen)2(phthalate)], S1 can function independent of
exogenous reagents. Cytotoxic analysis was conducted on S1 againstcisplatin resistant human ovarian
cancer cell lines (SKOV-3) and non-cancer human ovarian cell line (HS-832). It was found that S1 is a
potent cytotoxin against both cell lines. In comparison with the clinical type II topoisomerase inhibitor,
Mitoxantrone, it was eight times more active against the SKOV-3 cell line. In order to analysis the
potential of cytotoxic oxidative stress, S1 was exposed to human-derived lung cancer cells (A549) and
it was concluded that it was capable of producing intracellular ROS upon a nano-molar exposure
(Prisecaru et al., 2012).
1.5.3 DNA binding and cleaving properties
The ability of a complex to bind DNA is a key mechanistic function. DNA binding can be examined by
way of a competitive ethidium bromide displacement assay. Previous studies have shown that novel
metal based complexes show avid DNA binding ability, particularly if phenanthroline is part of the
complexes structure (Kellet et al., 2012; Kellett, O’Connor, et al., 2011). After demonstration of the
ability of a complex to bind to DNA, a Nuclease Assay can be performed to test for the presence of
endonuclease activity. The complexes are exposed to specifically designed DNA which is in super

24. 13
coiled conformation (Form I) such as Puc18 DNA or Pbr322 (Kellett, O’Connor, et al., 2011; Kellett et
al., 2012; Prisecaru et al., 2012). Endonucleases require co-factors in order to carry out their function
such as the reductants 3-mercaptopropioinc acid (3-MPA) and ascorbic acid and oxidants such as
H2O2. A complex which possesses endonuclease ability is able to cleave DNA in Form I to either Form
II open coiled or Form III linearly coiled. Figure 1.5 demonstrates the three forms ofDNA scission which
and a typical gel electrophoresis result.
Figure 1.5: Typical gel electrophoresis of supercoiled DNA (Kennedy., 2012).
Another ability which is tested due a complex possessing the ability to bind to DNA is the ability of the
complex to cause DNA damage directly in the form of double strand breaks (DSB). DSB elicit the
phosphorylation of the histone variant H2AX becomes rapidly phosphorylated at serine-139 to form
γH2AX. A γH2AX Assay can be performed to analyse the presence or not of the γH2AX, this is an
immunoassay using a primary antibody for γH2AX and a secondary fluorescently labelled antibody to
detectthe presence of γH2AX. The γH2AX assay is reliable and has been used in previous studies by
Kellet et al., (2012) and Prisecaru et al., (2013) which investigated different metal based complexes to
induce DSB.

25. 14
1.6 Hypothesised biological effects in Novel silver compounds
The study by Thornton., (2012) analysed the biological activity of20 various novel silver(I) compounds.
The silver(I) complexes were derived from the reaction of various silver(I) dicarboxylate complexes with
the nitrogen donor ligand 1,10- phenanthroline. The silver(I) complexes used for this research project
were MD4 (originally labelled complex 9) and MD5 (originally labelled complex 19). Complexes 1-10
have similar structure to Figure 1.6 (MD4) and complexes 11-20 have similar structure to Figure 1.7
(MD5). Thornton conducted a biological analysis of these compounds as outlined below
1.6.1 Chemical structures
Two specific silver compounds MD4 [Ag2(udda)] and MD5 [Ag2(phen)3(udda)] which both have two Ag
groups divided by a ligand size of n=9 were the most active compounds in the biological test systems
outlined by Thornton, 2012. See Figure 1.6 for the basic chemical structure of the MD4 silver
dicarboxylate the silver (Ag) metal on either end of the compound separated by CH2 (n=9). Figure 1.7
shows basic chemical structure of MD5 with additional phenanthroline groups attached directly to the
two Ag metal groups separated by CH2 ligands (n=9).
The size of the compounds were quite different as MD4 is quite a small compound with a molecular
weight of 430g/mol compared to the more complex MD5 compound with a molecular weight of
1385g/mol. MD5 is a Di-Ag phenanthroline complexes, the phenanthroline acts as a ligand for avid
DNA binding and also possess a strong binding affinity for the silver ion. Both compounds were made
soluble in methanol (MeOH) as this possesses minimal toxicity to cells, however the compounds did not
completely go into suspension.

26. 15
Figure 1.6: Chemical structure of MD4 with two Ag groups separated by n=9 CH2 groups.
where n = 1 - 10
(CH2)nC C
O
O
Ag
O
O
Ag
Figure 1.7: Chemical Structure of MD5 with two Ag groups surrounded by phenanthroline and
seperated by CH2 (n=9)
where n = 1 - 10
C C
O
O
Ag
O
O
AgN
N N
N(CH2)
C C
O
O
Ag
O
O
Ag
N
N
N
N(CH2)n
N
N

27. 16
1.6.2. Cytotoxicity analysis
A cytotoxic analysis against two human derived cancer cell lines, breast (MCF-7) and ovarian (SKOV-
3) was performed on the 20 silver(I) complexes and clinically available anti-cancer drugs cisplatin and
mitoxantrone as positive drug controls. The activity was determined by the calculation of IC50 values
(the drug concentration causing a 50% reduction in cellular viability). MD4 and Complexes 1-10 showed
an initial selectivity towards the MCF-7 cell line. Interestingly, MD5 possessed the bestcytotoxic activity
against both cancer cell lines; this may be due to the large amount of phenanthroline ligands which may
contribute to the activity. It is known that phenanthroline alone can bind directly to DNA and attached to
a specific metal group can enhance its activity (Kellett, Connor, et al., 2011; McCann et al., 2012;
Prisecaru et al., 2013).
In an attempt to determine whether this class of silver(I) complex displayed any selectivity for cancer
cells over non-cancerous cells, a representative complex was tested against the normal Human
Keratinocyte cell line (HaCaT). Since MD5 showed the mostpotentactivity against the cancer cell lines
this was selected. MD4 was also tested as this is its silver(I) dicarboxylate starting material as well as
the cisplatin and mitoxantrone (MXT) controls. Results showed that MD5 was fast acting against the
non-cancerous cell line with an increasing activity compared to that of the two cancer cell lines.
1.6.3 Potential Generation of ROS by MD4 and MD5
In order to conclude whether the results from the cytotoxicity analysis were derived by the silver(I)
complexes ability to cause cell death through production of ROS, SKOV-3 cisplatin resistant ovarian
and MCF-7 breastcancer cells along with HaCaT normal human keratinocyte cells which had been pre-
treated with the intracellular ROS indicator 2’,7’-dichlorofluorescin diacetate (DCFH-DA) were exposed
to both MD4 and MD5.The results obtained clearly demonstrated that neither of the silver(I) complexes
were capable of generating reactive oxygen species within the cancer or normal cells and that ROS
generation does not appear to be a feature of their biological mode of action in cells. This was an

28. 17
interesting result since cisplatin and copper based drugs have been shown to induce ROS in their
mechanistic response. This would therefore indicate a possible alternative mode of action of silver (I)
compounds.
1.6.4 DNA binding activity of MD4 and MD5
Another way anti-cancer drugs cause cell death through apoptosis is through direct DNA binding form
DNA adducts (as described previously). Thornton., (2012) tested the ability of these silver (I)
compounds to bind to DNA by using a competitive ethidium bromide (EtBr) displacement experiment
using calf thymus DNA (CT-DNA). EtBr bound DNA is highly flouregenic, the assay uses the principle in
which the drugs must compete with the EtBr for binding to the DNA leading in a reduction of
fluorescence. This assay compared the binding of these compounds to DNA compared to the known
DNA intercalator actinomycin D and the DNA minor groove binder pentamidine and therefore the
binding properties could be calculated.
As expected complexes 11-20 including MD5 had a very high DNA binding activity due to its phen
ligand and MD5 showed higher DNA binding properties than EtBr. Complexes 1-10 including MD4 also
possessed good DNA binding activity. Figure 6 displays the EtBr displacement of MD4 (9) and MD5
(19) versus the DNA intercalators and known DNA binding structures; MD4 displayed good apparent
DNA binding constants but compared to the intercalators the binding ability is significantly less. MD5
displayed a DNA binding constant of 18 times greater than that of the intercalators.

