Ce diaporama a bien été signalé.
Nous utilisons votre profil LinkedIn et vos données d’activité pour vous proposer des publicités personnalisées et pertinentes. Vous pouvez changer vos préférences de publicités à tout moment.

Recombinant Expression and Purification of Aedes aegypti Midgut Serine Protease VII (AaSPVII)

The Aedes aegypti mosquito is a major vector of blood-borne pathogens, such as the Dengue, Chikungunya, yellow fever, and Zika viruses. This poster discusses the recombinant expression and purification of a late-phase trypsin- like protease, Aedes aegypti serine protease VII (AaSPVII).

  • Identifiez-vous pour voir les commentaires

  • Soyez le premier à aimer ceci

Recombinant Expression and Purification of Aedes aegypti Midgut Serine Protease VII (AaSPVII)

  1. 1. RESEARCH POSTER PRESENTATION DESIGN © 2012 www.PosterPresentations.com Between the years of 2010 and 2014, there were approximately 1 to 2 million incidences of Dengue fever in the Latin Americas [1]. The transmission and subsequent outbreak of this disease is attributable to the Aedes aegypti mosquito—a major vector of blood-borne pathogens (BBPs) such as the Dengue virus, along with the Chikungunya, yellow fever, and Zika viruses [1, 2]. The Ae. aegypti mosquito is an urban vector that thrives near populations of people. Blood meals acquired from vertebrate hosts in these urban areas provide nutrients for female Ae. aegypti to complete the gonotrophic cycle and oviposition [3]. This opportune habitation enables populations of Ae. aegypti to reproduce uncontrollably and encourages the infection of nearby vertebrate populations [1, 2]. Accordingly, controlling the reproduction mechanism of the vector population could be useful in impeding the spread of pathogens associated with this vector. Our approach examines the structures and biochemical functions of the Ae. aegypti midgut serine proteases involved in blood meal digestion. By understanding these mechanisms, we can potentially develop small-molecule inhibitors and disrupt vector reproduction. The Aedes aegypti mosquito is a major vector of blood-borne pathogens, such as the Dengue, Chikungunya, yellow fever, and Zika viruses. A female mosquito will often take several blood meals in a single night to complete the gonotrophic cycle, effectively spreading any blood-borne pathogens it may be infected with. Potentially useful in streamlining vector control strategies, our approach examines the structures and functions of Ae. aegypti midgut serine proteases involved in blood meal digestion. This poster discusses the recombinant expression and purification of a late-phase trypsin- like protease, Aedes aegypti serine protease VII (AaSPVII). Previous studies were unable to purify AaSPVII with an N-terminal His6-tag because AaSPVII was found to be autocatalytic, often cleaving the His6-tag upon recombinant bacterial protein expression. In this study, AaSPVII was, instead, cloned with a C-terminal His6-tag allowing for successful purification of the protein. In addition, we investigated chemical environments that appear to minimize the auto-degradation of AaSPVII upon purification. So far, we have been able to solubly express the C-terminally His6-tagged AaSPVII protease and have been able to partially purify it using a nickel column. BApNA assays of the enzyme show some enzyme activity. From here, we will further purify AaSPVII, conduct kinetic experiments, and compare our results with previous findings. ABSTRACT INTRODUCTION Primers were designed with NdeI and XhoI restriction sites so that AaSPVII can be cloned into pET29b plasmid directly adjacent to the C-terminal His6-tag (Figure 2). A poly(A) tail was included in each primer to prevent degradation. In the reverse primer, the stop codon was omitted because it is already present in pET29b downstream of the His6-tag (Figure 3). RECOMBINANT CLONING AaSPVII plasmids were transformed into Shuffle® T7 Express Competent E. coli (New England Biolabs, Cat #C3029H), suitable for T7 promoter-driven plasmids such as pET29b. These E. coli B cells are engineered to help with protein folding by forming disulfide bonds within the expressed polypeptide in the cytoplasm. The transformed cells were grown at 30 °C in Terrific Broth (ThermoFisher Scientific, cat #BP2468-2). During the logarithmic stage of growth (estimated by OD600 = 0.5–0.8), protein expression was induced with isopropyl-β-D-1-thiogalactopyranoside (IPTG), an analog of allolactose, utilizing the lac operon present in pET29b to express the inserted gene. Protein expression was sustained for 44 hours at 12 °C, stopping before AaSPVII begins to auto- catalyze. Cell paste was flash-frozen with liquid nitrogen and stored at -80 °C. PROTEIN EXPRESSION FUTURE WORK Other purification conditions that could potentially inhibit auto-digestion (i.e. pH, temperature) will