3. Fig.1. A typical Actinomycetes colony growing on agar
•Gram positive, aerobic, filamentous, high G+C content (Williams et al.1989;
Manfio et al. 1995).
4. Habitat Actinomycetes Reference
Salt lake Streptomonospor amylolytica,
Streptomonospora flavalba
Cai et al.,2009
Marine
(pacific ocean)
Micromonospora, Rhodococcus, Streptomyces Maldonado et al.,2004
Tropical rain forest Streptosporangium, Nocardia, Micromonospora,
Streptomyces, Actinomadura,
Wang et al.,1999
Stream Streptomyces,Micromonospora,
Actinomadura, Pseudonocardia
Das et al.,2006
Marine sediment Salinispora tropica,Salinispora arenicola Jensen et al.,2006
Antarctica soil Streptomyces, Actinomycetales Moncheva et al.,2002
Mangrove soil Micromonospora, Streptomyces. Hong et al., 2009
Forest soil Micromonospora,Microbisporium,Actinosporium,
Streptosporangium
Seong et al.,2001
5. Habitat Actinomycetes Reference
Volcanic soil Streptomyces,Streptosporangium,Actinomadura Zenova et al.,2009
Fresh water Saccharopolyspora,Actinosynnema Sibanda et al.,2010
Agricultural soil Actinoallomurus,Actinopolyspora,Micromonospora Khanna et al.,2011
Mangrove ecosystem Actinomycetes Fredimose et al.,2011
Theobroma cacao Streptomyces Barreto et al., 2008
Lycopersicon esculentum
(tomato)
Streptomyces species,Streptoverticillium,
Nocardia
Cao et al.,2004
Pea (Pisum sativum) Streptomyces lydicus Tokala et al.,2002
Wheat Streptomyces Juhnke et al., 1987
Cotton S. purpureus, S. aurantiacus, S. microflavus. Hassanin et al., 2007
6. Plant Rhizosphere Actinomycetes Reference
Medicinal plant Streptomyces,Actinomadura sp.,
Microbispora sp., Micromonospora sp.,
Nocardia sp,Nonomurea sp
Khamna et al., 2009
Mahuva (Madhuca induca),
Karaj(Pongamia globra)
Streptomyces sp. Thangapandian et al.,
2007
Maize (Zea mays) Actinomycetes Miller et al., 1989
Rice (Oryza sativa L.) Mycobacterium,Streptomyces,
Micromonospora,Actinoplanes,Frankia,
Tian et al.,2007
Theobroma cacao Streptomyces Barreto et al., 2008
Lycopersicon esculentum
(tomato)
Streptomyces species,Streptoverticillium,
Nocardia
Cao et al.,2004
Wheat Streptomyces Juhnke et al., 1987
Cotton S. purpureus, S. aurantiacus, S. microflavus. Hassanin et al., 2007
7. Rhizospheric
Actinomycetes
IAA Siderophore Phosphate
Solubilization
Reference
Streptomyces viridis + + + Khamna et al., 2010,
Gangwar et al., 2012.
Nocardia + + + Gangwar et al., 2012
Micromonospora + + + Gangwar et al., 2012
Saccharopolyspora + + + Gangwar et al., 2012
Actinopolyspora + + + Gangwar et al., 2012
Streptomyces rochei
IDWR19,
Streptomyces
carpinensis IDWR53,
Streptomyces
thermolilacinus IDWR81
+ + + Jog et al., 2012
8. Fig.2. Mechanisms of P solubilization (Khan et al., 2010)
Mechanisms of P solubilization
12. • In previous studies, significantly high P-solubilizing
actinomycete isolates from cotton rhizosphere were obtained.
• The isolate (CR-16) over produced malate (as confirmed on TLC
using malate standard) in minimal medium supplemented with
100 mM glucose. However, when grown on lower glucose
concentration (50 mM), acid production was not observed.
• Literature lacks determined pathway for malate over
production in actinomycetes
• Majority of actinomycetes are reported to follow glycolytic
pathway for glucose metabolism . Glyoxylate shunt has also been
reported in Streptomyces spp. (Han and Reynolds,1997).
13. Fig.3. Phosphate solubilization on Tris buffered
(50 mM) (pH- 8.0)Tricalcium Phosphate (TCP) Agar
supplemented with 100 mM glucose by CR-16 isolate
16. Confirmation of MPS phenotype of CR-16 and EC-11 in presence of rhizospheric carbon
sources.
Elucidation of hypothesized pathway for malate over production in phosphate
solubilising CR-16 isolate.
Enzyme assays (Isocitrate lyase, Isocitrate dehydrogenase and Malate synthase).
Gene expression (Isocitrate lyase, Isocitrate dehydrogenase and Malate synthase)
study by reverse transcriptase PCR (RT-PCR)
Confirmation of gene expression by Real-time PCR (q-PCR)
In vivo studies for beneficial effect of isolates on chick pea plants.
Pot experiment
Hydroponic studies
▪ Rock phosphate containing MS medium
▪ Coinoculation with commercially available biofertilizer (V Green)
▪ Biocontrol trait (chitinase production)
▪ Organic phosphorous utilization (phytase production)
▪ Potassium solubilization (Mica sol.)
▪ Halotolerance of isolates
18. Selection of cultures to determine malate production pathway
• Test culture: Phosphate solubilizing actinomycete isolate (CR-
16) showing over production of malic acid.
• Control: Phosphate solubilizing actinomycete isolate (EC-11)
lacking malic acid over production served as a control.
19. Revival of cultures:
Organic acid production:
Minimal medium supplemented with 2% glucose was
inoculated with CR-16 and incubated at 30oC for 7
days.
Cells were centrifuged at 10,000 rpm for 10 min
Qualitative and quantitative organic acid profile of cell free
supernatant by HPLC analysis (CSMCRI, Bhavnagar) using
Supelcogel organic acid specific column (Sigma Aldirch)
CR-16 and EC-11
obtained in previous
studies were maintained
on ISP-3 and preserved as
20% glycerol stock
Minimal medium
(Vellore, 2001) with
glucose unless mentioned
otherwise
Incubated at 30 ◦C for 7
days under static/shaking
condition
21. CR-16 and EC-11
inoculated in minimal
medium containing 1%
sugar and incubated at
30 oC for 10 days
pH of cell free
supernatant was
measured and growth
was visually observed
Phosphate estimation
by phosphomolybdate
method (Ames, 1964)
22. Gene Expression studies and Enzyme
Assays of enzymes involved in
malate over production
Isocitrate dehydrogenase
Isocitrate lyase
Malate synthase
Objective 2:
23. Cells grown in
minimal medium
with 50 mM and
100 mM glucose
seperately.
Incubated at 30 oC
under shaking for
7 days
Cells were
subjected to freeze
thaw and
lysozyme
treatment for 1 h
at 37 oC
Cells were then
resuspended in 0.1
M phosphate
buffer (pH-
6.8)(Ball and
McCarthy, 1988)
Cells were lysed by
ultra sonication for
10 sec five times
with 1.5 min
interval at 700 W
Clear cell lysate
obtained after
centrifugation at
8000 rpm for 10
min was used as
enzyme source
24. Enzyme Assays:
Isocitrate Dehydrogenase:
•Isocitrate dehydrogenase (IDH) was determined by continuous
spectrophotometric rate determination depending on reduction of β-NADP
( Nicotinamide Adenine Dinuleotide Phosphate ) at 340 nm.
•The IDH activity was measured by decrease in the absorption of β-NADP at 340
nm. One unit IDH converts 1µmole of isocitrate to α-ketoglutarate per minute at
pH 7.4 at 370 C (Bergmeyer, 1974).
