Ce diaporama a bien été signalé.
Nous utilisons votre profil LinkedIn et vos données d’activité pour vous proposer des publicités personnalisées et pertinentes. Vous pouvez changer vos préférences de publicités à tout moment.

The First Benchtop Next-Generation Sequencer - Ion Proton™ Sequencer

2 052 vues

Publié le

Powered by Ion Torrent™ semiconductor chip technology, the Ion Proton™ Sequencer is the first benchtop next-generation sequencer to offer fast, affordable human genome and human exome sequencing. Powered by the next generation of semiconductor sequencing technology and offering a similar single-day workflow to the Ion PGM™ Sequencer, the Ion Proton™ Sequencer promises to change the way scientists look at genomics.

For more information visit:

http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Sequencing/Semiconductor-Sequencing/proton.html?CID=Protonbrochure-SS-12312

Publié dans : Technologie, Business
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

The First Benchtop Next-Generation Sequencer - Ion Proton™ Sequencer

  1. 1. Ion Proton™ System yJanuary 2012 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  2. 2. Highly Disruptive TechnologiesEEmpower E Everyone Main Frame  Mini Computer  Personal Computer Sanger Sequencing Next‐Gen Sequencing Ion Semiconductor Sequencing Technology generations are defined by who can use them2
  3. 3. Semiconductors Disrupt Industries3
  4. 4. Ion’s Semiconductor Chip Sees ChemistryBiological Information Ion Semiconductor Chip Digital Information Leverages $1 Trillion investment and $50 Billion annual spend 4
  5. 5. Ion PGM™ Sequencer:The Fastest Selling Sequencer in the World • Speed:1.5 Speed:1 5 hour runs • Scalability:10 Mb to 1 Gb • Simplicity: Automated workflows, benchtop convenience • Affordable Aff d bl5
  6. 6. The Promise of Semiconductor SequencingFirst 100-Fold Scaling Delivered and More 100 Fold Achieved i 2011 A hi d in • 100-fold scaling and 200 bp kits, Ion 318™ Chip* 525 base perfect reads achieved • Breakthrough Ion AmpliSeq™ app, microbial and RNA-seq apps Ion 316™ Chip • 5,000 member Ion Community Ion 314™ 2012 Roadmap Chip • 2 x 200 paired end kit, 400 bp kits • Custom and fixed AmpliSeq™ panels • FDA submission and CE-IVD certification6 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  7. 7. Introducing Ion Proton™ ChipsThe Next 100-Fold Scaling 100 Fold7 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  8. 8. $500 Exome and $1,000 GenomeSequencing in a Few Hours on the Benchtop Ion Proton™ I Chip Ion Proton™ II Chip 2 human exomes 1 human genome 165 million wells 660 million wells $1,000 per run $1,000 per run Highest Throughput8 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  9. 9. Introducing the Ion Proton™ SequencerThe Benchtop Genome Center 9 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  10. 10. Introducing the Ion Proton™ SequencerThe Benchtop Genome Center 10 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  11. 11. Introducing the Ion Proton™ SequencerThe Benchtop Genome Center 11 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  12. 12. Introducing the Ion Proton™ SequencerThe Benchtop Genome Center • Supports Ion Proton™ I and Proton Proton™ II chips • $149K List Price (USD) – $99K for Ion PGM™ owners • State-of-the-art electronics to support highest throughput 12 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  13. 13. …and Rack-Mountable! Broad, Baylor, Broad Baylor and Yale have already signed up for this configuration13 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  14. 14. Harnessing a Decade of Moore’s Law inO LOne Leap… Nature 475, 348 352 (21 July 2011) 475 348–352 Ion Proton™ I Chip: 165 million wells (>100-fold ( 100 fold more wells than Ion 314™ Chip) 31414 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  15. 15. …While Seamlessly Scaling Ion’s PostLight™ Sequencing Ch i t S i Chemistry Ion 314™ Chip Signal Ion Proton™ I Chip Signal Nucleotide Incorporation Signal Signal, Same Signal Same Speed Internally generated R&D data shown 15 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  16. 