be explored. Ion-affinity chromatography may be used to further purify partially-purified AaSPVII / pET29b based on its isoelectric point. Upon fully purifyingAaSPVII, crystallization will help us identify its structure, and substrate binding assays will allow us to further characterize its enzymatic capability. ACKNOWLEDGEMENTS We would like to thank Dr. Jun Isoe and Dr. Roger L. Miesfeld (University of Arizona) for providing Ae. aegypti cDNA, the AaSPVII group from Chem131B (San José State University) for their initial work on the removal of the leader sequence, and James Nguyen (San Jose State University) for his initial work on the recombinant cloning and expression of AaSPVII with an N-terminal His6-tag. This work is funded by the NIGMS/NIH SC3 underAward Number SC3GM116681. REFERENCES 1. Fernández-Salas I, et al. Historical Inability to Control Aedes aegypti as a Main Contributorof Fast Dispersal of Chikungunya Outbreaks in Latin America. Antiviral Research 2015; 124: 30-42. 2. Calvez E, et al. Genetic Diversity and Phylogeny of Aedes aegypti, the Main Arbovirus Vector in the Pacific. PLoS Neglected Tropical Diseases 2016; 10: e0004374. 3. Isoe J, et al. Molecular Genetic Analysis of Midgut Serine Proteases in Aedes aegypti Mosquitoes. Insect Biochemistry and Molecular Biology 2009; 39: 903-912. San José State University, 1 Washington Square, San José, CA 95112 Kamille A. Parungao and Alberto A. Rascón, Jr. Recombinant Expression and Purification of Aedes aegypti Midgut Serine Protease VII (AaSPVII) PROTEIN PURIFICATION Crude AaSPVII was purified using a HisTrap FF nickel column (GE Healthcare Life Sciences, cat #17-5255-01). Dithiothreitol (DTT), a reducing agent, was added to the imidazole buffers to partially unfold the protein by disrupting disulfide bonds. AaSPVII / pET29b SHuffle® T7 cell paste was resuspended in cold, buffer containing 10 mM imidazole + 250 mM NaCl + 20 mM Tris-HCl pH 7.2 + 10 mM DTT. The resuspension was sonicated and centrifuged at 8 °C. The supernatant (crude lysate) was loaded on to the AKTA FPLC and purified starting with the low-imidazole buffer (same as resuspension buffer) and eluting using a linear gradient of high-imidazole buffer (500 mM imidazole + 250 mM NaCl, 20 mM Tris-HCl pH 7.2 + 10 mM DTT). Purified fractions were collected in a 1.5 mL 96-well plate. The fractions containing AaSPVII-Z / pET29b were pooled and buffer-exchange via dialysis in 50 mM sodium acetate pH 5.2 + 1 mM DTT at 4C. From CDC: Surveillance and Control of Aedes aegypti and Aedes albopictus in the United States From Shanghai Jiao Tong University School of Medicine: Pathogen Biology FIGURE 1: Oocyte maturation in female Aedes aegypti that were fed with various concentrations of blood [3]. Blood meals are necessary in the completionof the gonotrophic cycle and the development of healthy oocytes. Sequence (5’ – 3’) Melting Temperature (Tm) [°C] Forward Primer AAAAACATATGCTATCAACCGGATTCCATCCGC 65.4 Reverse Primer AAAAACTCGAGAACTCCACTGACTTCGGCCACC 65.04 FIGURE 2: Primers used in AaSPVII PCR amplificationintothe pET29b vector. The resultingAaSPVII insert is 760 bp long. Meltingtemperature was obtained using NetPrimer. FIGURE 3: pET29b plasmidcloning region (Novagen, cat #69872) showing restrictionsites NdeI and XhoI (blue) and the His6-tag(green) directlyat the C-terminus of the AaSPVII insert.A C-terminal His6-tagcould help with the partial purificationof AaSPVII, as autocatalysis has been observed inAaSPVII expressed with an N-terminal His6-tag,losing the tag before purification. FIGURE 4 (left): SDS-PAGE of AaSPVII / pET29b total (purple) and soluble (teal) samples expressed at 12 °C in Luria Broth. Time in hours.Autocatalysis is observed at T = 44. Intact AaSPVII / pET29b: 27.64 kDa FIGURE 5 (right): SDS-PAGE of AaSPVII / pET29b total (purple) and soluble (teal) samples expressed at 12 °C in Terrific Broth. Time in hours. To further minimize auto-digestion, additional AaSPVII / pET29b SHuffle® T7 cell paste purified with the same protocol, except that the imidazole buffers contained 5 mM DTT and 25 µL of 3 M sodium acetate pH 5.2 was added to the wells of the 96-well plate prior to fractionation (see below). FIGURE 6: (top) SDS- PAGE of AaSPVII / pET29b Ni2+ purified fractions. (bottom) SDS- PAGE of post- dialysis AaSPVII / pET29b in increasing volumes (µL) of purified protein. Auto-digestion occurred, but there was still a significant amount of intact AaSPVII / pET29b. FIGURE 7: (left) SDS-PAGE of AaSPVII / pET29b Ni2+purified fractions collectedin 50 mM sodium acetate pH 5.2. (right) SDS-PAGE of post-dialysis AaSPVII / pET29b in increasingvolumes (µL) of purified protein. The 20 µL sample was so concentrated that it could not clearly travel through the NuPAGE Novex 4-12% Bis-Tris ProteinGel (ThermoFisher Scientific,cat #NP0321BOX). Auto-digestion still occurred.

×