Ce diaporama a bien été signalé.
Nous utilisons votre profil LinkedIn et vos données d’activité pour vous proposer des publicités personnalisées et pertinentes. Vous pouvez changer vos préférences de publicités à tout moment.
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
1 
-1 »2« گشينه ي 
خ یبكت بّی گف ؼ مٍ ؼـ آ كًین 2 وً ؼاـ ؽً ل...
2 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
-9 »1« گشينه ي 
...
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
3 
»2« -15 گشينه ي 
هػتل x ؼـ ایي عًَ بّ خ یبكت ثب ا بٔك فًؼى...
4 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
-26 »3« گشينه ي ...
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
5 
- 
37 »2« گشينه ي 
RNA پلی هفاق II ـ یًٍَىی پی وبق بّی mRN...
6 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
-44 »1« گشينه ي ...
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
7 
»3« -56 گشينه ي 
پی ؽًَ یّؽـ لٍ یً خٍ ؼَ ؼاـؼ. هط لَّ كؼبل...
8 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
»3« -64 گشينه ي ...
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
9 
- 
73 »3« گشينه ي 
آ تًی ؽً ىٍ UGA ه وٌل ؽً ىٍ ACU اوت. ای...
11 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
-81 »2« گشينه ي...
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
11 
- 
89 »4« گشينه ي 
هٍتی آ تًی ؽً ىٍ AAG ؼـ تًید ؽً ىٍ UUC...
12 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
تًٌ :ِ ثب ت خَ ...
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
13 
- 
115 »4« گشينه ي 
اق آى خبیی اپفاى ؼـ ىّت ی ول لَ بّی ی...
14 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
جايگاه آغاس 
جا...
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
15 
»4« -123 گشينه ي 
لى وبق ؽً ی ه بْـ ؽًٌٌ ی اپفاى لي، وّ ا...
16 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
-129 »3« گشينه ...
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
17 
»2« -137 گشينه ي 
خ بًّیی یي یب ز ؽٌ لًًَئ تَیؽ لى ـا، ـ ...
18 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
»2« -147 گشينه ...
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
19 
- 
153 »3« گشينه ي 
ؿبلجبً ت ظٌین ثیبى لى ؼـ ی بًَـی تَ ب...
21 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
-162 »4« گشينه ...
) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 
Keramat A. 
21 
- 
172 »1« گشينه ي 
ایي ؼ هطون ثفای ثفـوی ػول لى اق بّ بٍ...