16. Maintaining 200 Base Read Lengths 200 Base Q20 Reads on Ion Proton™ I Chip TCTTCTTCTGGCTGCCAGCACGCCGGTTGTAGTGGGATCTCTTCGCGATC |||||||||||||||||||||||||||||||||||||||||||||||||| TCTTCTTCTGGCTGCCAGCACGCCGGTTGTAGTGGGATCTCTTCGCGATC 1 10 20 30 40 50 AAACGCCAGATCACCCCCGTTAACCACTTCAGAACCGTGGGTGATGACCT ||||||||||||||||||||||||||||||||||||||||||||||+||| AAACGCCAGATCACCCCCGTTAACCACTTCAGAACCGTGGGTGATG-CCT 51 60 70 80 90 100 TTGAAATCGAATCAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT |||||||||||+|||||||||||||||||||||||||||||||||||||| TTGAAATCGAA CAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT TTGAAATCGAA-CAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT 101 110 120 130 140 150 GCATCGCGCTGAACATCGTCTCGATACGCCCTGGATAACGTTTATCCCAG |||||||||||||||||||||||||||||||||||||||||||||||||| GCATCGCGCTGAACATCGTCTCGATACGCCCTGGATAACGTTTATCCCAG 151 160 170 180 190 200 TCA ||| TCA 201 Internally generated R&D data shown16 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  17. 17. Single Day Workflow with Highest Throughput Ion Kits Ion Proton™ Ion Proton™ Sequencer Proton™ Torrent Server OneTouch S t O T h System17 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  18. 18. Streamlined Bioinformatics InfrastructureServer Room & Informaticists in a Box and in the Cloud Ion Reporter™ Solution Proton Proton™ Torrent Server and Torrent Suite Software 18 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  19. 19. Overcoming Data Bottlenecks Full Genomes in Ion Reporter™ p High Data g Hours vs. Weeks Solution Quality More uniform coverage Single genome Flexible cloud-based enables higher quality sequencing in hours solution to manage manage, variant calls with less raw greatly eases analysis annotate, and archive data. Longer reads bottleneck (vs. batch- variants of interest for enable better mappability processing) future interpretation with less raw data19 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  20. 20. Ion Proton™ System Availability January 2012 Ion Proton System available for quotes Proton™ Ion Proton™ I Chip to commence shipment Mid-2012 (Ion Proton™ II Chip to be available 6 months later) Early Access for 4-unit rack-mounted configuration 4 unit rack mounted Unrestricted launch of Ion Proton™ Sequencer and End of Q3:2012 standalone Proton Torrent™ Server to commence20 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  21. 21. Ion Semiconductor SequencingRapid,Rapid Benchtop Sequencing for All 1.25” 1” Genes Genomes Ion 3 Series Chips 3-Series Ion Proton™ Chips Ion PGM™ Sequencer Ion Proton™ Sequencer21 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  22. 22. Unprecedented Scaling Every 6 Months22 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  23. 23. Enabling All Applications23 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  24. 24. 5500 Wildfire24 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  25. 25. Wildfire Offered to Existing 5500 CustomersMid-2012 Delivery Wildfire simplifies workflow and improves economics while retaining ultra high accuracy and p y p g g y pay-per-lane sequencing q g 1.Simpler Workflow: 2 hour on flowchip template preparation 2.Lower Price / Gb: $25 / Gb guaranteed 3.Higher Throughput: g g p > 20 Gb / day throughput y g p25 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  26. 26. Purchasing Options for 5500 andSOLiD C t Customers • Ion Proton™ Sequencer + Wildfire upgrade q pg (discounted package for 5500 customers) • Ion Proton™ Sequencer + 5500 Wildfire (discounted package for SOLiD customers) • Ion Proton™ Sequencer (discounted, standalone for 5500/SOLiD) • Wildfire upgrade (list price, standalone for 5500/SOLiD)26 The content provided herein may relate to products that have not been officially released and is subject to change without notice.
  27. 27. All products mentioned in this presentation are for Research Use Only, not i t d d f any animal or h t intended for i l human th therapeutic or di ti diagnostic use. ti27 Confidential and Proprietary—DO NOT DUPLICATE

×