29. 18
Figure 1.8: Competitive EtBr displacement for complexes 9 (MD4) and 19 (MD5), uddaH2, phen,
pentamidine and actinomycin D (Thornton., 2012).
Based on the binding interactions of the compounds Thornton., (2012) further analysed the possible
DNA intercalation ability (insertion into DNA) of the drugs through a DNA viscosity titration. Helical
lengthening of DNA results in an increase of viscosity indicating intercalation has occurred. Viscosity
profiles were carried out on MD4 (9), MD5 (19), metal free phen, the known DNA intercalator EtBr and
pentamidine (minor groove binder) as controls. Figure 1.9 displays the viscosity profiles of all
complexes;the viscosity profile ofMD4 (9) is one of a complex which does not intercalate with DNA but
its silver do bind to DNA but do not intercalate with it based on results above. The viscosity profile of
MD5 is exceptional compared to the DNA intercalator EtBr, this result is significant as it suggests that
MD5 possesses avid DNA binding and intercalation ability.
Concentration (µM)
0 50 100 150 200 250
Fluoresence(a.u.)
10
20
30
40
50
9
19
UddaH2
Phen
Pentamidine
Actinomycin D

30. 19
Figure 1.9: Relative viscosity increments of CT-DNA upon exposure to complexes 9 (MD4) and 19
(MD5, metal free phen, ethidium bromide and pentamidine (Thornton., 2012).
1.6.5 Potential Nuclease Activity
Since these compounds demonstrated avid DNA binding properties, Thornton., (2012) then tested their
endonuclease activity by measuring the DNA cleavage of supercoiled (SC) pBR322 DNA in the
presence ofcofactors such as the reductants 3-mercaptopropioinc acid (3-MPA) and ascorbic acid and
oxidants such as H2O2. If the DNA was cleaved from exposure to the silver(I) complexes then this could
be clearly seen by separation ofthe DNA by gel electrophoresis to yield three different forms. Form I is
the supercoiled form which is wrapped really tight and therefore able to mediate further through the
matrix of the gel. Form II is the open coiled form where one strand has been cut. Form III is the linear
coiled form where double stranded scission has occurred and two strands of the DNA have been cut
(Kellett, O’Connor, et al., 2011). Figure 1.5 displays an animation of the three forms of the coiled DNA.
Compound/ DNA (µM)
0.00 0.05 0.10 0.15 0.20
0.9
1.0
1.1
1.2
1.3
1.4
1.5
1.6
9
19
Phen
Ethidium Bromide
Pentamidine

31. 20
Figure 1.10 Relaxation ofpBR322 DNA by (a) lane 1: DNA control, lanes 2 – 4 complex 9 (MD4) at 50,
5 and 0.5 µM (b) lane 1: DNA control, lanes 2 – 6 complex 19 (MD5) at 50, 20, 10, 5 and 1 µM
(Thornton., 2012).
(a)
1 2 3 4
(b)
1 2 3 4 5 6
The agarose gel electrophoresis results indicate that MD4 possesses no nuclease activity. In contrast
MD5 based on results has depleted the DNA from form to form III.
1.6.6 Potential anti-inflammatory activity
Thornton., (2012) also analysed the silver(I) complexes for Cyclooxygenase (COX) Inhibition ability as
due to the role of inflammation in the development of cancer there is a potential development of non-
steroidal anti-inflammatory drugs (NSAIDS) combined with a metal based ion. NSAIDS inhibit the action
of prostaglandins by inhibiting cyclo-oxygenase (COX) activity of the enzyme prostaglandin G/ H-
synthase. The level of prostaglandin found in tumour cells is much higher than normal cells.
COX-1 and COX-2 are bifunctional enzymes which have a COX component that converts arachidonic
acid to prostaglandin (PGH2). Prostaglandins play a key role in inflammatory response and contribute to
the characteristics of acute inflammation (FitzGerald & Ricciotti, 2011).

32. 21
The COX inhibitory effects of MD4 and MD5 were analysed and results showed that they were
marginally active towards COX-1 (9.6 and 25.2 % Inhibition, respectively) and are inactive against
COX-2. Similarly, salicylic acid (aspirin) which is known to have weak anti-COX-1 and anti-COX-2
inhibition is inactive as a COX-2 inhibitor however, moderate COX-1 inhibition (26.7 %) is observed.

33. 22
1.7 Hypothesis of project for novel silver compounds
From the biological evaluation results obtained by Thornton (2012) it is clear that both MD4 and MD5
possess cytotoxicity in both cancerous and non-cancerous cell lines butwere not tumour selective and,
MD4 being initially cytotoxic to MCF-7 cell line, however over longer time period the cytotoxic effects of
MD4 was the same for both MCF-7 and SKOV-3 cell lines. MD5 exhibited the best cytotoxic activity
over the time points against MCF-7 and SKOV-3 cell lines with an IC50 value comparable to that of
cisplatin. Further biological mechanistic analysis showed that neither of the silver(I) complexes
possessed any potential ROS generation but did show strong DNA binding and endonuclease
activities. This highlights the hypothesis that ROS is not a key player in the DNA damage response in
cells and although the binding properties increased with the phenanthroline groups (MD5) that silver (I)
does appear to be directly bound to DNA causing the cytotoxic and genotoxic effects. .
The aim of this current research study was to further analyse both MD4 and MD5 for their mechanistic
mode of action in cells using the information that was gathered by Thornton (2012). THP-1 cells were
used and basic cytotoxic analysis was conducted to calculate the IC50 concentration of both MD4 and
MD5 as the concentrations to use for the subsequent biological testing. The DNA damage effect was
further investigated using an alternative approach to measure the induction of double strand breaks
(DSB) (ƴH2AX assay) compared to the Nuclease assay. Once DNA is damaged in cells then apoptosis
is usually signalled by key genes to initiate cell death. Key genes in the Intrinsic Apoptosis response
were analysed. Due to the clearly different mode of action of these silver (I) compounds compared to
copper and cisplatin, preliminary studies were also conducted to investigate the anti-inflammatory
properties of these compounds.

34. 23
1.7.1 Induction of DNA damage by the silver(I) complexes
It was determined that MD5 possessed DNA binding and cleavage ability and that MD4 possessed
apparent DNA binding ability. Double strand breaks (DSB) are a form of DNA damage believed to be
caused by the Silver(I) compounds. In response to DSBs caused by the potential chemotherapeutic
drugs, the conserved C-terminal tail of the histone variant H2AX becomes rapidly phosphorylated at
serine-139 to form γH2AX by PI3-K like kinases, including ATM, ATR and DNA-PKc (Yuan et al., 2013).
H2AX is a member of histone H2A family, which is one of the five types of histones that package and
organize eukaryotic DNA into chromatin. The basic composition of chromatin is the nucleosome. Each
nucleosome consists of eight histone molecules, two from each of the four core histones (H2A, H2B,
H3, and H4) to form an octamer, which is wrapped by approximately 146 base pairs of DNA (Yuan et
al., 2013). The γH2AX assay represents a fast and sensitive approach for detection of DNA DSBs
induced by cancer therapeutics. There is a linear relationship between the number of γH2AX foci and
DNA DSB in a cell, as DSB increase so does the number of γH2AX foci and as DSB are repaired the
number of γH2AX foci decreases. This can be quantified to the number of foci per nucleus and can be
determined if the drug is efficient or not (Bonner, Martin, & Lobachevsky, 2011). The assay uses the
phosphorylated serine-139 residue on γH2AX as a biomarker to quantify the amount of foci per
nucleus.
The gold standard methods in performing γH2AX assays are to use flow cytometry and confocal
microscopy to detectand quantitatively measure the induction offluorescentfoci. Both methods involve
the use of a rabbit polyclonal antibody with specificity for γH2AX, with a fluorescent probe to allow
quantification. Flow cytometry is a technique for quantification and examination of a cell population. The
cells are incubated with the fluorescently labelled antibody and aspirated one by one in droplets in a
hydrodynamic stream of fluid. This passes through a series of lasers and detectors, and there are a
number of detectors which measure different properties such as side scatter, forward scatter and
fluorescence at a particular wavelength. This is used to quantify the bound fluorescently labelled