22 
علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي 
Keramat A. 
-179 »4« گشينه ...
Prochain SlideShare
Chargement dans…5
×

پاسخ نامه ی کامل تست های فصل1 زیست پیش دانشگاهی

2 543 vues

Publié le

پاسخ نامه ی کامل تست های فصل1 زیست پیش دانشگاهی

Publié dans : Santé & Médecine

پاسخ نامه ی کامل تست های فصل1 زیست پیش دانشگاهی

  1. 1. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 1 -1 »2« گشينه ي خ یبكت بّی گف ؼ مٍ ؼـ آ كًین 2 وً ؼاـ ؽً لؿا ج٘ن هىیف هتبث لَیىوی قیف وًی ت اَ ؽًٌ اق اـ یًتیي، ویتف لٍیي ثىبق ؽً : -2 »4« گشينه ي ثب ت خَ ث لٌٌ تًبة، ثیؽل تیت مَ ثفای ا و٘ی بٌى اق ـ یٍ ؼاؼى خ ،ًْ بّ بٍّی پفت ؼَیؽ ـا ث هطی تًٍ ضؽاهل ه تٌول فًؼ ؽً. -3 »1« گشينه ي ثیوبـی آل بٌپت ـًََیب ػًَی ثیوبـی اـثی اوت. گف ؼـ اٍهغ ت اَ ىًت ثیي یي وً ل یً)ثیوبـی آل بٌپت ـًََیب( یي وً آ كًیوی)آ فًین تدكی ؽًٌٌ ی وّ خَ تٌیىیي اویؽ( ـاثٙ ثفهفاـ ؽًٌ. ث ایي تفتیت ا ؽًی بّی ا لٍی ی ی یٌ اق ه نْ تفیي ؼـ وبل .» فّ لى هىئ لَ وبغتي یي آ كًین اوت « ظًفی بّی قیىت بٌٌوی لٌٌ گفكت. ا ؽًی ای ثیبى هی ؼاـؼ 1941 ؼ هطون ث بًم بّی خ ـَج ثیؽل اؼ اٍـؼ تیت مَ آقهبی یٍ ا دًبم ؼاؼ ؽً ه دٌف ث اـای ی ظًفی ی یي لى یي - آ كًین ؽٌ. -4 »1« گشينه ي هىیف وبغتي آـلی یٌي ثب ضؿف فّ یي اق آ كًین بّ هت هَق هی ؼٌَ. ثف وّیي اوبن هی ت اَى گلت ؼـ خ یًبكت بّی گف ا لٍ هبؼـ ث وبغتي اُـ یًتیي یًىت ؽٌ، آ كًین 1 خٍ ؼَ ؽًاـؼ. ؼـ خ یًبكت بّی گف ؼ مٍ، آ كًین 2 خٍ ؼَ ؽًاـؼ، ث وّیي ؼلیل ؼـ ایي خ یًبكت بّ ویتف لٍیي ث آـلی یٌي تجؽیل هی ؼٌَ، اهب اُـ یًتیي وًی ت اَ ؽً ث آـلی یٌي تجؽیل ؼٌَ. ؼـ خ یًبكت بّیی كو ؼـ ض ـَٕ آـلی یٌي ـ ؽٌ هی ؽًٌٌ، آ كًین 3 خٍ ؼَ ؽًاـؼ. -5 »4« گشينه ي ت بٌْ ثؼ یٕ اق بّ بّی پفت ؼیؽ ؼـ آقهبی ثیؽل تیت مَ ؼـ هطی تًٍ ضؽاهل ـ ؽٌ وًی فًؼ ؽً. -6 »1« گشينه ي ثب ت خَ ث هتي تًبة ؼـ آقهبی ثیؽل تیت مَ ا بٌـ ؽٌ گف یٍّ اق خ یبكت بّ ثفای ـ ؽٌ یًبق ث آهی اویؽ آـلی یٌي ؼا تٌ ؽٌ ث ػجبـت ؼیگف ثفغی خ یبكت بّ وً ؼـ و تٌك آهی اٌَویؽ آـلی یٌي ؽًا تٌ ؽٌ، ثل وً ؼـ و تٌك یٍتبهیي یب آهی اٌَویؽ ؼیگفی ؼا تٌ ا ؽً. -7 »2« گشينه ي ث هتي تًبة لِط ی 6 یي پبـاگفاف هب ؽً ث آغف ت خَ یًٌؽ. تًٌ :ِ وبیفگكی بّ یًك ث ـَ٘ ؿیفهىتوین طِیص ىّت ؽٌ لٍی اق تًبیح آقهبی بٍت ثیؽل تیت مَ جً ؼَ ؽً. -8 »4« گشينه ي ج٘ن لٌٌ 1 1 لِط ی 7 تًبة ؼـوی، هطی تًٍ )الق( اق عًَ ضؽاهل هطی بّی تًٍ )ة( )ج( اق عًَ بًهل - ىّت ؽٌ. هطی تًٍ ضؽاهل ضب یٍ هػل ـهیوی اق وًی فٌٌ )وب بًـق(، ا اًَع وًي بّ یٍتبهیي ثی تَیي اوت. ؼـ ؤي هطی تًٍ بٌ ؽّ، وّبى هطی تًٍ ضؽاهل هی ثب ؽٌ.