25. Enzyme Assays:
Isocitrate Lyase:
• Isocitrate lyase (ICL) was determined by continuous spectrophotometric rate
determination depending on formation of phenylhydrazine glyoxylate and
measuring absorption at 324 nm.
•The ICL activity was measured by decrease in absorption of phenylhydrazine
glyoxylate at 324 nm. One unit ICL forms 1µmole of glyoxylate per minute at pH
6.8 at 300 C( Chell et al,1978).
26. Enzyme Assays:
Malate Synthase:
•Malate synthase (MS) was determined by continuous spectrophotometric rate
determination depending on reduction of 5,5’- Dithio bis 2- Nitrobenzoic acid
(DTNB) to 5- Thio, 2- Nitrobenzoic acid (TNB) at 412 nm.
•The MS activity was measured by decrease in absorption of DTNB at 412 nm.
One unit MS cleaves 1 µmole of acetyl CoA per minute at pH 8.0 at 300C in
presence of glyoxylate (Silverstein, 1975).
27. Primer designing
RNA isolation
Reverse Transcriptase PCR (RT-PCR)
Data analysis
28. Primer synthesis
using Integrated DNA
Technology (IDT)
Primer pairs fulfilling all criteria
for primer selection were
selected
The primers were confirmed by
Insilico PCR
Primers were
reconfirmed by
primer BLAST
Gene sequence of enzymes:
Isocitrate dehydrogenase,
Isocitrate lyase, Malate
synthase of Streptomyces spp.
from NCBI
Contig sequence from
sequences of the same
gene using codon aligner
Coding sequence of the
gene using ORF Finder
29.
30.
31.
32. Growth
Actinomycetes
in minimal
medium,
30 oC, 4-5 days
Cell Lysis
GTE solution,
freeze thaw
bead beating,
lysozyme
SDS-EDTA
prolonged
incubation at
65 oC
Cell lysate
Proceeded
with High pure
RNA isolation
kit (Roche)
Steps
Silica Binding,
DNase
treatment,
Washing,
Elution
RNA yield
confirmed on
1.5% agarose
gel and
quantified at
260 nm
Equal concentration
of RNA (4 μg) was
used for gene
amplification of
IDH, ICL and MS
genes. DNA gyrase
gene was used as an
internal control
33. Reagents Volume
2x 1 step buffer (Reaction buffer,
dNTP mixture, One step enhancer
solution)
12.5 μl
Prime Script 1 step enzyme mix
(PrimeScript RTase, DNA Polymerase- Ex
Taq HS, RNase Inhibitor)
1 μl
Forward Primer 100 mmole
Reverse Primer 100 mmole
Template RNA 4 μg
Sterile Milli Q Make up volume upto 25 μl
Total Volume 25 μl
Specific for genes
36. RT-PCR products were resolved on 1.5 % and 1.2 % agarose
gel respectively and viewed under gel documentation system.
The data was analyzed TotalLab quant (Ver. 10) as follows:
Detection of lanes, annotation of wells, band
detection, removal of background signals
Different parameters of the bands were analyzed
including area of band in pixels(for DNA
concentration) and peak height (for purity)
Graph for area (in pixels) of each
band was plotted
38. Reagents Volume
SYBR Premix Ex Taq II (2X) 25 µl
Forward Primer (10 µM) 2 µl
Reverse Primer (10 µM) 2 µl
ROX Reference Dye (50X) 1 µl
c-DNA template 100 ng
sterile milliQ water Make upto 50 µl
Final Volume 50 µl
specific for genes
39. Process Temperature Time
Initial denaturation 95 oC 30 sec
PCR (40 CYCLES) 95 oC 5 sec
60 oC 30 sec
Dissociation stage As recommended for ABI
Real-time StepOnePLus
PCR system
Prefixed
40. Data were analysed in StepOne software (ver. 2.2.2), Applied BioSystems Life
Technologies.
DNA gyrase was used as an internal control.
ΔCT values were calculated for each sample. Accordingly, RQ values were determined.
Graphs were plotted with RQ values for each samples.
41. In vivo study for beneficial effects of
CR-16 and EC-11 inoculation on Cicer
arietinum (chick pea) growth and
development
Objective 3:
42. Chick pea seeds
surface sterilized by
0.1% HgCl2 and 70%
ethanol
Washed many times
with sterile distilled
water and rolled over
N-agar plate for
validation
Seeds germinated on 1%
water agar plate were
bacterized in dense spore
suspension of each
isolate separately
(107-108/ml) for 1 h
Seeds were sown in sterile
soil in equal sized pits and
grown at room
temperature using
standard light-dark cycle
After Incubation for 40
days, different plant
parameters were
measured.
Uninoculated plants
served as control
43. Chick pea seeds
surface sterilized by
0.1% HgCl2 and 70%
ethanol
Washed many times
with sterile distilled
water and rolled over
N-agar plate for
confirmation of
sterilization
Seeds germinated on
1% water agar plate
Germinated seeds
were placed in sterile
partial MS medium
inoculated with CR-16
and EC-11
Plants were incubated
in Plant Growth
Chamber at 28oC and
35% relative humidity
(Rh)
After 14 days of
incubation different
plant parameters
were measured
44. Chick pea seeds
surface sterilized
by 0.1% HgCl2 and
70% ethanol
Washed many times
with sterile distilled
water and rolled over
N-agar plate for
confirmation of
sterilization
Seeds germinated
on 1% water agar
plate
Germinated seeds were
placed in sterile free
phosphate deprived MS
medium containing rock
phosphate and
inoculated with CR-16
and EC-11
Plants were
incubated in Plant
Growth Chamber
at 28oC and 35%
relative humidity
(Rh)
After 30 days of
incubation
different plant
parameters were
measured
45. Chick pea seeds
surface sterilized
by 0.1% HgCl2
and 70% ethanol
Washed many times
with sterile distilled
water and rolled over
N-agar plate for
confirmation of
sterilization
Seeds
germinated on
1% water agar
plate
Germinated seeds were
placed in sterile partial
MS medium containing V-
Green biofertilizer with
and without CR-16 and
EC-11
Plants were incubated
in Plant Growth
Chamber at 28oC and
35% relative humidity
(Rh)
After 14 days of
incubation
different plant
parameters were
measured
47. Chitinase test
Cultures spotted on 2% colloidal chitin
agar (Renwick et al.,1991)
Amount of NAG liberated was estimated
by DNSA method (Miller, 1959)
Phytase test
Cultures spotted on 1% sodium phytate
agar (Harland and Harland, 1980)
Amount of free soluble phosphate
liberated was estimated (Ames, 1969)
Potassium solubilization
Cultures spotted on 1% mica agar Amount of potassium solubilized was
estimated by flame photometry
(Sugumaran and Janarthanam,2007)
Halotolerance of isolates
Cultures grown in minimal medium containing 2,4,6,8 and 10% NaCl and incubated
and growth was visually observed
53. MPS phenotype of CR-16
and EC-11 in presence of
different sugars
54. Acid production by CR-16 and EC-11 in presence
of different carbon sources
Sugar
Succinate
Acetate
Gluconate
Citrate
Oxalate
Arabinose
Ribose
Mannitol
Xylose
Glucose
Lactose
Fructose
Sucrose
pHValue
0
2
4
6
8
10
EC-11
CR-16
(P ≤ 0.05, n=3)
55. • pH drop in glucose and fructose from 7.2 to 5.0 in
both isolates
• In presence of organic acids succinate, acetate and
oxalate CR-16 showed no significant change in pH;
whereas increase in pH for same tubes was observed
in EC-11
• CR-16 showed pH drop from 7.2 to 5.0 in sugars viz
ribose, xylose , arabinose, sucrose, mannitol and
lactose, indicating organic acid production
• Organic acid over production results in pH drop
(Hilda et al 2006)
56. Growth in different rhizospheric sugars
Sugars
Succinate
Acetate
Arabinose
Ribose
Oxalate
Mannitol
Citrate
Fructose
Xylose
Sucrose
Glucose
Lactose
Gluconate
Growth
0.0
0.2
0.4
0.6
0.8
EC-11
CR-16
• All 13 different rhizospheric sugars were utilized by both the isolates
• Growth of EC-11 was faster compared to CR-16
• However, CR-16 showed more pH drop compared to EC-11
Sugar utilization growth profile of CR-16
and EC-11
59. • Range of free phosphate liberated: 96.79 μg/ml to
267.14 μg/ml
• CR-16 solubilized maximum phosphate in presence
of ribose followed by xylose and lactose
• EC-11 solubilized maximum phosphate in presence
of fructose followed by succinate and glucose
• Phosphate solubilization is found in those sugars
which showed organic acid production
• P solubilization by organic acid production is
reported in actinomycetes( Gangwar et al., 2012)
64. Chitin is the major polymer present in fungal cell wall. Hence chitinase
producing cultures are known to have antifungal activity. Chitinase
production is common in actinomycetes (Gupta et al., 1995)
Actinomycete isolates producing chitinase serve as a natural plant
protecting agent against phytopathogenic fungus (Shirokikh et al., 2007).