35. 24
antibody to γH2AX per cell nucleus (Jahan-Tigh, Ryan, Obermoser, & Schwarzenberger, 2012).
Confocal microscopy is a microscopic technique which uses a small pinhole aperture allowing only the
light emitting from the desired focal spot to pass through and therefore eliminate any out of focus light.
By using the pinhole aperture the resolution is greatly increased leading to the ability to focus on a
particular area for examination. The areas focused on are that of fluorescence caused by the antibody
binding to γH2AX in the nucleus of the cells (Nwaneshiudu et al., 2012). Images can be taken of the
area and manual quantification can be performed to quantify the amount of cells with labelled
antibodies.
Figure 1.11: Sample of ƴH2AX foci (Green) at DSB sites (Indicated with arrows). Confocal image from
THP-1 cell line exposure to IC25 value of Cisplatin for 24 Hours.
Mitosis

36. 25
1.7.2 Induction of Apoptosis by silver (I) complexes
Apoptosis is a conserved process designed to removed damaged or extraneous cells from an organism
without inducing inflammation (Maag, Hicks, & Machamer, 2003). Apoptosis can occur in two pathways;
the Extrinsic (Death Receptor Pathway) or the Intrinsic (Mitochondrial Apoptotic Pathway). The Intrinsic
pathway is activated when the mitochondria of the cell is damaged due to a variety of toxic agents
which would include these test silver(I) compounds MD4 and MD5.
The Bcl-2 protein family play a vital role in the deciding ifa cell will live or die, they are divided into pro-
apoptotic and anti-apoptotic (Gross, Mcdonnell, & Korsmeyer, 1999). Following a death signal, cytosolic
and monomeric pro-apoptotic BAX translocates to the mitochondria where it becomes an integral
membrane protein and cross-links as a homodimer (Gross et al., 1999). The integration of BAX and
another pro-apoptotic protein BAK leads to the release of cytochrome c to the cytosolic which begins
the downstream biochemical reactions which lead to apoptosis by binding to and activating the
apoptosome.
Caspases are the general death causing proteins used in apoptosis; they orchestrate the cellular and
biochemical reactions in order to cause the cell to die. There are two main types of Caspases; Initiator
and Effector. Initiator caspases exist in cells as inactive monomers, which are activated by the
formation of dimers (induced proximity) and subsequent stabilisation with cleavage at their aspartate
residues. Caspase 9 is the initiator caspase in the intrinsic pathway. Caspase 9 is activated by the
formation of the dimers in a protein called the apoptosome which in turn is activated by the release of
cytochrome c from the mitochondria into the cytosol. There are three executioner caspases; 3, 6 and 7.
Caspase 3 being the main effector, and they exist as inactive dimeric zymogens (pro-caspases) until
activation. They are activated by the cleavage at specific aspartate residues between a small and a
large subunit to yield a mature executioner caspase (active). Cleavage (activation) of the executioner
caspases are mediated by upstream initiator caspases. Once activated, the executioner caspase can

37. 26
cleave different proteins which in turn bring about the morphological changes which occur during
apoptosis such as DNA fragmentation, membrane blebbing and the formation of apoptotic bodies.
Figure 1.12: Animation of the Intrinsic Pathway ofApoptosis; A – Bcl-2, B – Bim, C – Caspase 9 and D
– Caspase 3 (Testa, 2004).
This apoptotic study involved the analysis of the intrinsic apoptotic genes expressed in THP-1 cells
exposed to MD4 and MD5 novel silver (I) compounds. The method involves quantifying the gene
expression in real time by Real Time Polymerase Chain Reaction (RT-PCR) of the target gene
transcripts against a reference gene transcript (housekeeper genes) using SYBR green technology.
RT-PCR has three major steps; Denaturation, Annealing and Elongation (Extension) (Edwards,
Saunders and Logan, 2004).

38. 27
The cDNA is denatured at a high temperature to single stranded DNA. During the annealing step of real
time PCR, the forward and reverse primers hybridise to the target mRNA, this forms small regions of
double stranded DNA (dsDNA) where the SYBR green can intercalate, therefore producing a
fluorescent signal. In the elongation step, more dsDNA is formed and therefore the SYBR green can
intercalate and increasing the fluorescence more so. At the end of this step when the maximum SYBR
green has intercalated, the complete fluorescence is measured. Melting curve analysis (Tm) is
performed to determine that only the specific target product has been detected and prevents error in
final data analysis. One melting peak represents one amplicon (Edwards, Saunders and Logan, 2004).
During denaturation the SYBR green is released and fluorescence is greatly reduced. Primers (forward
and reverse) then anneal to the two separate single strands and a PCR product is generated using
dNTPs (Deoxynucleotide triphosphates) which act as “building blocks” for the PCR product and TAQ-
Polymerase which is derived from the thermo tolerant bacterium Thermus aquaticus. When the
polymerization is completed the SYBR green dye binds to the double stranded PCR products which
results in a net increase in fluorescence. The RT-PCR cycles continue until the cycle threshold (set by
the housekeeper genes – Actin and Tubulin) are complete (Edwards, Saunders and Logan, 2004).

39. 28
Figure1.13: Animation of RT-PCR using SYBR Green technology
A number of apoptotic genes were analysed to determine if the silver(I) in MD4 and MD 5 had any
effects on the level ofgene expression. Bcl-2 was analysed as it has a pivotal role in deciding if a cell
should undergo apoptosis or not, BIM a member of the Bcl-2 family with a BH3 domain which interact
with Bcl-2 to suppress its anti-apoptotic activity (Gross et al., 1999). Caspase 9 is an initiator caspase
which forms a complex with APAF-1 to form the apoptosome and Caspase 3 is an executioner caspase
which is activated to ensure that cell death is executed. These caspases were analysed as increased
expression ofthese genes can indicate the activation of the intrinsic pathway of apoptosis and that they
are fundamentally linked to each other. NF-κB (nuclear factor kappa-light-chain-enhancer of activated B
cells) expression was also analysed. NF-κB is a transcription factor which when activated can localise
into the nucleus and bind to DNA as specific enhancer regions to up-regulate anti-apoptotic genes
(Lamkanfi, Declercq, Vanden Berghe, & Vandenabeele, 2006). As regards the anti-apoptotic activity of

40. 29
NF-κB it has been shown to increase the expression of X-IAP (X-Chromosome Linked Inhibitor of
Apoptosis), X-IAP prevents activation ofpro-caspase 9 and also blocks the catalytic cleft of caspase 3
thus inhibiting its activity (Karin & Lin, 2002). Interleukin 6 (IL-6) is a cytokine which plays a major role
as a signal transducer in inflammation (Scheller, Chalaris, Schmidt-Arras, & Rose-John, 2011). Once
activated IL-6 can lead to the increased expression of other inflammatory genes through a Mitogen
Activated Protein Kinase (MAPK) pathway.
1.7.3 Anti-inflammatory responses of silver (I) compounds
NF-κB and IL-6 gene expression were measured to test the hypothesis that MD4 and MD5 has role to
play in the inflammatory response in cells and could potentially be anti-inflammatory compounds. The
inflammatory response is less toxic to cells and considering that the silver (I) compounds show medium
toxicity to cells, then the inflammatory response may be an alternative or additional biological mode of
action.
NF-κB as described above as a role to play in apoptosis but it also plays a key role in inflammation by
regulating the expression of many target genes that mediate distinct events in the inflammatory
response (Staal, Bekaert, & Beyaert, 2011). IL-6 is a key cytokine that is immediately stimulated in an
innate immune response in monocyte/macrophage cells (such as the THP-1 cells used) when they are
invaded by a potential pathogen.
This study involved using the methodology described in section 1.7.2 above to measure key genes
expressed in an innate inflammatory response; IL-6 and NF-κB. This was a preliminary study to
compare DNA damage and an apoptotic response to a less toxic inflammatory response.