  2. 2. 2 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. -9 »1« گشينه ي ؼـ اكفاؼ هجتلا ث ثیوبـی آل بٌپت ـًََیب فّ لى هىئ لَ وبغتي یي آ كًین یًىت ز ىَ ثىیبـی اق لى بّ پف تٍئیي بّیی ـا ث ـهك ؼـ هی آ ـٍ ؽً آ كًین یًىت ؽٌ یًك ثىیبـی اق آ كًین بّ )پف تٍئیي بّ( اق ز ؽٌ ق دًیف ی پلی پپتیؽی ث خٍ ؼَ آهؽ ا ؽً ت لَیؽ فّ ق دًیف ت وَ یي لى غب ـَِت هی پؿیفؼ. -11 »4« گشينه ي ثب ثفـوی ثیوبـی آل بٌپت ـًََیب لٌٌ گفكت اكفاؼ هجتلا ث ایي ثیوبـی - » یي لى یي آ كًین « ا ؽًی بّی ا لٍی ی ظًفی ی هبؼـ ث تدكی ی وّ خَ تٌیىیي اویؽ جً ؼَ ؽً. ثبیؽ ػ اٌَى وً ؼَ: ػًَی ثیوبـی اـثی ث ؼَ ؼـ آى تدكی ی وّ خَ تٌیىیي اویؽ هت هَق هی ؼٌَ »2« ؼـ اـتجب ثب گكی ی ت لَیؽ آى. -11 »2« گشينه ي -12 »3« گشينه ي تجؽیل اـ یًتیي ث ویتف لٍیي ث وًي آ كًین وبغت ؽٌ ت وَ پًي ـًَ وٍپ ـَا فًاوب ـَِت هی پؿیفؼ اق ف٘ین ه اَؼ ه خَ ؼَ ؼـ هطی تًٍ ؿ یٌ ؽٌ .ُ ـؼ وبیف گكی بّ: هطی تًٍ ؿ یٌ ؽٌ اق اكك ؼٍى ثؼ یٕ ه اَؼ آلی ث هطی تًٍ ضؽاهل ایدبؼ هی ؼٌَ. : »1« گكی ی ك لَیي اویؽ ؼـ ت لَیؽ گلج لَ بّی هفهك تأثیفگؿاـ اوت. :»2« گكی ی آـلی یٌي ث ػ اٌَى یي آهی اٌَویؽ، ه هًََفی ثفای پلی پپتیؽ بّ پف تٍئیي بّ هی ثب ؽٌ. :»4« گكی ی -13 »3« گشينه ي ثب ت خَ ث هىیف و تٌك آـلی یٌي فّ خ یبكت ای ثب اـ یًتیي ـ ؽٌ ؽًٌ یؼ یٌ ای ویتف لٍیي ـا ث آـلی یٌي تجؽیل فًؼ اوت: -14 »4« گشينه ي الق وّ یِ ا اًَع خ یبكت بِّی یًبقه ؽٌ آـلی یٌي )گف بٍُّی ا لٍ، ؼ مٍ و مَ( ثب اكك ؼٍى آـلی یٌي ث هطی تًٍ ضؽاهل ـ ؽٌ - هی ؽًٌٌ. اهب وًیت اَى گلت وّ ی خ یبكت بِّ ثب اكك ؼٍى آـلی یٌي ـ ؽٌ هی ؽًٌٌ! قیفا خ هی ت اَ ؽً هفث ث لى ؼیگفی ثب ؽٌ. ة ضتی بّ وبلن ـًَ وٍپ ـَا هبؼـ ث وبغتي یٍتبهیي ثی تَیي یًىت! قیفا ؼـ هطی تًٍ ضؽاهل یًك ایي یٍتبهیي خٍ ؼَ ؼاـؼ. - ج فّ عًَ بّ خ یبكت ،ِ ػلا ثف آى ؼـ هطی تًٍ بًهل )هطی ضؽاهل + ا اًَع ه اَؼ آلی ه ـَؼ یًبق خب ؽًاـ( ـ ؽٌ - هی ؽًٌ، ؼـ هطی تًٍ ؿ یٌ ؽٌ ) هطی ضؽاهل + ثفغی ه اَؼ آلی( یًك هی ت اَ ؽً ـ ؽٌ ؽًٌ! ؼ ویتف لٍیي ؼـ هىیف و تٌك آـلی یٌي، پی هًبؼ ای اوت ثب ػول یي آ كًین ث آـلی یٌي تجؽیل هی ؼٌَ. -