EC-11 produced 1.27 units/ml chitinase in 2% colloidal chitin medium
which is within the known range reported for actinomycetes.
66. Phytic acid, myo-inositolhexaphosphate, is a major storage form of
phosphorus in cereals and legumes, representing 18–88% of total
phosphorus. Phytic acid is also abundantly available in soil. However,
plants cannot utilize it as phosphate is present in a bound form.
Phytate degrading enzymes (phytases) breakdown phytic acid and release
inorganic phosphate (Pi) which can be taken up by plants (Reddy et al.,
1982). The phenomena is called as organic phosphate solubilization.
The isolates under study (CR-16 and EC-11) produced 0.68 and 0.52
units/ml enzyme respectively. The values are higher than reported in
Thermomonospora spp.RC7 (0.233 units/ml ) (Wittanalai et al., 2003).
67. Salinity (%) Growth of CR-16 Growth of EC-11
2 +++ +++
4 +++ +++
6 +++ +++
8 +++ +++
10 +++ +++
• For the survival of cultures in saline conditions, salt tolerance is required. Saline soils
usually have high NaCl concentration. Similarly, saline condition is created in fertile non-
saline soils due to improper irrigation.
• Hence for a bio-inoculant, salt tolerance is a desirable trait. The cultures obtained
showed tolerance to as high as 10% NaCl. In literature, halotolerant actinobacteria
Haloactinospora alba (7-23% NaCl tolerance) are reported (Tang et al., 2008).
• Results indicate NaCl tolerant cultures, however tolerance to higher NaCl range needs
to be examined.
68. Isolate Free potassium concentration
CR-16 300 μg/ml
EC-11 400 μg/ml
• Crude powder of mica rocks was obtained. Mica contains potassium ions in bound
form, thus making it unavailable. Mica solubilizing cultures liberate K+ ions from mica
rocks which can be further utilized by plants.
• In the present study, CR-16 and EC-11 solubilized mica releasing K+ ions. The
solubilization is relatively higher as compared to other mica solubilizing bacteria (MSc
dissertation thesis, Archana D.S., 2007, University of Agricultural sciences, Dharwad)
• To the best of our knowledge, there are no reports for mica solubilization for
actinomycetes.
70. Fig.6.HPLC profile of isolate CR 16: Peak with RT 13.12 min corresponds to
malate (RT 13.1 min)
71. • Significantly high activity of IDH in 50 mM glucose and low activity of IDH in 100 mM
glucose.
Isocitrate dehydrogenase EC-11
Glucose concentration
0 1 2
EnzymeUml
-1
0.00
0.01
0.02
0.03
0.04
0.05
0.06
EC-11 50 mM pH -2.7
EC-11 100 mM pH- 2.5
EC-11 50 mM pH -7.0
EC-11 100 mM pH -7.0
(P ≤ 0.05, n=3)
72. • Significantly low activity of ICL in 50 mM glucose and high activity of ICL in 100
mM glucose
2. Isocitrate lyase EC-11
Isocitrate lyase EC-11
Glucose concentration
0 1 2
EnzymeUml
-1
0.000
0.005
0.010
0.015
0.020
0.025
0.030
EC-11 50 mM pH -2.7
EC-11 100 mM pH -2.5
EC-11 50 mM pH -7.0
EC-11 100 mM pH -7.0
(P ≤ 0.05, n=3)
73. • Similar amount of malate synthase produced in 50 mM and 100 mM glucose.
• We can conclude that EC-11 produces some unidentified organic acid other than malic acid.
3. Malate Synthase EC-11
Malate synthase EC-11
Glucose concentration
0 1 2
EnzymeUml
-1
0.000
0.005
0.010
0.015
0.020
0.025
EC-11 50 mM pH -2.7
EC-11 100 mM pH -2.5
EC-11 50 mM pH -7.0
EC-11 100 mM pH -7.0
74. 4. Isocitrate dehydrogenase CR-16
Isocitrate dehyrogenase CR-16
Glucose concentration
0 1 2
EnzymeUml
-1
0.00
0.01
0.02
0.03
0.04
0.05
0.06
CR-16 50 mM pH -2.8
CR-16 100 mM pH -2.1
CR-16 50 mM pH -7.0
CR-16 100 mM pH -7.0
• Significant low activity of IDH in 50 mM and high activity in 100 mM glucose
(P ≤ 0.05, n=3)
75. • Significant low activity of ICL in 50 mM and high activity in 100 mM glucose.
5. Isocitrate lyase CR-16
Isocitrate lyase CR-16
Glucose concentration
0 1 2
EnzymeUml
-1
0.00
0.01
0.02
0.03
0.04
0.05
0.06
0.07
CR-16 50 mM pH -2.8
CR-16 100 mM pH -2.1
CR-16 50 mM pH -7.0
CR-16 100 mM pH -7.0
(P ≤ 0.05, n=3)
76. • Significant low activity in 50 mM and high activity in 100 mM glucose
6. Malate synthase CR-16
Malate Synthase CR-16
Glucose concentration
0 1 2
EnzymeUml
-1
0.00
0.02
0.04
0.06
0.08
0.10
CR-16 50 mM pH -2.8
CR-16 100 mM pH -2.1
CR-16 50 mM pH -7.0
CR-16 100 mM pH -7.0
(P ≤ 0.05, n=3)
77. Isolate IDH (U ml-1) ICL (U ml-1) MS (U ml-1)
After pH drop- 10
days
Before pH drop- 3
days
After pH
drop
Before
pH drop
After
pH drop
Before
pH drop
After pH
drop
Before
pH drop
CR-16 (50 mM) 0.070 0.040 0.050 0.022 0.080 0.030
CR-16 (100 mM) 0.090 0.049 0.090 0.020 0.140 0.030
EC-11 (50 mM) 0.070 0.032 0.030 0.015 0.060 0.014
EC-11 (100 mM) 0.095 0.037 0.045 0.017 0.060 0.015
• CR-16 shows significant high activity of ICL and MS at high concentration of glucose
• EC-11 shows similar malate synthase activity, no over production of malate in EC-11,
organic acid produced by EC-11 is unidentified
• Enzyme activity of all three enzymes almost similar in medium before pH drop
• High activity of ICL and MS in CR-16 shows presence of glyoxylate shunt pathway
79. Enzymes Primer Sequence
Forward Primer Tm(◦c) Reverse Primer Tm(◦c)
Isocitrate
dehyrogenase
CCAACATCATCAAGCTGCCGAACA 60.1 AGACCTTCATCATCGTGGCCTTCA 60.2
Isocitrate lyase
TTCGAGCTGACCAAGGCGATGAT 60.7 CCAGGGTGATGAACTGGAACTTGT 59.1
Malate synthase
ACTTCGGCCTGTACTTCTTCCACA 60.0 TCGTAGAGGATCTCCTCCATCTCGAA 59.8
DNA gyrase
GAAGTCATCATGACCGTTCTGCA 59.2 AGCAGGGTACGGATGTGCGAGCC 65.6
80. 1 2 3 4
• Bands of RNA resolved on 1.5% agarose gel.