41. 30
1.8 Project synopsis and future directions
In this study, an analysis oftwo promising silver(I) complexes named MD4 and MD5 was carried out to
investigate their biological mode ofaction and potential use as chemotherapeutic drugs as alternatives
to Cisplatin and its derivatives currently on the market.
THP-1 cells were used to first consolidate the hypothesis that MD4 and MD5 cause DNA damage and
initiate apoptosis in cells as a consequence.THP-1 cells were then used to measure an alternative less
toxic mode of action as MD4 and MD5 were suggested to have anti-inflammatory properties. THP-1
cells were chosen on the basis to develop the latter hypothesis further as part of a new PhD research
projectfor the future. The silver(I) complexes themselves are in a very early stage ofbiological analysis
and many different cellular mechanisms need to be explored to elucidate their potential as drugs for
chemotherapy.

42. 31
2.0 Materials and Methods
2.1 Novel Silver(I) drugs
Both MD4 and MD5 complexes were derived from the PhD thesis study of Laura Thornton (2012). Both
complexes were synthesised in this study and were kindly donated by her supervisor Prof. Michael
Devereux, Director and Dean of the College of Sciences and Health at DIT. MD4 was present in a
colourless powder and was insoluble with common solvents. MD5 was present as a yellow powder.
As well as the two silver(I) complexes, two other clinically available were selected for analysis and to
function as controls. Cisplatin Cl2H6N2Pt+2 (Sigma-Aldrich) and Mitoxantrone C22H28N4O6 (MXT)
(Sigma-Aldrich) were selected because they had been used in all of the original biological evaluation
studies by Thornton (2012).
2.1.1 Solubilisation of Silver(I) drugs and clinically available controls
Prior to any of the biological experiments to be conducted all of the drugs were put into solution
(solubilised). MXT, MD4 and MD5 were solubilised in Methanol (MeOH) and Cisplatin was solubilised in
H20 with 2.5% NaCl.
A stock concentration of the solution was determined through calculations based on the molecular
weight of the compound and the final stock concentration. The adequate amount of drug was weighed
out and was made soluble in 5ml ofthe coinciding solution named above. See Table 2.1 for details on
the molecular weight, stock concentration, stock volume and solution the compounds were made
soluble in.

43. 32
Table 2.1: Metal based drugs stock solution components.
2.1.2 Viscosity testing on drug complexes
The samples of drugs demonstrated a small degree of insolubility and therefore viscosity was
measured. 10 mls of each sample was placed into a small plastic cup, this cup was then placed
appropriately into a SV-10 Viscometer, which measure the viscosity of liquids. The sensory plates and
temperature probe were lowed to the indentation of the probes and the measurement commenced.
Results were presented in millipascal (mPa).
Metal Based Drug Mw Desired [Stock] Stock Volume Amount of drug Solution
Cisplatin 300.05g/mol 2mM 5ml 3.0005mg H₂0 2.5% NaCl
MXT 454.44g/mol 2.5mM 5ml 5.68mg MeOH
MD4 430g/mol 2.5mM 5ml 5.37mg MeOH
MD5 1385g/mol 2.5mM 5ml 17.31mg MeOH

44. 33
2.2 Cell culturing methods of THP-1 Cell Line
2.2.1 THP-1 Cells
THP-1 is a human monocytic cell line derived from the peripheral blood of a one year old male with
acute monocytic leukaemia. The THP-1 cells were obtained from the American Tissue Culture
Collection (ATCC). Monocytes are polymorphogranular leukocytes, meaning that they have granules in
their cytoplasm as well as a multi-lobed nucleus. However the THP-1 cell line is cancerous and
histological analysis shows that in contrast to the non-cancerous monocyte they possess a much larger
circular nucleus and a smaller cytoplasmic area due to the immature cells being produced due to the
cancer.
2.2.2 Culturing conditions THP-1 Cell Line
The cell line THP-1 was resuscitated from liquid nitrogen and grown up in Roswell Park Memorial
Institute media (RPMI 1640, Sigma). The media was also further supplemented with 60ml of Foetal Calf
Serum (Gibco) and 5ml of L-Glutamine (Gibco) to further aid growth of the cell line. The cell line stock
was cultured in T75 cell culture flasks (Corning) and incubated at 37°C with 5% CO² and 95% O2. THP-
1 cells are grown in suspension and were recorded to have a doubling time of 24-48hours. It was vital
to ensure a sterile environment when handling the mammalian cell line to avoid contamination with
microorganisms. Therefore aspectic technique was practiced at all times during culturing and
experimentation. See 5.1.2 for details of aseptic technique and 5.1.3 for the growth characteristics of
THP-1 cells.
The THP-1 cell line was easily sub-cultured as the cells were already grown in suspension. To
subculture the cells, the media from the T75 flask was transferred to a sterile tube and centrifuged to
condense the cells.The supernatant was poured offinto a discard jar and the pellet was re-suspended
in 50ml of fresh supplemented RPMI1640 media. Cell cultures were transferred in 5 and 10ml volumes
to T75 flasks and topped up to a total volume of 50ml to increase the number of cells in culture and

45. 34
accommodate the large number of experiments. This was necessary to ensure the cell line remained
viable throughout the study. See 5.1.2 for a more detailed protocol.
2.2.3 Cell Counting and Plating
In order to determine the amount of THP-1 cells in suspension and to ensure that correct amount of
cells are used for each experiment the THP-1 cells were counted using a Coulter Counter (Beckman
Coulter). 1ml of the cell suspension was placed into 20ml of Isoton electrolyte solution (Beckman
Coulter) in a dilivial. The instrument itself was pre-set to count cells per 0.5ml. Prior to a cell count, a
background count was performed on just Isoton solution to ensure that the instrument was clear and
ready to measure the cell suspension.
The final count from the coulter counter was obtained and the background count subtracted. The value
obtained was then multiplied by 42 (probe reads 0.5ml; the total volume in the dilivial is 21mls x 2,
yielding 42) to getthe number of cells per ml of suspension. See 5.1.5 for a more detailed protocol on
using the Coulter Counter.

46. 35
2.3 MTT Cytotoxicity Analysis
The cytotoxic properties of MD4 and MD5 along with the clinically available anti- cancer drugs cisplatin
and mitoxantrone were investigated using a standard MTT assay against the human derived cell line
THP-1. The cytotoxicty of these 4 compounds were analysed at a 24 hour and a 48 hour exposure.
This cytotoxicity data allows for the calculation of IC25 values (inhibitory concentration) for each
complex.
2.3.1 MTT assay on THP-1 cells
This is a colorimetric assay that measures the reduction of yellow 3-(4,5-dimethythiazol-2-yl)-2,5-
diphenyl tetrazolium bromide (MTT) by mitochondrial succinate dehydrogenase. The MTT enters the
cells and passes into the mitochondria where it is reduced to an insoluble, coloured (dark purple)
formazan product. The cells were then solubilised with an organic solvent; Dimethyl Sulfoxide (Sigma-
Aldrich) and the released, the solubilised formazan reagent was measured spectrophotometrically.
Since the reduction of MTT can only occur in metabolically active cells the level of activity is a measure
of the viability of the cells. Cells that are non-viable or dead will not show any metabolic activity and
therefore will not reduce the MTT.
In order to determine the effectiveness and the concentration of the metal based drugs to induce cell
death over a 24 hour and a 48 hour exposure, the MTT Assay was set up using 12.5mM, 25mM,
50mM, 100mM and 200mM of the drugs and negative controls for the assay on 96 well round bo ttom
cell culture plates (Fisher Scientific) (See Table 5.2 for image for the set up of each plate). In order to
coincide with statistical validity the plates were set up in triplicate and the assay was repeated three
times. For the 24 hour time point, the plate wells were seeded to a total volume of 100µl (cells and
media) in the plates with 1x104 cells and 1x105 cells for the 48 hour time point. The plates were pre-
incubated at 37°C for 24 hours to ensure cells were able to recover and re-enter the log phase due to
stress induced by the experimental setup. After the pre-incubation, the plates were centrifuged and the