  3. 3. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 3 »2« -15 گشينه ي هػتل x ؼـ ایي عًَ بّ خ یبكت ثب ا بٔك فًؼى ویتف لٍیي یب اـ یًتیي ـ ؽٌ هی ؽًٌ، هٙؼبً ت لَیؽ اـ یًتیي اق پی هبؼ ی ؽٌ اوت. »3« -16 گشينه ي .T,C,G ؼاـین ؼـ ـ تٌ ی ؼ مٍ A,C,G اوت.یؼ یٌ ؼـ ـ تٌ ی ا لٍ A ث ؼَ ،ُ په ـ تٌ ی ؼ مٍ نّ كبهؽ T ـ تٌ ی ا لٍ كبهؽ ثب ایي و ثبق آلی ؼـ فّ ـ تٌ هی ت اَى 33 یؼ یٌ 27 عًَ ـهك ؼـ ظًف گفكت یؼ یٌ ؼـ هدو عَ ؼ ـ تٌ 54 عًَ ـهك. اهب ؼهت هٙفش هی ؼٌَ، ثبیىتی ـهك بّی ه تٍفى ثیي ؼ ـ تٌ ـا كو یي ثبـ ؼـ DNA یًٌؽ قهبیً ثطث ا اًَع ـهك ؼـ ؼ ـ تٌ ی ، ؼـ فّ ؼ ـ تٌ خٍ ؼَ ؼاـ ؽً، 23 یؼ یٌ 8 عًَ ـهك ه تٍفى ؼاـین ثب نً فًؼى آى اق 54 C,G ظًف گفكت. ز ىَ ثبق بّی ت عٌَ ـهك ؼـ لًِ ه لَ لٌَ ث 46 هی ـوؽ. »3« -17 گشينه ي هٙلوأ ؽِم وًی ؽًٌ كو ؼـ لى بّیی ؼوت ـَ وبغتي یي ـ تٌ ی ،rRNA tRNA ؼـ ه ـَؼ لى بّی »3« گكی ی وبغت هی ؼٌَ په اق تفخو یي ـ تٌ ی پلی پپتیؽ وبغت mRNA پلی پپتیؽی ـا هی ؼ ؽٌّ، اثتؽا ث ؼ جًبل ـ یًٍَىی یي ی ثبلؾ )هبثل تفخو (ِ خٍ ؼَ ؼاـؼ ػلاهت ـهك mRNA هی ؼٌَ. ث بٌثفایي، ؼـ ایي لى بّ فّ و لًًَئ تَیؽ ـ تًٌٍَ آى بّ ؼـ یي ؽً ىٍ اوت. ؼـ ؤي ثفای ؽً ىٍ بّی پبیب یً یًك یّر آهی اٌَویؽی خٍ ؼَ ؽًاـؼ، لؿا فّ و لًًَئ تَیؽ ه خَ ؼَ ؼـ ه لَ لٌَ ػلاهت ـهك یي آهی اٌَویؽ وًی ثب ؽٌ. ،DNA »1« -18 گشينه ي ؼـ هبؼ ی ـٍاثتی فّ لًًَئ تَیؽ هؼبؼل یي ـهك آهی اٌَویؽ یًىت. ؼـ اٍهغ ـهك بّی لًًَئیي اویؽ بّ و ضفكی ىّت ؽٌ. »2« -19 گشينه ي ؼـ كفآی ؽٌ ـ یًٍَىی ؼـ هوبثل ـ تٌ ی الگ ثب لًًَئ تَیؽ تیویي ؼاـ، ـیج لًًََئ تَیؽ آؼ یًي ؼاـ هفاـ هی گیفؼ، ؼـ ضبلی ؼـ وّب ؽًٌوبقی ؼئ ىًَی ـیج لًًََئ تَیؽ آؼ یًي ؼاـ هفاـ هی گیفؼ. »3« -21 گشينه ي ثفای بٌٌوبیی ـهك بّ اوتلبؼ فًؼ ؽً. وّب ًٙ ـَ ؼـ تًبة ا بٌـ ؽٌ اوت ، mRNA یًف جًف وّ بٌـا اق ه لَ لٌَ وبغت هی ؼٌَ. II پلی هفاق RNA ؼـ ی بًَـی تَ بّ ت وَ mRNA »1« -21 گشينه ي ث ؼلیل ؼا تٌي ثبق RNA خ تْ ضف تً آ كًین اق ـاوت ث زپ اوت . ؼهت ؼا تٌ ثب یٌؽ ، RNA ثب ت خَ ث لَ٘ ـ تٌ ی ی ىٌبى ثب ؽٌ. DNA ی ـَاویل وًی ت اَ ؽً اق ظًف ت اَلی لًًَئ تَیؽی ثب »2« -22 گشينه ي اوت تفخو وًی ؼٌَ. tRNA ،III پلی هفاق RNA هط لَّ »1« -23 گشينه ي 2 ـ یًٍَىی، ؼ ـ تٌ ؼـ هفضل ی 3، و ـ تٌ ؼـ خبیگب كؼبل آ كًین ؼیؽ هی ؼٌَ. ثب ت خَ ث لٌٌ قیف ؼـ هفاضل 1 »4« -24 گشينه ي اوت ـ یًٍَىی DNA ـا ا ؽًاق ؼـ كًؼی یٌ خبیگب آؿبق ـ یًٍَىی هفاـ ؼاـؼ اهب ـ یًٍَىی وًی ؼٌَ.ای تٌف ىٍ بًم ه بٌ و٘ی اق ی ثبلؾ خٍ ؼَ ؽًاـؼ. mRNA ؽٌ اهب ؼـ »3« -25 گشينه ي آهی اویؽ اوت، ؼـ ضبلی ؼـ و گكی ی ؼیگف لًًَئ تَیؽ هی ثب ؽٌ. III پلی هفاق RNA اٍضؽ وبق ؽً ی
  4. 4. 4 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. -26 »3« گشينه ي اٍضؽ وبق ؽً ی RNA پلی هفاق III آهی اویؽ اوت، ؼـ ضبلی ؼـ و گكی ی ؼیگف لًًَئ تَیؽ هی ثب ؽٌ. -27 »1« گشينه ي خبیگب ات بّل آهی اٌَویؽ ) CCA (، ؼـ tRNA اوت لٍی وبیف ه اَـؼ ؼـ DNA ىّت ؽٌ. په عًَ آ كًیوی ؼـ وبغت آى فٌ تً ؼاـؼ، یؼ یٌ RNA پلی هفاق ثب DNA پلی هفاق، كفم ؼاـؼ. -28 »3« گشينه ي خبیگب آؿبق ـ یًٍَىی، ث ا لٍیي لًًَئ تَیؽی اق DNA گلت هی ؼٌَ ـ یًٍَىی هی ؼٌَ لى هىوتی اق DNA اوت. -29 »4« گشينه ي ـ یًٍَىی ا لٍیي هؽم ثفای وبغتي پف تٍئیي اوت ت وَ آ كًین RNA پلی هفاق ـَِت هی گیفؼ. ایي آ كًین اق هط لَّات ـیج قَ مٍ اوت. -31 »2« گشينه ي ؼـ كفآی ؽٌ ـ یًٍَىی هو يٌ یًىت هوبثل ـیج لًًََئ تَیؽ آؼ یًي ؼاـ ؼـ ـ تٌ ی الگ ،َ ـیج لًًََئ تَیؽ ی ـَاویل ؼاـ هفاـ گیفؼ. ز ىَ ـ تٌ ی الگ ،َ DNA اوت ؼـ وبغتبـ آى ؼئ ىًَی ـیج لًًََئ تَیؽ آؼ یًي ؼاـ خٍ ؼَ ؼاـؼ. -31 »2« گشينه ي خبیگب اغت بّ یِ ات بّل آهی اٌَویؽ ؼـ ه لَ لٌَ بّی tRNA هفاـ ؼاـؼ. ؼـ خب ؽًاـاى ی بًَـی تَی هب ؽًٌ آهیت، وّ ی tRNA بّ ت وَ آ كًین RNA پلی هفاق III وبغت هی ؽًٌَ. -32 »4« گشينه ي هط لَّ RNA پلی هفاق I ، rRNA اوت ػًَی اق آى ؼـ ثػ ثكـ ـیج قَ مٍ ثبػث ایدبؼ پی ؽًَ پپتیؽی ثیي آهی اٌَویؽ بّ هی ؼٌَ ث بٌثفایي پبوع ثبیؽ پف تٍئی یٌ ثب ؽٌ كو ؼـ ی بًَـی تَ بّ ؼیؽ هی ؼٌَ قیفا RNA پلی هفاق I كو ؼـ ی بًَـی تَ بّ خٍ ؼَ ؼاـؼ. پبؼتي پف تٍئی یٌ غب ی بًَـی تَ بّ اوت؛ ضبل آى RNA پلی هفاق نّ ؼـ ی بًَـی تَ بّ نّ ؼـ پف بًٍـی تَ بّ ؼیؽ هی ؼٌَ. ه بْـ ؽًٌٌ ی اپفاى لي، غب پف بًٍـی تَ بّوت. -33 »2« گشينه ي لًًَئ تَیؽ گ اَ یًي ؼاـ ؼـ DNA ، لًًَئ تَیؽی پ ـَی یٌ ثب ه ؽٌ ؼئ ىًَی ـیج قَ اوت ؼـ ی٘ ـ یًٍَىی ؼـ هوبثل لًًَئ تَیؽ ویت قَیي ؼاـ ) لًًَئ تَیؽی پیفیویؽی یٌ( هفاـ هی گیفؼ ؼاـای ه ؽٌ ـیج قَ اوت. -34 »1« گشينه ي ؼـ هفضل ی ؼ مٍ ـ یًٍَىی پی ؽًَ یّؽـ لٍ یً ؼـ ه ٌٙو ای كًؼیي ث ـا ا ؽًاق ىٌٌت هی ؼٌَ. وّس یٌي ؼـ هفضل ی و مَ ـ یًٍَىی پی ؽًَ یّؽـ لٍ یً ثیي RNA ـ تٌ ی الگ ىٌٌت هی ؼٌَ تب RNA اق DNA خؽا گفؼؼ. اهّب پی ؽًَ كىل ؼَی اوتف كو ؼـ هفضل ی 3 ـ یًٍَىی ایدبؼ هی ؼٌَ. ؼـ ؤي، ؼـ ضیي ضف تً RNA پلی هفاق ؼـ هفضل ی 3 ، پی ؽًَ بّی یّؽـ لٍ یً ثیي ؼ ـ تٌ ی DNA ؼـ بًضی ی لى یًك ىٌٌت هی ؽًٌَ. -35 »1« گشينه ي لى 2 ؼـ وبغتبـ اپفاى لي ـا ا ؽًاق بًضی ی پبیبى ـ یًٍَىی ؽًاـؼ. لى بّیی اق ـ یٍ آى بّ tRNA rRNA وبغت هی ؽًٌَ، هط لَّ پف تٍئی یٌ ؽًاـ ؽً. هط لَّ RNA پلی هفاق II پی وًبق mRNA RNA بّی زًَي اوت، په هی ت اَ ؽً هط لَّ ایي آ كًین پی وًبق mRNA جًب ؽٌ. -36 »4« گشينه ي ؼـ ـ یًٍَىی ی یٌ اق ؼ ـ تٌ ی DNA ث ػ اٌَى الگ ػول هی ؽًٌ. ـؼ وبیف گكی بّ: وّ ی لى بّ هىئ لَ وبغت پلی پپتیؽ یًىت ؽٌ. : »1« گكی ی :»2« گكی ی RNA ی پیي اق ـ یًٍَىی لى بّی هىئ لَ وبغت پلی پپتیؽ ایدبؼ هی ؼٌَ. خبیگب آؿبق ـ یًٍَىی ؼـ كًؼی یٌ ـا ا ؽًاق هفاـ ؼاـؼ. »3« گكی ی
  5. 5. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 5 - 37 »2« گشينه ي RNA پلی هفاق II ـ یًٍَىی پی وبق بّی mRNA بّ یًك ثفغی اق RNA بّی زًَي ـا ا دًبم هی ؼ ؽّ. RNA پلی هفاق III ـ یًٍَىی لى بّی tRNA یًك ثؼ یٕ ؼیگف اق RNA بّی زًَي ـا بًتبلیك هی ؽًٌ. -38 »2« گشينه ي ـ یًٍَىی ا لٍیي هؽم ثفای وبغت پف تٍئیي بّوت ؼـ ىٍ هیت ؽًٌَـی لًف پٍلاوت ثب ػول تفخو ؼـ یي هطل ا دًبم هی گیفؼ. -39 »3« گشينه ي ـ تٌ ی الگ ثفای وّب