• RNA concentration quantified at 260 nm
• Same concentration of RNA template used for RT-PCR.
Isolate and glucose
concentration
O.D. at 260 nm Concentration (μg/μl)
CR-16 (50 mM) 0.270 4.32
CR-16 (100 mM) 0.266 4.26
EC-11 (50 mM) 0.284 4.54
EC-11( 100 mM) 0.282 4.51
• Lane 1: CR-16 (50 mM)
• Lane 2: CR-16 (100 mM)
• Lane 3: EC-11 (50 mM)
• Lane 4: EC-11 (100
81. • DNA gyrase, internal control
• Band intensity not affected by glucose concentration
1.2 kb amplicon
82. 200 bp amplicon
Isolate Band intensity
EC-11 (50 mM) high
EC-11 (100 mM) low
1 2
• Lane 1: EC-11 (50 mM)
• Lane 2: EC-11 (100 mM)
83. 200 bp amplicon
Isolate Band intensity
CR-16 (50 mM) Low
CR-16 (100 mM) High
EC-11 (50 mM) Low
EC-11 (100 mM) High
1 2 3 4
• Lane 1: CR-16 (50 mM)
• Lane 2: CR-16 (100 mM)
• Lane 3: EC-11 (50 mM)
• Lane 4: EC-11 (100 mM)
84. 1 2 3 4
200 bp amplicon
Isolate Band intensity
CR-16 (50 mM) Low
CR-16 (100 mM) High
EC-11 (50 mM) Moderate
EC-11 (100 mM) Moderate
• Lane 1: CR-16 (100 mM)
• Lane 2: CR-16 (50 mM)
• Lane 3: EC-11 (100 mM)
• Lane 4: EC-11 (50 mM)
85. 0
500
1000
1500
2000
2500
3000
3500
4000
EC-11 50 mM EC-11 100 mM
Area(pixels)
• Area covered under 50 mM is higher compared to 100 mM glucose concentration
indicating higher IDH activity in 50 mM glucose for EC-11
86. 0
1000
2000
3000
4000
5000
6000
7000
8000
CR-16 50 mM CR-16 100 mM EC-11 50 mM EC-11 100 mM
Area(pixels)
•Area of band was higher for 100 mM glucose as compared to 50 mM glucose for
both CR-16 and EC-11 indicating higher ICL activity at 100 mM glucose
87. 0
500
1000
1500
2000
2500
3000
3500
4000
4500
CR-16 50 mM CR-16 100 mM EC-11 50 mM EC-11 100 mM
Area(pixels)
• Area covered under 50 mM is lesser compared to 100 mM glucose concentration in CR-16
• EC-11 shows almost equal area covered under 50 mM and 100 mM glucose concentration
92. Isolate IDH intensity ICL intensity MS intensity
CR-16 (50 mM) - Low Low
CR-16 (100 mM) - High High
EC-11 (50 mM) High Low Moderate
EC-11 (100 mM) Low High Moderate
• High intensity ICL and MS bands obtained in 100 mM glucose medium
shows the presence of glyoxylate shunt in CR-16
• Low intensity IDH band at 100 mM glucose concentration compared to
50 mM glucose concentration
• EC-11 MS bands are of almost equal intensity indicating lack of malate
over production
• IDH gene amplification for CR-16 was not obtained due to inadequate
initial m-RNA concentration
93. In vivo studies for effects of
PGP activity of CR-16 and
EC-11 on chick pea growth
95. • Gopalkrishna et al., (2012) reported 39-65% increase in root length, shoot length and
total dry weight by Streptomyces inoculation
•Micromonospora endolithica promoted the growth of roots and shoots of bean plants
(El-Tarabily et al.,2008)
• Actinomycetes isolates CR-16 and EC-11 showed beneficial effects on chick pea
development
• Higher root length, shoot length, lateral roots, branches and plant biomass observed as
compared to control
Plants Root length (cm) Shoot length
(cm)
Shoot length
increase
(fold)
No. of lateral
roots
No. of
branches
Dry
weight
(mg)
Dry weight
increase
(fold)
Control 1±0 2.5±0.70 - 1±0 4±0 265±0.04 -
CR-16 3.83±1.72 10.17±5.56 3 5±1.75 6±1.47 580±0.16 2.2
EC-11 5.00±1.41 16.00±1.41 5.4 10±0.70 10±0 550±0.01 2.0
96. • The mechanisms by which PGPR promote plant growth are not fully understood but
include :
1) ability to produce plant hormones (Mordukhova et al., 1991)
2) asymbiotic N2 fixation (Boddey and Dobereiner, 1995)
3) solubilization of mineral phosphate and other nutrients (De Freitas et al., 1997)
•The production of hormones by PGPR in numerous reports indicate the importance of
indolacetic acid (IAA) in the roots and shoots development (Aloni et al. 2006)
• El tarabily (2008) reported PGP with S. filipinensis due to ability to produce IAA
• CR-16 and EC-11 showed beneficial effects on chick pea growth in partial MS medium
Plants Root length
(cm)
Shoot length
(cm)
% increase
with respect to
control
No. of lateral
roots
No. of
branches
Dry weight
(mg)
% increase
with respect
to control
Control 7.5±2.36 11.33±0.82 -- 10±1.18 7±1.89 120±0.001 --
CR-16 8.53±0.54 16.37±2.95 44% 15±1.93 11±0.61 120±0.024 --
EC-11 10.22±1.22 19.59±3.46 72% 15±2.25 10±0.92 130±0.006 8%
97.
98. • Saber et al., (2009) reported inoculation of mung bean with phosphate solubilizing
fungi in presence of rock phosphate or calcium superphosphate increased significantly
growth, seed yield and P-uptake
• Plant promotion relies on the ability of the Actinomycetes to solubilize phosphate (El-
Tarabily et al., 2008; Hamdali et al.,2008)
•Root development in rock phosphate containing M.S. medium was low as compared to
normal M.S. medium
• EC-11 showed its beneficial effects on chick pea shoot development and CR-16
showed its beneficial effect on plant biomass
Root length (cm) Shoot length
(cm)
Shoot
length
% increase
No. of lateral
roots
No. of
branches
Dry weight
(mg)
Dry weight
% increase
Control 5.76±3.06 9.60±3.28 - 2±0.20 14±1.21 146±0.003 -
CR-16 4.08±0.26 8.57±0.28 - 1±0.80 13±0.91 169±0.018 15.75 %
EC-11 5.65±0.49 13.95±0.35 45 % 2±0.14 13±0.42 134±0.019 -
99.
100. •Vessey (2003) defines biofertilizers as a substance which contains living microorganisms
which, when applied to seed, plant surfaces, or soil colonizes the rhizosphere or the
interior of the plant and promotes growth by increasing the supply or availability of
primary nutrients the host plant.
• Rhizobacteria, associated with rhizosphere, can fix nitrogen, and solubilizing
phosphorus has been used as inoculum in nonleguminous species such as maize, rice,
wheat, and sugar cane (Dobereiner 1997).
• However, beneficial effects of isolates seen on shoot development and lateral roots
development
• Plant biomass in EC-11 inoculated plants was more as compared to control
Plants Root length (cm) Shoot length
(cm)
Shoot length%
increase
No. of lateral
roots
No. of
branches
Dry
weight
(mg)
Dry
weight%
increase/
decrease
Control 16.06±1.13 12.20±1.09 - 19±1.76 16±2.16 135±0.02 -
CR-16 15.10±1.33 14.33±1.21 17.3 % 26±2.23 12±3.78 117±0.06 -
EC-11 15.45±1.05 14.73±0.32 20.7 % 25±3.74 10±0.65 146±0.003 8.1 %
103. Williams, S.T. , Sharples, G.P., Bradshaw, R.M. The fine structure of Actinomycetes. In actinomyctales,
Characteristics and practical importance , Edited by G.sykes and F.A Skinner . London : Acedemic press.
Pp. 113-130 (1973)
Locci, R., Williams, S.T., M.E. Sharpe and J.G. Holt (Eds.). Willians and Wilkins. Baltimore,
1989. Streptomyces and Related Genera. In: Bergeys Manual of Systematic Bacteriology, 2452-2492.
Manfio, G.P., Zakrzewska-Czerwinska, J., Atalan, E. Goodfellow, M. Towards minimal standards for the
description of Streptomycesspecies. Biotechnologia. 7-8: 242–253 (1995).
Vanloon baker 2003 Bais et al 2004, Gray and Smith 2005, kiely et al 2006
Hasegawa, S., Shimazu, M ., Meguro, A., Ohmura, y., Nishimura, T., Kunoh, H. An endophytic
Actinomycetes, Streptomyces sp. MBR-52, that accelerates emergence and elongation of plant
adventitious root. Actinomycetologicia. 20: 1-9 (2006)
Okazaki, T.: K. Takahashi, M. Kizuka & R. Enokital,1995, Annu. Rep.Sankyo Res. Lab Studies on
Actinomycete isolated from plant leaves, Vol. 47, 97–106.
Matsukuma, S.; T. Okuda & J.Watanabe,1994,Actinomycetologica Isolation of Actinomycetes from pine
litter layers, Vol.8, 57–65.
Matsumoto, A.; Y. Takahashi, M. Mochizuki, A. Seino, Y. Iwai & S. Omura,1998, Actinomycetologica,
Characterization of actinomycetes isolated from fallen leaves, Vol. 12, 46–48.
Fuhrer, T., Fischer, E., and Sauer, U. (2005). Experimental identification and quantification of glucose
metabolism in seven bacterial species. Journal of bacteriology.187, 1581-1590.
Marschner H 1995 Mineral Nutrition of Higher Plants. Academic Press, London.
Hoffland E 1992 Quantitative evaluation of the role of organic-acid exudation in the mobilization of rock
phosphate by rape. Plant Soil 140, 279–289.
Johnson J F, Allan D L, Vance C P and Weiblen G 1996a Root carbon dioxide fixation by phosphorus-
deficient Lupinus albus: Contribution to organic-acid exudation by proteoid roots. Plant Physiol. 112, 19–
30.
104. Ryan P R, Delhaize E and Randall P J 1995a Malate efflux from root apices and tolerance to aluminum are
highly correlated in wheat. Aust. J. Plant Physiol. 122, 531–536.
Ismail I, DeBellis L, Alpi A and Smith S M 1997 Expression of gly- oxylate cycle genes in cucumber roots
responds to sugar supply and can be activated by shading or defoliation of the shoot. Plant Mol. Biol. 35,
633–640.
Earl K D, Syers J K and McLaughlin J R 1979 Origin of citrate, tartrate, and acetate on phosphate sorption
by soils and synthetic gels. Soil Sci. Soc. Am. J. 43, 674–678.
Fox T R and Comerford N B 1992 Influence of oxalate loading on phosphorus and aluminum solubility in
spodosols. Soil Sci. Soc. Am. J. 56, 290–294.
Fox T R, Comerford N B and McFee W W 1990a Phosphorus and aluminum release from a spodic horizon
mediated by organic acids. Soil Sci. Soc. Am. J. 54, 1763–1767.
Fox T R, Comerford NB and McFee W W 1990b Kinetics of phos- phorus release from spodosols – effects
of oxalate and formate. Soil Sci. Soc. Am. J. 54, 1441–1447.
Gerke J 1994 Kinetics of soil phosphate desorption as affected by citric acid. Z. Pflanzenernähr. Bodenk.
157, 17–22.
Jones D L and Darrah P R 1994b Role of root derived organic-acids in the mobilization of nutrients from
the rhizosphere. Plant Soil 166, 247–257.
Bolan N S, Naidu R, Mahimairaja S and Baskaran S 1994 Influence of low-molecular-weight organic-acids
on the solubilization of phosphates. Biol. Fert. Soils 18, 311–319.
Fox T R, Comerford NB and McFee W W 1990b Kinetics of phos- phorus release from spodosols – effects
of oxalate and formate. Soil Sci. Soc. Am. J. 54, 1441–1447.
Lan M, Comerford N B and Fox T R 1995 Organic anions effect on phosphorus release from spodic
horizons. Soil Sci. Soc. Am. J. 59, 1745–1749.
105. Stone et al.,2000, Nature Genetics , Mutation of a gene encoding a putative chaperonin causes McKusick-Kaufman
syndrome, Mutation of a gene encoding a putative chaperonin causes McKusick-Kaufman syndrome, Vol. 25, 79–82.
Baker, P. N., Morser, J. & Burke, D. C. ,1980, Journal of lnterferon Research, Effects of sodium butyrate on a human
lymphoblastoid cell line (Namalwa) and its interferon production, Vol. 1, 71-77.
Hiltner, L. Uber neure Erfahrungen und problem auf dem dem Gebiet der Bodenbakteriologie und unter besonder
Berucksichtigung der Grundungung und branche. [German].- Arb Dtsch Landwirtsch Ges. 98: 59-78 (1904)
Maldonado, L.A., James, E.M., Stach, Wasu Pathom-aree1, Alan, C., Ward Alan, T., Bull, Goodfellow, M. Diversity of
cultivable Actinobacteria in geographically widespread marine sediments. Antonie van Leeuwenhoek. 87: 11–18 (2005).
Wang, Y., Zhang, Z.S., Ruan, J.S., Wang, Y.M., Ali S.M.S.D. Investigation of actinomycetes diversity in the tropical rainforest of
Singapore. Journal of Industrial Microbiology and biotechnology. 23: 178-187 (1999).
Das, M., Royer, T.V., Leff, L.G. Diversity of Fungi, Bacteria, and Actinomycetes on Leaves Decomposing in a Stream. Applied
Environmental Microbiology. 73(3): 756–767 (2007).
Castillo, U., Harper, J. K., Strobel, G. A., Sears, J., Alesi, K., Ford, E., Lin, J., Hunter, M., Maranta, M., Ge, H., Yaver, D., Jensen,
J. B., Proter, H., Robinson, R., Millar, D., Hess, W.M., Condron, M., Teplow D. Kakadumycins, novel antibiotics from
Streptomyces sp. NRRL 305, an endophyte of Grevillea pteridifolia. FEMS (Federation of European Material Societies)
Microbiology Letter. 224: 183–190 (2003).
Moncheva, P., Tishkov, S., Dimitrova, N.V., Chipeva, S. Antonova-Nikolova and N. Bogatzevska. characteristics of soil
actinomycetes from antarctica. Journal of culture collections. 3: 3-14 (2002).
