1. Designing a Switch to Control and Track Gene
Expression In Bacteria
Reina Betancourt1,2, Travis Wiles2 Ph.D and Karen Guillemin2 Ph.D 1. Georgia Institute of Technology, Atlanta, Ga 2. University of Oregon, Eugene, Or
Coordinated expression of genes allows bacterial pathogens to develop and quickly
respond to and survive host immune responses1. Of particular interest would be
elucidating the mechanisms by which complex bacterial communities that comprise
host associated microbiota develop in the face of volatile fluctuations in
environmental conditions.
Question: How do gene expression patterns control the development of microbiota?
Hypothesis: Bacterial members of the normal zebrafish gut microbiota require
coordinated gene expression for community development and function within the
host.
Approach: We set out to explore how expression patterns for genes that control
motility and chemotaxis influence bacterial behaviors of swimming and biofilm
formation. In order to realize our experiment we needed a way to vary gene
expression as bacteria progressed through the three major growth phases. To this
end we set out to engineer a genetic device that would allow us to conditionally
control and track gene expression.
Abstract
The next step will be inserting genes of interest into the synthetic construct, pRB3,
transforming it into natural isolates of the zebrafish microbiota and observing the effects
of gene expression on bacterial behavior. The switch could potentially be a key tool in
future experiments centered around the identification and characterization of genetically
encoded behaviors.
Inspiration
Design
The naturally occurring tet repressor system negatively controls tetracycline (tc)
resistance.
In the presence of tc the constitutively produced TetR protein is inhibited and detaches
from its cognate DNA sequence allowing the expression of tetA which codes for a tc
antiporter (efflux pump)2.
Engineering Scheme
Construction of the Switch
Future Directions
Our design uses an analog of tc, aTc, a similarly powerful inducer molecule without
antibiotic properties.
The construct will allow for the tracking of gene expression using co-transcribed genes
that code for fluorescent proteins.
The backbone of the vector codes for ampicillin resistance, which allows for selective
growth of bacteria containing the plasmid.
1. Starting Vector
2. Insert
3. Repression
4. Gene of Interest
Constitutive expression of dTomato (dTom) yields red only bacteria.
The AvrII and SacI restriction sites were used to insert a tet-inducible
element containing sfGFP. At this stage bacteria express both red
and green protein.
The NotI and SalI restriction sites were used to insert the tetR gene.
The PLtetO promoter is repressed which results in red only bacteria
unless induced with aTc to yield bacteria that are both red and green.
A single colony grown
with the starting vector
1. Starting Vector (pTW92)
The multiple cloning site allows for genes of interest to be inserted
into to the construct. The gene can then be conditionally expressed
and tracked in vivo.
2. Insert (pRB1)
A single colony grown
with stage 2 plasmid.
A single colony grown
with stage 3 plasmid.
Same as above with
dTom image at 4X the
intensity.
The pRB2 construct was sequenced confirmed, but demonstrated very dim expression of
dTom.
The only clones that were functionally correct were those that had a mutated tetR gene.
In a functional test, aTc was added to
a small disc of Whatman filter paper
that was placed on a plate of E. coli
containing the pRB2 construct and no
induction of sfGFP was observed.
Optimizing Repression
Ribosome Binding Site Sequence Logo for
tetR in E. coli
In order to obtain a mutation free, functionally correct pRB2 construct, tetR expression
was dampened by changing the base sequence at its ribosome binding site (RBS). This
change in base pairs works at a translational level by modulating ribosomal affinity to
tetR’s ribosome binding site.
Naturally occurring tetR
used in pRB2
tetR library with randomized
RBS. N=A/G/C/T, R=A/G,
D=A/G/T
Functional clone (pRB3).
TTAGGAATTAATGATGTCTAGATTAGAT
TCTAGGTATTACATCATGTCTAGATTAG
TNDRRDNATTACATCATGTCTAGATTAG
RBS
Acknowledgements
References
3. Repression (pRB3)
A single colony grown with
stage 3 plasmid.
The pRB3 construct demonstrated noticeably higher expression of the dTom gene.
1. Miller, J. F., Mekalanos, J. J., & Falkow, S. (1989). Coordinate regulation and sensory transduction in the
control of bacterial virulence. Science, 243(4893), 916.
2. Bertram R, Hillen W. The application of Tet repressor in prokaryotic gene regulation and expression.
Microbial Biotechnology. 2008;1:2–16.
Conclusion: Over expression of TetR from the strong Ptac promoter might result in
inappropriately high levels of TetR, thus explaining lack of induction and off target
repression of dTom.
Thank you to everyone in the Guillemin lab, my mentor Travis Wiles. Peter O’Day, Marilyn Drennan, all of the
SPUR interns, and everyone else involved in SPUR. Thank you to the National Science foundation Research
Experience for Undergraduates Site Program in Molecular Biosciences at the University of Oregon (NSF
DBI/BIO 1460735) and the National Institute of Diabetes and Digestive and Kidney Diseases (Grant
#1R01DK101314) for funding this project.
In a functional test, pRB3
showed visible induction of
GFP with the addition of aTc.
Result: Successful construction of an aTc inducible switch using modified synthetic
transcriptional elements and translationally optimized modulation of gene expression.
4. Gene of Interest3. Repression (pRB2)
sfGFP dTom Merged
sfGFP dTom Merged
sfGFP dTom Merged
sfGFP dTom (4X) Merged
sfGFP dTom Merged
sfGFP dTom Merged
sfGFP dTom Merged
Notes de l'éditeur
Get grant numbers, connect the project more to the hypothesis.