ؽًٌوبقی ـ یًٍَىی، ه لَ لٌَ DNA اوت ؼاـای ه ؽٌ ؼئ ىًَی ـیج قَ اوت. -41 »1« گشينه ي ؼـ ػول فٌؼ یي آ كًین DNA پلی هفاق یي آ كًین RNA پلی هفاق كو یي ـ تٌ ی DNA ث ػ اٌَى الگ ػول هی ؽًٌ ؼـ اثف ػول فّ ؽًام اق آ كًین بّی بًم ثفؼ ؽٌ كو یي ـ تٌ )ؼئ ىًَی ـیج لًًََئ تَیؽی ؼـ اثف كؼبلیت DNA پلی هفاق ـیج لًًََئ تَیؽی ؼـ اثف كؼبلیت RNA پلی هفاق( ت لَیؽ هی ؼٌَ. هی ؼا یًن ثفای ت یٌٍل ـ تٌ ی پلی لًًَئ تَیؽی پی ؽًَ كىل ؼَی اوتف ت یٌٍل هی ؼٌَ. په ت بٌْ ه ـَؼی ؼـ ثیي ػ اَهل ؾ فً ؽٌ ؼـ ثیي ؼ آ كًین بًم ثفؼ ؽٌ هتلب تٍ اوت عًَ پی هبؼ ی آى بّوت ثفای DNA پلی هفاق، ؼئ ىًَی ـیج لًًََئ تَیؽ ثفای RNA پلی هفاق ـیج لًًََئ تَیؽ اوت. -41 »2« گشينه ي لى بّ هىوتی اق ه لَ لٌَ DNA ىّت ؽٌ ؼـ ىّت ی ول لَ بّی ی بًَـی تَی ؼـ وبغتبـ فً هٍ قَ مٍ بّ هفاـ ؼاـ ؽً. فً هٍ قَ مٍ بّی وّتب، فً هٍ قَ مٍ بّیی ىّت ؽٌ ا ؽًاق ،ُ لٌٌ هطت اَی ل تًیي آى بّ ه بٍث اوت، په خبیگب لى بّی ه بٍث ـ یٍ فً هٍ قَ مٍ بّی وّتب ه بٍث اوت. ـؼ وبیف گكی بّ: هی ت اَى ؾ فً فًؼ خٍ ؼَ خ بًّی خب یًٍ یٌ ثی اثف ؼـ ی یٌ اق لى بّ عًَ »4« ػلا ثف ت یَٔص گكی ی :»1« گكی ی لًًَئ تَیؽ بّ ـا تـییف هی ؼ ؽّ اهب پلی پپتیؽ ضب لِ ؼزبـ تـییف وًی ؼٌَ. ؼـ ایي ضبلت كفؼ هَّ قَیگ نَ اوت تّف قٍیگ نَ. :»3« گكی ی اگف ی یٌ اق ایي پلی پپتیؽ بّ ؼـ پف بًٍـی تَی ظًیف :»4« گكی ی E.Coli ایدبؼ ؼٌَ ؼیگفی ؼـ ی بًَـی تَی هثل ا ىًبى ؼیؽ ؼٌَ، ز ىَ ؼـ ی بًَـی تَ بّ لى بّ گىىت ا ؽً ؼاـای وبغتبـ اگك ىٍ ای تٌف ىٍ ا ؽً، ث ـَ٘ هٙغ mRNA بّی ضب لِ اق ـ یًٍَىی اق لطبٚ ت اَلی لًًَئ تَیؽی هتلب تٍ ا ؽً. -42 »3« گشينه ي گٌّبهی آ تًی ؽً ىٍ GAG ث خبیگب P ـیج قَ مٍ اٍـؼ هی ؼٌَ ؼـ خبیگب P ؽً ىٍ CUC هفاـ ؼا تٌ ثب ؽٌ. ؽً ىٍ CUC وٌٍیي ؽً ىٍ mRNA كف یٔ اوت ثفای هفاـ گفكتي آى ؼـ خبیگب P، ـیج قَ مٍ 5 ثبـ خبث خبیی ا دًبم ؼاؼ اوت. تفخو ی mRNA اق ؽً ىٍ آؿبق (AUG) فٌ عٍ هی ؼٌَ. -43 »1« گشينه ي وّبى ـَ٘ ؼـ لٌٌ قیف ه بٍ ؽّ هی یًٌؽ وبغت ز ؽٌ RNA اق ـ یٍ لى، وبغتبـ پف هب ؽًٌی ـا ث وًبی هی گؿاـؼ.