47. 36
supernatant was removed using a multi-channel pipette. The cell pellets were re-suspended in the drug
stock solution diluted with cell culture media to the required concentration described above and for
either 24hour or 48 hour exposure time points.
After the 24 hour or 48 hour drug exposure time point the plates were centrifuged and washed in
Phosphate Buffer Saline (PBS) three times. After washing the pellet was re-suspended in 100µl MTT
reagentand incubated at 37°C for 3 hours to allow the reaction to occur. After reaction, the plates were
centrifuged and washed three times in PBS ensuring that the formazan salts were firmly attached to the
bottom of the wells. The formazan salts were re-suspended in 100µl Dimethyl Sulfoxide (DMSO)
(Sigma-Aldrich) and placed on a bench top plate shaker for 15 minutes.
2.3.2 Spectrophotometric analysis
The absorbance of the MTT reduced cells on the plates was read by spectrophotometer (1420
Multilabel Counter Victor3V) at 595nm wavelength. The data obtained from the absorbance were
analysed and their cytotoxic concentrations calculated.
2.3.3 Statistical analysis
Each plate had five replicate concentrations and the assay was repeated three times and in each
separate repeatthere were three replicates per drug exposure. This was done for statistical validity and
led to the collection of large amounts of raw data of absorbance values. Absorbance values were
exported from the 1420 Multilabel Counter Victor3V to Microsoft Office Excel. Basic statistical
calculations were performed using Excel, the mean absorbance per individual triplicate this led to the
normalisation ofthe means (The average of the negative control being 100%). Standard deviation was
also calculated in order to assess any significant errors across the assays. An Excel software addition
known as ‘XLFIT’ (ID Business Solutions) was used to calculate the IC25 values of the individual
replicates across the three separate assays. The average IC25 value for each drug and exposure time
was then calculated.

48. 37
2.4 Gamma H2AX foci induction and analysis
2.4.1 Gamma H2AX assay on THP-1 cells
Five T25 flasks of THP-1 cells in 5mls of supplemented RPMI1640 media (as described previously)
were set up for each time exposure; Negative control, Cisplatin, MXT, MD4 and MD5. The appropriate
drug:media amount to equate the IC25 values were added to a total volume of 5mls for 24 hrs and 48
hrs. After each time exposure, the cell suspension in each T25 flash was transferred to sterile tubes
and centrifuged at 400g for 5 minutes at room temperate. The supernatant was removed and the pellet
was re-suspended in 5mls of PBS and centrifuged as before. The cell pellet was fixed in 200µl of 2%
paraformaldehyde (See 5.2.4) and allowed to stand for 10 minutes. The tubes were centrifuged as
before and the supernatant was removed and tubes were allowed to blot dry for 5 minutes. The pellets
were re-suspended and transferred to eppendorf tubes in 1ml of 70% ice cold ethanol (See 5.2.4).
Samples were stored in the freezer overnight.
The samples were centrifuged at 1200rpm for 5 minutes at room temperature to acclimatise the
samples from the freezer. Once the supernatant was removed the pellet was re-suspended in200µl
0.25% Triton X-100 (Sigma-Aldrich) (Appendix 2: 5.2.4) and allowed to stand at room temperature for 5
minutes. The samples were then centrifuged as before and once the supernatant was removed the
pellet was re-suspended in 200µl of 2% Bovine Serum Albumin (Sigma-Aldrich) (See 5.2.4) and
allowed to stand for 30 minutes. The samples were centrifuged and the supernatants were removed.
The pellets were re-suspended in 100µl of the primary antibody (Millipore) (1:500) (See 5.2.4) and
incubated at room temperature for 1 hour. After incubation the samples were centrifuged as before and
washed in 300µl of PBS three times. 100µl of the secondary antibody (Millipore) (1:200) (See 5.2.4)
was added to re-suspend the pellet and incubated at room temperature for 1 hour in the dark. After the
incubation the cells were centrifuged as before and washed in 300µl of PBS three times. The counter

49. 38
stain; popidium iodide (PI) (Sigma) (1:100) was added to the samples at a volume of 350µl with PBS.
The samples were then ready for subsequent flow cytometry and confocal analysis.
2.4.2 Flow cytometric analysis
250µl of each of the samples were placed into sterile glass tubes as well as an unstained negative
sample. The flow cytometry analysis was performed using a C6 Flow Cytometer (Accuri®). The flow
cytometer analyses the cells as they pass through the machine in a sheath fluid through a series of
forward scatter, side scatter and photo-detectors. This quantifies the cells based on their size,
granularity and the presence of the fluorescently antibody labelled dye. The scattering of light and
intensity of the fluorescence can be quantified and presented on scatter plot histograms. Mean
Fluorescent Intensity (MFI) and the percentage of H2AX positive cells was calculated from each
sample.
2.4.3 Confocal analysis
100µl ofeach cell sample was placed on a glass slide using a cytospin at 1200rpm for five minutes. #0
thickness coverslips (0.080-0.120 microns) (Zeiss) were applied using mounting media and sealed
using clear nail varnish on each of the sample slides to avoid oxidation of the fluorescently labelled
antibodies.
The slides were read using the Zeiss LSM© 510 Meta Confocal Microscope using LSM© software
(Germany) and the images were processed with imageJ software.

50. 39
2.5 Gene expression analysis in THP-1 cells
Many different genes and proteins contribute to the initiation ofapoptosis or an inflammatory response.
These specific regulatory proteins have their expression increased or decreased according to their
gene activity. Genes that are expressed transcribe mRNAs that are subsequently translated into their
protein counterpart causing a cellular response in cells according to the molecular machinery Therefore
measuring gene expression is often the first level of measuring a molecular response. Gene
expression ofspecific apoptosis and inflammatory targets were analysed through RT-PCR. Each target
gene has specific Forward and Reverse primers (as a set) which amplify out the target gene sequence.
The primer sequences used for this projectwere designed in house and synthesised by Sigma-Aldrich.
Table 2.2 and 2.3 show the primer set sequences for Apoptotic and inflammatory gene targets
respectively. Table 2.4 shows the primer set sequences for the house-keeper reference genes.
Apoptotic Genes Forward Primer (5’-3’) Reverse Primer (3’-5’)
Bcl-2 AAGTCTGGGAATCGATCTGG AATGCATAAGGCAACGATCC
BIM TTCGACGAGCATGTTATTGG CTGATGCTGACAGTGCATCC
Caspase 9 AATGCTGTTTCGGTGAAAGG CAAGATAAGGCAGGGTGAGC
Caspase 3 GAGGCCGACTTCTTGTATGC TGTCGGCATACTGTTTCAGC
NF-κB TCTGTGTTTGTCCAGCTTCG GCTTCTGACGTTTCCTCTGC
Table 2.2: Primer sets for apoptotic genes.
Inflammatory Genes Forward Primer (5’-3’) Reverse Primer (3’-5’)
IL-6 GATGCAATAACCACCCCTGACCC CAATCTGAGGTGCCCATGCTAC
Table 2.3: Primer set for inflammatory genes.
Housekeeper Genes Forward Primer (5’-3’) Reverse Primer (3’-5’)
Actin ACTCTTCCAGCCTTCCTTCC GTTGGCGTACAGGTCTTTGC
Tubulin GCTTCTTGGTTTTCCACAGC CTCCAGCTTGGACTTCTTGC
Table 2.4: Primer sets for housekeeper genes.

51. 40
2.5.1 RNA isolation
The T25 Flasks of THP-1 cells were set up and exposed as per 2.4.1 above. After exposure the
samples were centrifuged and washed as above three times. From that point on extra care was taking
when handling the samples to avoid contamination by RNases. RNase is a ubiquitous enzyme which
can essentially chop up single stranded RNA into small fragments. Therefore throughout the RNA
extraction the following measures were taken. Gloves were worn at all times, Pipette tips; eppendorf
tubes and glassware were all treated with RNase AWAY (Molecular BioProducts) and autoclaved. All
work surfaces were pre-treated with RNase AWAY. All extractions were carried out on ice. All
eppendorf tubes were labelled accordingly and placed on ice.
After the cell washing steps cell pellets were re-suspended in 2mls of Tri-reagent (Sigma-Aldrich) and
1ml of each sample was placed into 1.5ml eppendorf tubes and stored in the freezer at -80°C.
Samples were thawed out on ice, vortexed briefly and allowed to stand at room temperature for five
minutes. 0.2ml of Chloroform (Romil) was added to each sample in the fume hood. Samples were
mixed and allowed to stand for two minutes at room temperature. Samples were placed in a centrifuge
at 12000g for 15 minutes at 4°C. This separated the sample into three phases, a lower phase of red
colour containing protein, an interphase of DNA and a colourless upper aqueous phase containing
RNA.
150µl of the upper aqueous phase was carefully pipetted out of each sample into RNase free
eppendorf tubes. 0.5ml of isopropanol (2-propanol; Sigma) was added to each sample in the fume
hood. Samples were vortexed briefly and allowed to stand at room temperature for five minutes.
Samples were placed in a centrifuge at 12000g for 10 minutes at 4°C, and this allowed a RNA pellet to
form with each sample. Supernatantwas removed by careful pipetting and the pellets were washed in
1ml 70% ethanol (Merck). Samples were placed in a centrifuge at 12000g for five minutes at 4°C. The