Hong, K., Gao, A.H., Xie, Q.Y., Gao, H., Zhuang, L., Lin, H.P., Yu, H.P. Li, J., Yao, X.S., Goodfellow, M., Ruan, J.S. Actinomycetes
for Marine Drug Discovery Isolated from Mangrove Soils and Plants in China. Marine Drugs. 7: 24-44 (2009).
Seong, C. N., Ji Heok Choi, Keun-Shik Baik. An Improved Selective Isolation of Rare Actinomycetes from Forest Soil. The
Journal of Microbiology. 39(1): 17-23 (2001).
Zenova, G.M., Kurapova, A.I., Lysenko, A.M., Zvyagintsev, D. G. The structural-functional organization of thermo tolerant
complexes of actinomycetes in desert and volcanic soils Earth and Environmental Science . 42(5): 531-535 (2009).
Sibanda, T., Mabinya, L.V., Mazomba, N., David, A., Akinpelu, K., Bernard, Ademola, O., Olaniran , Anthony, I., Okoh.
Antibiotic Producing Potentials of Three Freshwater Actinomycetes Isolated from the Eastern Cape Province of South Africa.
International Journal of Molecular Science. 11: 2612-2623 (2010).
106. Ravikumar. S., Fredimoses, M., Gokulakrishnan, R., Biodiversity of actinomycetes in Manakkudi mangrove ecosystem,
Southwest coast of India. Annals of Biological Research. 2(1): 76-82 (2011).
Barreto, T.R., augusto, c.m., Da silva, ana cristina, f., Soares, jorge, t., De souza. Population densities and genetic diversity of
actinomycetes associated to the rhizosphere of theobroma cacao. Brazilian journal of microbiology. 39: 464-470(2008).
Cao, L., Z., You, J., Tan, H., Zhou, S. Isolation an dcharecterization of endophytic Streptomyces strains from surface-sterilized
tomato (Lycopersicon esculentum) roots. Letters in Applied Microbiology. 39:425-430 (2004)
Ranjeet, K., Tokala Janice, L., Strap Carina, M. JungDon, L., Crawford, Michelle Hamby Salove, Lee A., Deobald, J., Franklin
Bailey, Morra, M.J. Novel Plant-Microbe Rhizosphere Interaction Involving Streptomyces lydicus WYEC108 and the Pea Plant
(Pisum sativum), Applied and Environmental Microbiology. 68(5): 2161–2171 (2002).
Ehrlich, H. L. Mikrobiologische und biochemische Verfahrenstechnik. In: Einsele, A., Finn, R. K., Samhaber, W., editors.
(1990). Geomicrobiology, 2nd ed. Weinheim: VCH Verlagsgesellschaft.
Fernandez, C. and Novo R. (1988). Vida Microbiana en el Suelo, II. La Habana: Editorial Pueblo y Educación.
MOLLA MAZ AND CHOWDHURY AA.1984. Microbial mineralization of organic phosphate in soil. Plant Soil 78: 393–399.
CHIEN SH AND MENON RG. 1995. Factors affecting the agronomic effectiveness of phosphate rock for direct application.
Fert Res 41: 227–234.
SALE PWG AND MOKWUNYE AU. 1993. Use of phos- phate rocks in the tropics. Fert Res 35: 33–45.
SANCHEZ PA, SHEPHERD KD, SOULE MJ, PLACE FM, BURESH RJ AND IZAC AN. 1997. Soil fer- tility replenishment in Africa: an
investment in nat- ural resource capital. In: Replenishing soil fertility in Africa, Indianapolis. Proceedings, SSSA Special
PublicationNo. 51, Madison, WI:AmericanSociety of Agronomy, 1997, p. 1–46.
Begon, M., Harper, J. L., Townsend, C. R. (1990). Ecology: Individuals, Populations and Communities, 2nd ed. Blackwell
Scientific Publications USA.
Goldstein, A. H. (1994). Involvement of the quinoprotein glucose dehydrogenase in the solubilization of exogenous
phosphates by gram-negative bacteria. In: Torriani-Gorini, A., Yagil, E., Silver, S., editors. Phosphate in Microorganisms:
Cellular and Molecular Biology. Washington, DC: ASM Press. pp. 197-203.
OBERSON A, BESSON JM, MAIRE N AND STICHER H. 1996. Microbiological processes in soil organic transformations in
conventional and biological crop- ping systems. Biol Fertil Soils 21: 138–148.
107. STEWART JWB AND TIESSEN H. 1987. Dynamics of soil organic phosphorus. Biogeochem 4: 41–60.
BEEVER RE AND BURNS DJW. 1980. Phosphorus up- take storage and utilization by fungi Adv Bot Res 8:
127–219.
Fernandez, C. and Novo R. (1988). Vida Microbiana en el Suelo, II. La Habana: Editorial Pueblo y
Educación.
Odum, E. P. (1986). Fundamentos de Ecologìa. Mexico: Interamericana.
ENGELSTAD OP, JUGSUJINDA A AND DE DATTA SK. 1974. Response by flooded rice to phosphate rocks of
varying citrate solubility. Soil Sci Soc Amer Proc 38: 524–529.
RICHARDSON AE. 2001. Prospects for using soil mi- croorganisms to improve the acquisition of phospho-
rus by plants. Aust J Plant Physiol 28: 897–906.
Dey, B. K. (1988). Phosphate solubilizing organisms in improving fertility status of soil. In: Sen, S.P., Palit, P.
(Eds.). Biofertilizers Potentialities and Problems. Plant Physiology Forum, Naya Prokash, Calcutta,
pp.237±248.
Goldstein, A. H. (1986). Bacterial solubilization of mineral phosphates: historical perspective and future
prospects.American Journal of Alternative Agriculture. 1, 51-7. 50.
Goldstein, A. H. (1994). Involvement of the quinoprotein glucose dehydrogenase in the solubilization of
exogenous phosphates by gram-negative bacteria. In: Torriani-Gorini, A., Yagil, E., Silver, S., editors.
Phosphate in Microorganisms: Cellular and Molecular Biology. Washington, DC: ASM Press. pp. 197-203.
Shirokikh IG, Zenova GM, Merzaeva OV et al. Actinomycetes in prokaryotic complex of the rhizosphere of
oats in a soddy-podzolic soil. Eurasian soil Sci 40: 158-162, 2007.
Jones, D. A., Smith, B. F. L., Wilson, M. J., Goodman, B. A. (1991). Solubilizator fungi of phosphate in rise
soil. Mycol Res. 95, 1090-3.
Dalal, R. C. (1977). Soil organic phosphorus. Advances in Agronomy. 29, 83-117
108. Anderson, G. Assessing organic phosphorus in soils. In: Khasawneh, F. E., Sample, E. C., Kamprath, E. J.,
editors. (1980). The Role of Phosphorus in Agriculture. Madison, Wis: American Society of Agronomy. pp.
411–32.
Harley, J. L., Smith, S. E. (1983). Mycorrhizal symbiosis. London, New York: Academic Press.
Paul, E. A., Clark, F. E. (1988). Soil Microbiology and Biochemistry. San Diego, CA: Academic Press
Ohtake, H., Wu, H., Imazu, K., Ambe, Y., Kato, J., Kuroda, A. (1996). Bacterial phosphonate degradation,
phosphite oxidation and polyphosphate accumulation. Resources, Conservation and Recycling. 18, 125-
34.
McGrath, J. W., Wisdom, G. B., McMullan, G., Lrakin, M. J., Quinn, J. P. (1995). The purification and
properties of phosphonoacetate hydrolase, a novel carbon-phosphorus bond- cleaving enzyme from
Pseudomonas by Rhizobium huakuii PMY1. Applied and Environmental Microbiology. 64, 356-58.