52. 41
supernatant was poured off into a discard jar and samples were allowed to air dry for 10 minutes. The
RNA pellets were re-suspended in 30µl of DEPC H2O.
2.5.2 RNA Quantification
Each extracted RNA sample was quantified using a Nanodrop spectrophotometer (Maestro Gen). The
Nanodrop was blanked with 2µL DEPC (Diethyl Pyrocarbonate) treated water (See 5.2.5). The
concentration of the RNA was determined by carefully placing 2µL of each RNA sample onto the
Nanodrop probe. A ratio of absorbance at different wavelengths (Absorbance 260:280) was calculated
and samples were selected based on whether the fell in between or around the permitted ratio range of
1.8 – 2.1 which indicates high quality RNA samples.
𝐴260𝑛𝑚
𝐴280𝑛𝑚
Equation 1: Ratio of absorbance between proteins and nucleic acids.
Concentration values (ng/µl) were also computed by the Nanodrop and then recorded for subsequent
cDNA synthesis.
2.5.3 cDNA synthesis
In order to synthesis complimentary deoxyribonucleic acid (cDNA) a standardised concentration of RNA
(ng/µl) was used ofeach RNA sample to reverse transcribe into cDNA using a qScript cDNA synthesis
kit (Quanta Biosciences). Samples were thawed out on ice and 0.2ml eppendorf tubes were labelled
appropriately and also placed on ice. The components ofthe qScriptcDNA kit were also placed on ice.
4μl of qScript Reaction Mix (5x concentrated solution of optimised buffer, magnesium, olig(dT) and
random primers and dNTPs (dinucleotide phosphates)), 1μl qScriptReverse Transcriptase, the volume
of RNA at the concentration of the lowest sample in a 5µl standard (made up in DEPC water) were
added to the tubes to keep the amount of RNA in each sample the same (See 5.3.3). Tubes were

53. 42
mixed gently and placed in a Thermo Cycler (Techne) which initiated the correct temperature and time
for the reverse transcription of the RNA into cDNA.
2.5.4 High-throughput Real-time PCR analysis
The synthesised cDNA served as the template for the RT-PCR reaction. Specific Primer set Master
Mixes were setup for each of the genes to be expressed (see Tables 2. 2, 2.3 and 2.4c for all the
primer sets). Each Master Mix comprised of 84µl of PCR grade H2O (DEPC treated H2O), 140µl SYBR
Green (Roche), 14µl forward primer (5’-3’) and 14µl reverse primer (3’-5’). 18µl of each corresponding
primer setmaster mix was added to a 96 well RT-PCR plate (Roche) (See Figures 5.5 and 5.6 for each
RT-PCR set up for 24 hour and 48 hour exposure). 2µl of the corresponding cDNA was added to the
plates. The plates were sealed with specific sealing foil and centrifuged at 1500rpm for two minutes at
4°C. Plates were plated in the Light Cycler 480 (Roche) RT-PCR machine for gene analysis.
2.5.5 Analysis of Gene Expression Data
The expression levels each of the target genes was measured using RT-PCR in the LC480 machine
along with the reference genes.The quantitative endpointfor real-time PCR is the threshold cycle (Ct or
Cp). The Ct is defined as the PCR cycle at which the fluorescent signal of the reporter dye crosses an
arbitrarily placed threshold. The numerical value ofthe Ct is inversely related to the amount of amplicon
in the reaction (i.e., the lower the Ct, the greater the amount of amplicon) (Livak & Schmittgen, 2001).
The LC480 determines the Ct values for each of the target genes and reference genes. From the Ct
values of the target genes and the reference genes, the 2⁻∆∆Ct value was calculated for each of the
target genes. 2⁻∆∆Ctvalue was used to compare the levels oftwo different gene expressions, one being
the untreated sample (Negative) and the other the treated sample to MD4 and MD5 (Pfaffl, 2001). This
gives the mean fold change of gene expression over a period of time (24 hour or 48 hour).

54. 43
3.0 Results
3.1 Metal based complexes
3.1.1 Viscosity results
The viscosity level of the drug samples were tested due to solubility issues. When selecting the
chemical solution to dissolve the drugs, the effects of this chemical on the cells themselves must be
taken into account. The chemical must be non-toxic to the cells to avoid firstly killing the cell population
or inducing false positives through cytotoxicity analysis. Methanol (MeOH) was selected as the
chemical to dissolve the drug complexes in. However Cisplatin historically is extremely insoluble in
MeOH. Therefore Cisplatin was made soluble in a water and low salt concentration solution. The
complexes could have been made soluble in an inorganic solvent such as DMSO but again this would
be extremely toxic to the cell population and care needs to be taken that the concentration of DMSO
used for dissolving drugs is below 2%. Due to the large Molecular Weight of MD5 it was hard to get into
solution and had to be mixed quite vigorously throughoutthe experimental protocols to ensure the drug
stayed in solution, the same for MD4. As regards the viscosity results, the higher the result in mPAS
units, the more viscous the drug solution is (insoluble). Cisplatin, MXT and MD5 had a low level of
viscosity and therefore possessed a good solubility profile (See Table 3.1). MD4 yielded a viscosity
profile of double compared to the other three compounds (See Table 3.1), which showed that it was
partially insoluble in MeOH.

55. 44
Drug mPAS
Cisplatin (H2O and 2.5% NaCl) 0.33
MXT (MeOH) 0.34
MD4 (MeOH) 0.71
MD5 (MeOH) 0.35
Table 3.1: Viscosity results of all complexes

56. 45
3.2 Cytotoxicity of Silver (I) compounds MD4 and MD5 compared to
Cisplatin and MTX controls using the MTT Assay
The IC25 (the compound concentration that inhibits the proliferation rate cancer cells by 25% as
compared to the control untreated cells) was calculated by averaging the IC25 values from each of the
three independent MTT Assays. The IC25 values were calculated over a 24 Hour and 48 Hour
exposure to the complexes. Table 3.2 below contains the results for the mean IC25 values for the
complexes over both exposure time points.
Cisplatin was less sensitive than the other three complexes, but its IC25 is reduced between the 24
hour and 48 hour time points which indicated that a prolonged exposure to cisplatin is more effective.
Similarly both the control compound MXT and the test compound MD4 have similar IC25 values, but
they do not change drastically over a prolonged exposure as seen with cisplatin, which indicated that
both MXT and MD4 were not as effective over a prolonged exposure. In contrast MD5 was the most
sensitive of the four compounds as it had the lowest IC25 values over both time points. Its IC25 vale
was reduced radically to half at the 48 hour time point which showed a similar pattern to cisplatin that it
is more effective over a prolonged period of time.
24 Hour Exposure 48 Hour Exposure
Cisplatin MXT MD4 MD5 Cisplatin MXT MD4 MD5
AVERAGE IC25
(µM) 64.72 57.74 68.69 29.8 32.05 45.28 57.9 14.94
Table 3.2: Average IC25 Values of all complexes from the 3 independent MTT assays.

57. 46
Figures 3.1 and 3.2 represent the percentage reduction in viable cells versus the increasing
concentration of drug used in the MTT assay over the 24 hour and 48 hour time points. The 100%
value is the number of viable cells in the negative (untreated) control sample.
Cisplatin over a 24 hour time point at a low concentration showed a proportional reduction in the
number of viable cells as the concentration of the drug increased. And in the 48 hour time point a low
concentration proved to significantly reduce the number of viable cells, which suggested again that
cisplatin is more effective over a longer period of time.

58. 47
Figure 3.1: Percentage reduction in viable cells with increasing concentration ofeach drug over a 24
hour exposure.
Figure 3.2: Percentage reduction in viable cells with increasing concentration ofeach drug over a 48
hour exposure.

59. 48
3.3 ƴH2AX
3.3.1 Flow Cytometery Results
Results from the flow cytometer are presented below in Figures 3.3 (24 hour exposure) and 3.4 (48
hour exposure) below; results are presented in bar chart form. Histograms (scatter plots) were
generated from the flow cytometer. Each ofthe histograms represents THP-1 cell lines exposed to the
IC25 of the corresponding drug complex in their expression (or not) of fluorescently labelled ƴH2AXfoci
representing the level of DSBs. The X axis contains the concentration of FL-1 which is the ƴH2AX foci
and the Y axis contains the concentration of FL-3 which is Popidium Iodide (PI) (Counterstain).
Figure 3.3 and 3.4 represents the Mean Fluorescence Intensity (MFI) for all samples exposed to the
IC25 value for a 24 hour period and for a 48 hour period respectively. Therefore, a high MFI value
represents an increase in the level of ƴH2AX expression in the cell population and therefore a higher
amount of DNA damage through DSBs.
Cisplatin showed a large MFI value exceeding the negative control at the 24 hour exposure and this is
consistent at the 48 hour exposure meaning that cisplatin induces DSB DNA damage initially and this
does not increase over time (plateaus). The flow cytometry histogram in Figure 3.6 compared the
expression of ƴH2AX foci presence in the Cisplatin control samples for the 24 Hour and 48 Hour
Exposure. For the 24 hour exposure the upper right quadrant was virtually full of scatter dots indicating
the presence ofthe fluorescently labelled antibody and therefore ƴH2AX foci. In the 48 hour exposure
the upper right quadrant had the presence of scatter dots however was not as severe as the 24 hour
exposure.
MXT showed relatively low values ofMFI below the negative control values for both the 24 and 48 hour
exposure. These low values compared to the histogram in Figure 3.7 verified that there were little
fluorescently labelled antibodies indicating ƴH2AX foci in the THP-1 cells exposed to MXT as both the

60. 49
upper right quadrants in the 24 hour and 48 hour exposure contain little or none scatter dots. In
comparison the upper left quadrant was heavily dotted in both exposures due to the high levels of
popidium iodide, (PI is the counter stain used in the ƴH2AX immunostaining procedure, a high
concentration of this can indicate that there is no presence of secondary antibodies) and therefore no
presence of ƴH2AX foci in THP-1 cells exposed to MXT. These results show that MXT does not
damage DNA by inducing DSB and possibly has a different biological mode of action compared to
Cisplatin.
MD4 had very little MFI in the 24 hour exposure however in the 48 hour exposure it dramatically
increased exceeding the negative control and exceeding the additional effect observed in Cisplatin at
this time point. This would suggest that MD4 is equally as effective at forming DSBs as cisplatin but it
takes longer to bind to DNA than cisplatin with the effect only evident at 48hrs and not 24hrs. The MFI
values were proportional to the histogram results in Figure 3.8, the 24 hour exposure shows a high
concentration of scatter dots in the upper left quadrant indicating presence of PI and therefore no
secondary antibody interaction and the 48 hour exposure shows a relative concentration of scatter dots
in the upper right quadrant indicating presence of ƴH2AX foci.
MD5 showed some ƴH2AXfoci with a moderate MFIvalue for the 24 hour exposure but was below the
negative control, however the MFI value for the 48 hour exposure drastically increased to >1,100,000
indicating that there is a high concentration of ƴH2AX foci present. In contrast to all other control and
test complexes this MFI value was by far the largest and was consistent with the DNA binding and
intercalating studies by Thornton., 2012 which showed that MD5 had avid DNA binding and
intercalating ability due to its additional phenanthroline groups attached to the silver molecules. The
histogram in Figure 3.9 shows a proportionate relationship between the presence of ƴH2AX foci (upper
right quadrant) and PI (upper left quadrant) this contributes to the moderate MFI value for the 24 hour
exposure. The 48 hour exposure histogram showed a population of high concentration scatter dots in

61. 50
the upper right quadrant with a low concentration of scatter dots in the upper left quadrant, thus
indicating a high concentration of ƴH2AX foci and therefore DNA damage in the THP-1 cell population.

62. Figure 3.3: Mean MFI Values for ƴH2AX Foci presence after 24 Hour exposure.
0
200000
400000
600000
800000
1000000
1200000
Negative Cisplatin MXT MD4 MD5
Delta Mean Flouresence Intensity (MFI) for FL-A (ƴH2AX) (Total MF1 minus
background unstained MF1) 24 Hour Exposure
MF1 Values

63. 52
Figure 3.4: Mean MFI Values for ƴH2AX Foci presence after 48 Hour exposure.
0
200000
400000
600000
800000
1000000
1200000
Negative Cisplatin MXT MD4 MD5
Delta Mean Flouresence Intensity (MFI) for FL-A (ƴH2AX) (Total MF1 minus
background unstained MF1) 48 Hour Exposure
MF1 Values

64. Figure 3.5: Comparison of ƴH2AX foci presence in the Negative control samples for the 24 Hour and
48 Hour Exposure.
Figure 3.6: Comparison of ƴH2AX foci presence in the Cisplatin control samples for the 24 Hour and
48 Hour Exposure.

65. 54
Figure 3.7: Comparison of ƴH2AX foci presence in the MXT control samples for the 24 Hour and 48
Hour Exposure.
Figure 3.8: Comparison of ƴH2AX foci presence in the MD4 test samples for the 24 Hour and 48 Hour
Exposure.

66. 55
Figure 3.9: Comparison of ƴH2AX foci presence in the MD5 test samples for the 24 Hour and 48 Hour
Exposure.

67. 56
3.3.2 Confocal Microscopy
Figures 3.10 and 3.11 below show Confocal microscopy images of the THP-1 cell line respectively
exposed to the novel silver(I) complexes and control complexes; Cisplatin and MXT at the IC25 values
determined from the cytotoxicity study. The images on the left of each figure represent the propidium
iodide cell counterstain which is a fluorescentintercalating molecule that binds in a non specific fashion
every 4-5 nucleotide bases. The images in the middle represent the γH2AX fluorescent green foci and
the images on the right hand side show the merged image from the left and middle. Confocal
microscopy images are a visual representation ofthe production of γH2AX fluorescentgreen foci due to
the exposure to the complexes.
Figure 3.10 below shows the confocal microscopy images for the THP-1 cell line after exposure to the
IC25 of each complex after a 24 hour period. The Negative exposure shows some positively labelled
γH2AX fluorescentgreen foci which are consistentwith the background fluorescence measured as MIF
in the flow cytometry experiments described previously. Figure 3.11 below shows the confocal
microscopy images for the THP-1 cell line after exposure to the IC25 of each complex after a 48 hour
period. Similar to the 24 hour exposure the Negative exposure shows presence of γH2AX fluorescent
green foci. Again this could be due to the experimental procedure inducing DNA damage, cellular
debris or gamma rays in the environment.
The cisplatin control shows a large amount of γH2AX fluorescent green foci amongst the THP-1 cell
population. This coincides with flow cytometery results (see Figure 3.3 above) that cisplatin is inducing
DNA damages through DSBs in the cell population. This result is a benchmark for a positive control to
compare the novel silver(I) complexes to. The confocal microscopy image for cisplatin showed
presence of γH2AXfluorescent green foci in cisplatin exposed cells, however a large number of cells
were lost through the experimental procedure. The image present is of a single THP-1 cell which is