McGrath, J. W., Hammerschmidt, F. and Quinn, J. P. (1998). Biodegradation of phosphonomycin by
Rhizobium huakuii PMY1. Applied and Environmental Microbiology. 64, 356-58.
Boddey, R. M., Dobereiner,J.(1995). Nitrogen fixation associated with grasses and cereals: recent progress
and perspectives for the future. Plant and Soil, 108 (Suppl1). 53-65.
Scher, F. M., Baker, R. (1982). Effect of Pseudomonas putida and a synthetic iron chealator on induction of
soil suppressiveness to Fusarium wilt pathogens. Phytopathology. 72, 1567– 1573.
Arshad, M., Frankenberger Jr., W. T. (1993). Microbial production of plant growth regulators. In: Blaine, F.
Metting, Jr. (Eds.), Soil Microbial Ecology. Marcel and Dekker, Inc., New York. pp. 307-347.
Glick, B. R. (1995). The enhancement of plant growth by free living bacteria. Canadian Journal of
Microbiology. 41 (Suppl 2), 109-114.
Khan, A. G. (2005). Role of soil microbes in the rhizosphere of plants growing on trace metal
contaminated soils in phtoremediation. Journal of Trace Element in Medicine and Biology. 18, 355-364.
Bais HP, Park SW, Weir TL, Callaway RM, Vivanco JM. How plants communicate using the underground
information superhighway. Trends Plant Sci 2004; 9:26-32
109. Badri DV, Vivanco JM. Regulation and function of root exudates. Plant Cell Environ 2009; 32:666-81. 20.
Aulakh MS, Wassmann R, Bueno C, Kreuzwieser J, Rennenberg H. Characteriaztion of root exudates at different
growth stages of ten rice (Oryza sativa L.) cultivars. Plant Biol 2001; 3:139-48. 21.
Badri DV, Loyola-Vargas VM, Broeckling CD, De-la-Peña C, Jasinski M, Santelia D, et al. Altered profile of secondary
metabolites in the root exudates of Arabidopsis ATP- binding cassette transporter mutants. Plant Physiol 2008;
146:762-71.
Neumann G, Römheld V. Root excretion of carboxylic acids and protons in phosphorus- deficient plants. Plant Soil
1999; 211:121-30.
Piñeros MA, Magalhaes JV, Carvalho-Alves VM, Kochian LV. The physiology and bio- physics of an aluminum
tolerance mechanism based on root citrate exudation in maize. Plant Physiol 2002; 129:1194-206. 25.
Campbell R, Greaves MP. Anatomy and community structure of the rhizosphere. In: Lynch JM, ed. The
Rhizosphere. England: John Wiley and Sons Ltd 1990; 11-34.
Valencia-Cantero E, Hernández-Calderón E, Velázquez-Becerra C, López-Meza JE, Alfaro-Cuevas R, López-Bucio J.
Role of dissimilatory fermentative iron-reducing bac- teria in Fe uptake by common bean (Phaseolus vulgaris L.)
plants grown in alkaline soil. Plant Soil 2007; 291:263-73.
Sperberg, J. I. (1958). The incidence of apatite-solubilizing organisms in the rhizosphere and soil. Austalian Journal
of Agricultural Research. 9, 778.
Katznelson, H, Peterson, E.A., Rovatt, J. W. (1962). Phosphate dissolving microoganisms on seed and in the root
zone of plants. Canadian Journal of Botany. 40, 1181-6.
Raghu, K., MacRae, I. C. (1966). Occurrence of phosphate-dissolving microorganisms in the rhizosphere of rice
plants and in submerged soils. Journal of Applied Bacteriology. 29, 582-6.
Alexander, M. (1977). Introduction to Soil Microbiology. New York: Wiley and Sons.
Hoon, H., Park, R. D., Kim, Y. W., Rim, Y. S., Park, K. H., Kim, T. H., Such, J. S., Kim, K. Y. (2003). 2-ketogluconic acid
production and phosphate solubilization by Enterobacter intermedium. Current Microbiology. 47, 87-92.
110. Vazquez, P., Holguin, G., Puente, M. E., Lopez-Cortez, A., Bashan, Y. (2000). Phosphatesolubilizing microorganisms
associated with the rhizosphere of mangroves in a semiarid coastal lagoon. Biology and Fertility of Soils. 30, 460-
468.
Bar-Yosef B., Rogers, R. D., Wolfram, J. H., Richman, E. (1999). Pseudomonas cepacia mediated rock phosphate
solubilization in kaolinite and montmorillonite suspensions. Soil Science Society of American Journal. 63, 1703-
1708.
Gupta, R. R., Singal, R., Shanker, A., Kuhad, R. C., Saxena, R. K. (1994). A modified plate assay for secreening
phosphate solubilizing microorganisms, The Journal of General and Applied Microbiology. 40, 255-260.
Gaur, A.C. (1990). Physiological functions of phosphate solubilizing micro-organisms. In: Gaur, A.C. (Ed.),
Phosphate Solubilizing Micro-organisms as Biofertilizers. Omega Scientific Publishers, New Delhi. pp. 16-72. 47.
Gaur A.C. (1990). Phosphate solubilizing microorganisms as biofertilizers. Omega Scientific Publisher, New Delhi,
pp. 176
Banik, S. and Dey, B. K. (1982). Available phosphate content of an alluvial soil as influenced by inoculation of
some isolated phosphate-solubilizing microorganisms. Plant and Soil. 69, 353- 364.9.
Banik, S. and Dey B. K. (1983). Phosphate solubilizing potentiality of the microorganisms capable of utilizing
aluminium phosphate as a sole phosphate source. Zentralblatt Fur Mikrobiologie.138, 17-23.
Khamna, S., Yokota, A., Lumyong, S. Actinomycetes isolated from medicinal plant rhizosphere soils: diversity
and screening of antifungal compounds, indole-3-acetic acid and siderophore production.World Journal of
Microbiology and Biotechnology. 25: 649–655 (2009).
Thangapandian, V. Actinomycetes diversity in the Rhizosphere soil of different medicinal plants in Kolly Hills
Termilnadu, India, for secondary metabolite production. Asian Journal of Plant Science. 6: 66-70 (2007).
Thangapandian, V., Ponmurugan, P., Ponmurugan, K. actinomycetes diversity in the Rhizosphere soils of different
medicinal plants in Kolly hills tamilnadu, in India for secoundary metabolite production. Asian journal of plant
science. 6(1): 66-77 (2007).
Miller, H.J., Henken, G., Van Veen, J.A. Variation and composition of bacterial populations in the rhizospheres of
maize, wheat, and grass cultivars. Canadian Journal of Microbiology. 35: 656–660 (1989).
Tian, X., Cao, L., Tan, H., Han, W., Chen, M., Liu, Y., Zhou, S. Diversity of Cultivated and Uncultivated
Actinobacterial Endophytes in the Stems and Roots of Rice. Microbial ecology. 53: 700–707 (2007).
111. Barreto, T.R., augusto, c.m., Da silva, ana cristina, f., Soares, jorge, t., De souza. Population densities and genetic
diversity of actinomycetes associated to the rhizosphere of theobroma cacao. Brazilian journal of microbiology.
39: 464-470(2008).
Tian, X., Cao, L., Tan, H., Han, W., Chen, M., Liu, Y., Zhou, S. Diversity of Cultivated and Uncultivated
Actinobacterial Endophytes in the Stems and Roots of Rice. Microbial ecology. 53: 700–707 (2007).