68. 57
γH2AX positive. Results are indicative ofthe previous flow cytometery analysis that cisplatin expressed
a high level of γH2AX (see Figure 3.4).
The MXT control shows no presence ofγH2AXfluorescent green foci. This result was expected as the
flow cytometer results as per Figure 3.3 also showed little γH2AX fluorescentgreen foci presence. This
results is therefore a potential benchmark for a negative control to compare the novel silver(I)
complexes to. And suggested that MXT is resistant to the production of γH2AX and therefore is
undergoing another mechanism of cytotoxic ability. Similar to the confocal microscopy images for the
24 hour exposure (See Figure 3.10) and the flow cytometery results (See Figure 3.4) the MXT has
shown no production of any γH2AX. This again coincides with the 24 hour exposure and interlinks with
the flow cytometery that MXT has another mode of cytotoxic action and not the ability to produce
γH2AX.
Similarly to results derived from the flow cytometer in Figure 3.3 MD4 shows no γH2AX fluorescent
green foci. Similar to the cisplatin exposure the MD4 exposure had a low number of cells presence for
confocal microscopy analysis, due to loss in the experimental procedure. However results based on a
single THP-1 cell indicate γH2AX which in turn is indicative of the flow Cytometery results previous in
that over a 48 hour period the presence of γH2AX foci is greatly increased compared to the 24 hour
exposure.
MD5 showed a significant amount of γH2AX fluorescent green foci, which indicate DNA damage
through DSBs. This coincides with results from the flow cytometer (see Figures 3.3 and 3.9) as they
both show a high concentration of γH2AX fluorescent green foci. The confocal microscopy images for
MD5 after the 48 hour exposure show a relatively high amount of γH2AX foci. This coincides with the
flow cytometery results (See Figure 3.4) where the γH2AX foci amount was the largest seen in all

69. 58
complexes. Both results suggested that MD5 is extremely genotoxic, even more than the clinically
available control cisplatin.

70. 59
Figure: 3.10: Confocal Microscopy Images for all complexes after 24 Hour Exposure.
Figure3.11: Confocal Microscopy Images for all complexes after 48 Hour Exposure.
Propidium
Iodide ƴH2AX Merging
MD5
MD4
MXT
Cisplatin
Negative

71. 60

72. 61
3.4 Gene Expression
3.4.1 RNA Quantification of cell extracts exposed to average IC25
Table 3.3 below contains the relative quantitative results for the extracted RNA from cells exposed to
the complexes. The absorbance of light at 260nm was used to identify the concentration of RNA in a
sample and the absorbance at280nm was used to identify protein concentration in a sample. Ideally for
RNA quantification the ratio of these two values (A260/A280) should be 1.8-2.1 to indicate high purity
RNA samples.
The ratio obtained after isolation of RNA from the THP-1 cells was between 0.856 and 1.662, this does
not fall between the ideal ratio of 1.8-2.1 however the results were deemed acceptable for subsequent
studies (due to time constraints). The ability to obtain pure RNA samples appeared to be greatly
reduced due to the cellular debris present from the complexes (due to partial insolubility properties).
Table 3.3: RNA Quantification results.
From Table 3.3 the lowest concentration of RNA 90.52ng/µl was set as the benchmark concentration
for cDNA synthesis. A concentration of 90.52ng/µl was thus needed in a 5µl volume for the cDNA
synthesis. See Table 3.4 below for calculations of the volume of RNA needed to achieve the
benchmark concentration of RNA.
Sample A260 A280 A260/A280 ng/µl Sample A260 A280 A260/A280 ng/µl
Negative 3.115 3.293 0.946 124.6 Negative 14.247 15.599 0.913 569.87
Cisplatin 6.202 6.294 0.985 248.09 Cisplatin 4.642 4.939 0.94 185.67
MXT 4.204 3.149 1.335 168.18 MXT 5.737 3.512 1.634 229.48
MD4 4.509 2.713 1.662 180.36 MD4 2.458 2.871 0.856 98.3
MD5 6.479 8.03 0.807 259.17 MD5 2.263 1.561 1.45 90.52
48 Hour24 Hour

73. 62
24 Hour 48 Hour
Volume of RNA
(µl)
Volume of DepCH₂O
(µl)
Volume of RNA
(µl)
Volume of DepCH₂O
(µl)
3.63 1.37 0.79 4.21
0.55 4.45 2.44 2.56
2.69 2.31 1.97 3.03
2.51 2.49 4.60 0.40
1.75 3.25 5.00 0.00
Table 3.4: Volume required ofeach RNA sample to make a 90.52ng/µl concentration in a 5µl solution.

74. 63
3.4.2 RT-PCR analysis ofapoptotic gene expressionin THP-1 cells exposed to the
complexes at 24 and/or 48 hour exposures
Bcl-2 plays a vital role in determining whether or not a cell should undergo apoptosis or not. The
expression ofBcl-2 is increased both the control and test samples. Perhaps indicating either the pro- or
anti-apoptotic function of Bcl-2 (See Table 5.3.3f for gene analysis raw data). This Result was
significant as Bcl-2 is an essential protein needed for apoptosis and an increased expression of this
along with pro-apoptotic genes such as Bim indicate the initiation of apoptosis.
Figure 3.12: Bcl-2 gene expression in cells exposed to the IC25 of each complex after a 48 hour
exposure.

75. 64
Bim
As previously discussed Bim is a pro-apoptotic protein which acts on Bcl-2 to inhibit its anti-apoptotic
functions. An increase in gene expression to compared to that of the negative control is seen in
Cisplatin, MXT and MD5. More so in Cisplatin which is expected due to previous cytotoxic analysis.
Interestingly there is no increase ofthe gene in MD4 exposure. MXTalso upregulates the expression of
Bim indicating that it is involved in initiating apoptosis, in contrast to ƴH2AX analysis it was not shown
to induce any DNA damage, therefore MXT is initiating apoptosis through another mechanism of
cytoxicity. See Table 5.11 for gene analysis raw data. Bim gene expression is increased in both the
MD4 and MD5 samples over the 48 hour period. The increased expression after a 48 hour period is in
contrast to no expression after a 24 hour period (See Table 5.17 for gene analysis raw data). These
findings were significant as Bim is a pro-apoptotic marker and indicated that the cells are signalling for
apoptosis over a longer period oftime when exposed to both MD4 and MD5. And signalling apo ptosis
in a shorter period of time in MD5.

76. 65
Figure 3.13: Bim gene expression in cells exposed to the IC25 of each complex after a 24 hour
exposure.
Figure 3.14: Bim gene expression in cells exposed to the IC25 of each complex after a 48 hour
exposure.

77. 66
Caspase 9
As previously stated Caspase 9 plays a key role in the initiation of the intrinsic pathway of apoptosis
(Initiator Caspase), once activated it forms the apoptosome which in turn activates effector caspase 3.
An increase in caspase 9 gene expression would be suggestive of the initiation of Apoptosis. As
expected cisplatin has increased gene expression of caspase 9 due to the elicit DNA damage it was
causing to the THP-1 cells. In contrast MD5 shows minimal gene expression of caspase 9, which
indicated that there is a pro-apoptotic response over a shortexposure to MD5 and MD4 did notexpress
the gene. See Table 5.12 for gene analysis raw data.
Figure 3.15: Caspase 9 gene expression in cells exposed to the IC25 of each complex after a 24 hour
exposure.

78. 67
Caspase 3
Caspase 3 is the main executioner caspase; it induces the cellular damage associated with apoptosis
once activated. Problematically the caspase 3 gene was notexpressed in any ofthe sample complexes
including the negative control. This could be down to the primer set not amplifying out the target gene.
See Table 5.13 for gene analysis raw data.

79. 68
3.4.3 RT-PCR analysis ofinflammatory gene expressionin THP-1 cells exposed to
the complexes at 24 and/or 48 hour exposures
NF-κB
NF-κB has the ability to induce an inflammatory response once activated and also increase the
expression of anti-apoptotic genes. It is expressed greatly in the cisplatin control perhaps initiating an
inflammatory response to the damage caused by the drug itself. The gene was not expressed in both
the MD4 and MD5 samples. See Table 5.14 for gene analysis raw data. This indicated that over a short
exposure MD4 and MD5 do not initiate an inflammatory response over a short period of exposure.
Figure 3.16: NF-κB gene expression in cells exposed to the IC25 of each complex after a 24 hour
exposure.

80. 69
IL-6
IL-6 plays a vital role as a signal transducer in an innate inflammatory response. The expression of IL-6
is marginally increased in the cells exposed to MD4; perhaps indicating that MD4 WAS inducing an
inflammatory response over a short period of time. See Table 5.15 for gene analysis raw data.
Figure 3.17: IL-6 gene expression in cells exposed to the IC25 of each complex after a 48 hour
exposure.