Juhnke, M. E., Mathre, D. E., Sands, D. C. Identification and Characterization of Rhizosphere-Competent Bacteria
of Wheat, Journal of Applied and Environmental. Microbiology. 53(12): 2793-2799(1987).
Madhurama Gangwar, Sheela Rani and Neerja Sharma. Investigating endophytic actinomycetes diversity from
Rice for plant growth promoting and antifungal activity.International journal of advanced life sciences,Vol.1:10-
21(2012).
Beever, R. E and Burns, D. J. W. (1980). Phosphorus uptake storage and utilization by fungi. Advances in Botanical
Research. 8, 127– 219.
Illmer, P. and Schinner, F. (1992). Solubilization of inorganic phosphates bymicroorganisms isolated from forest
soils. Soil Biology and Biochemistry. 24, 389± 395. 67.
Illmer, P., Barbato, A. and Schinner, F. (1995). Solubilization of hardly-soluble AlPO4 with P-solubilizing
microorganisms. Soil Biology and Biochemistry. 27, 265±270.
Halder, A. K. and Chakrabartty, P. K. (1993). Solubilization of inorganic phosphate by Rhizobium. Folia
Microbiologica. 38, 325-30.
Kucey, R. M. N. (1983). Phosphate solubilizing bacteria and fungi in various cultivated and virgin Alberta soils.
Canadian Journal of Soil Science. 63, 671-8.
Gugi, B., Orange, N., Hellio, F., Burini, J. F., Guillou, C., Leriche, F., Guespin-Michel, J. F. (1991). Effect of growth
temperature on several exported enzyme activities in the psychrotropic bacterium Pseudomonas fluorescens.
Journal of Bacteriology. 173, 3814-20.
Fraga, R. and Rodríguez, H. (1999). Phosphate solubilizing bacteria and their role in plant growth promotion.
Biotechnology Advances. 319-339.
Richardson, A. E. and Hadobas, P. A. (1997). Soil isolates of Pseudomonas spp. that utilize inositol phosphates.
Canadian Journal of Microbiology. 43, 509-16.
112. Ohtake, H., Wu, H., Imazu, K., Ambe, Y., Kato, J., Kuroda, A. (1996). Bacterial phosphonate degradation, phosphite
oxidation and polyphosphate accumulation. Resources, Conservation and Recycling. 18, 125-34.
McGrath, J. W., Hammerschmidt, F. and Quinn, J. P. (1998). Biodegradation of phosphonomycin by Rhizobium
huakuii PMY1. Applied and Environmental Microbiology. 64, 356-58.
Omar, S. A. (1998). The role of rock phosphate solubilizing fungi and vesicular arbuscular mycorrhiza (VAM) in
growth of wheat plants fertilized with rock phosphate. World Journal of Microbiology and Biotechnology. 14, 211-
219.
Gyaneshwar P., Naresh Kumar, G. and. Parekh, L. J. (1998). Effect of buffering on the phosphate-solubilizing ability
of microorganisms. World Journal of Microbiology & Biotechnology. 14, 669±673. 56.
Gyaneshwar, P., Parekh, L. J., Archana, G., Poole, P. S., Collins, M. D., Hutson, R. A., Naresh Kumar, G. (1999).
Involvement of a phosphate starvation inducible glucose dehydrogenase in soil phosphate solubilization by
Enterobacter asburiae. FEMS Microbiology Letters. 171, 223-229.
Kucey, R. M. N., Jenzen, H. H., Leggett, M. E. (1989). Microbially mediated increases in plant available phosphorus.
Advances in Agronomy. 42, 199-228.
Bolan, N. S., Mahimairaja, S., Baskaran, S. (1994). Influence of lowmolecular- weight organic acids on the
solubilization of phosphates. Biology and Fertility of Soils. 18, 311-319.
Jones, D.L., nggguyen, C., Finlay, R.D Carbonflow in the rhizosphere: carbon trading at the soil-root interface.
Plant soil.321:5-33(2009)
Nahas, E. (1996). Factors determining rock phosphate solubilization by microorganism isolated from soil, World
Journal of Microbiology and Biotechnology. 12, 18-23.
Halder, A. K., Mishra, A. K., Bhattacharyya, P., Chakrabartty, P. K. (1990). Solubilization of rock phosphate by
Rhizobium and Bradyrhizobium. Journal of General and Applied Microbiology. 36, 81-92. 58.
Halder, A. K. and Chakrabartty, P. K. (1993). Solubilization of inorganic phosphate by Rhizobium. Folia
Microbiologica. 38, 325-30.
Banik, S. and Dey, B. K. (1982). Available phosphate content of an alluvial soil as influenced by inoculation of
some isolated phosphate-solubilizing microorganisms. Plant and Soil. 69, 353- 364. 9.
113. Banik, S. and Dey B. K. (1983). Phosphate solubilizing potentiality of the microorganisms capable of utilizing
aluminium phosphate as a sole phosphate source. Zentralblatt Fur Mikrobiologie.138, 17-23.
Duff, R. B. and Webley, D. M. (1959). 2-Ketogluconic acid as a natural chelator produced by soil bacteria.
Chemistry and Industry. 1376-77.
Chen, Y. P., Rekha, P. D. Arun, A. B. Shen, F. T. Lai, W. A. Young C. C. (2006). Phosphate solubilizing bacteria from
subtropical soil and their tricalcium phosphate solubilizing abilities. Applied Soil Ecology. 34, 33-41.
Duine, J.A. (1991). Quinoproteins: enzymes containing the quinonoid cofactor pyrroloquinoline quinone,
topaquinone or tryptophan-tryptophan quinone. European Journal of Biochemistry. 200, 271-284.
Kim, K. Y., Mcdonald, G. A, Jordan, D. (1997). Solubilization of hydroxypatite by Enterobacter agglomerans and
cloned Escherichia coli in culture medium. Biology and Fertility of Soils. 24, 347-35.
Krishnaraj, P. U. and Goldstein, A. H. (2001). Cloning of a Serratia marcescens DNA fragment that induces
quinoprotein glucose dehydrogenase-mediated gluconic acid production in Escherichia coli in the presence of
stationary phase Serratia marcescens. FEMS Microbiology Letters. 205, 215–220.
Subba Rao, N. S. (1982).Advances in agricultural microbiology. In: Subba Rao, N. S., editor. Studies in the
Agricultura and Food Sciences. London: Butterworth Scientific. pp. 295-303.
Hiraga, K.L, Sheeu M., Kitazawa, S., Takahashi, M., Shimada, R. Sato and K. Oda. (1997). Isolation and
characterization of chitinase from a flake- chitin degrading marine bacterium, Aeromonas hydrophila H-2330.
Biosci. Biotechnol. Biochem., 61: 174-176.
Shin-Hye, P. and L. Jung- Hyun. (2000). Purification and characterization of chitinase from a marine bacterium,
Vibrio sp. 98CJ11027. J. Microbiol., 38: 224-229.
Majewski, R.A. and Domach, M.M. (1990). Simple constrained optimization view of acetate overflow in E. coli.
Biotecnology and Bioengineering, 35(7): 732-738.
el-Mansi EM, Holms WH. (1989) Control of carbon flux to acetate excretion during growth of Escherichia coli in
batch and continuous cultures. J Gen Microbiol. ;135(11):2875–2883.
Kornberg, H.L. (1966). The role and control of Glyoxylate cycle in E. coli. Biochem. J. 99(1): 1-11.
Je-Nie, P. and Joseph, S. (2003) Transcription levels of key metabolic genes are the cause for different glucose
utilization pathways in E. coli B (BL21) and E. coli K (JM109). Journal of Biotechnology, 109(1): 21-30