  6. 6. 6 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. -44 »1« گشينه ي اق ـ یٍ یي لى كو یي عًَ RNA پلی هفاق ػول ـ یًٍَىی ـا ا دًبم هی ؼ ؽّ وبغتبـ پف هب ؽًٌ ث ؼلیل ـ یًٍَىی بّی نّ قهبى اق ـ یٍ یي لى ی بًَـی تَی ت وَ ز ؽٌیي RNA پلی هفاق اهب اق یي عًَ هی ثب ؽٌ. ـ تٌ بّی ه ؼٌٍجی ؼـ لٌٌ 1 4 ؼـ - لِط ی 11 ؼیؽ هی ؼٌَ RNA بّیی ىّت ؽٌ ث ـَ٘ نّ قهبى ؼـ ضبل وبغت ؽٌى هی ثب ؽٌٌ. نّ ز یٌي خب ؽًاـ ه ـَؼ هٙبلؼ ی ثیؽل تیت مَ هبـذ ـًَ وٍپ ـَا فًاوب )ی بًَـی تَ( هی ثب ؽٌ. -45 »3« گشينه ي ـ تٌ بّی ه ؼٌٍت، RNA بّی ؼـ ضبل وبغت ىّت ؽٌ اق لطبٚ لَ٘ )تؼؽاؼ لًًَئ تَیؽ( ثب نّ هتلب تٍ ىّت ؽٌ. -46 »4« گشينه ي لًًَئ تَیؽ بّی ه ـَؼ اوتلبؼ ؼـ وّب ؽًٌوبقی اق عًَ ؼئ ىًَی ـیج لًًََئ تَیؽا ؽً لٍی لًًَئ تَیؽ بّی ه ـَؼ اوتلبؼ ؼـ ـ یًٍَىی اق عًَ ـیج لًًََئ تَیؽا ؽً. ایي لًًَئ تَیؽ بّ اق ظًف عًَ ه ؽٌ ثب نّ بًهلاً هتلب تٍ ا ؽً اهب اق ظًف ثبق آلی هثل آؼ یًي ، گ اَ یًي ویت قَیي جٌب تّ ؼاـ ؽً. -47 »2« گشينه ي ـ تًٌٍَ ای تٌف ىٍ اگك ىٍ ؼـ mRNA بّی ا لٍی ی ول لَ بّی ی بًَـی تَی خٍ ؼَ ؼاـؼ. ث بٌثفایي ؼـ ه لَ لٌَ بّی ضب لِ اق RNA پلی هفاق ؼـ ول لَ تػن ؼ قٍیىت ـ تًٌٍَ ای تٌف ىٍ هی ت اَ ؽً خٍ ؼَ ؼا تٌ ثب ؽٌ. -48 »2« گشينه ي ؼـ وبغتبـ پف هب ؽًٌ په اق ات بّل ا لٍیي آ كًین RNA پلی هفاق ث ـا ا ؽًاق لى فٌ عٍ ـ یًٍَىی، آ كًین بّی RNA پلی هفاق ثؼؽی ث ـا ا ؽًاق لى هت لّ ـ یًٍَىی ـا فٌ عٍ هی ؽًٌٌ. ؼـ تًید پی اق پبیبى یبكتي ـ یًٍَىی آ كًین بّی ا لٍی ،ِ آ كًین بّی ثؼؽی هی ت اَ ؽًٌ ـ یًٍَىی غ ؼَ ـا فٌ عٍ وًبی ؽٌ. ـؼ وبیف گكی بّ: كؼبلیت نّ قهبى ز ؽٌیي :»1« گكی ی RNA پلی هفاق ثفای ت لَیؽ ز ؽٌیي ه لَ لٌَ RNA اوت. ثیبى نّ قهبى یي لى ز ؽٌیي لى ؼـ خ تْ ت لَیؽ ز ؽٌیي :»3« گكی ی RNA ه بٍث نّ اوت. ؼـ ایي ضبلت فّ لى ت بٌْ ؼاـای یي خبیگب فٌ عٍ ـ یًٍَىی اوت. :»4« گكی ی -49 »4« گشينه ي ثب ت خَ ث ایي لٌٌ، یي لى ی بًَـی تَی ـا بًٍى هی ؼ ؽّ، ز ؽٌیي ػؽؼ RNA پلی هفاق اق یي عًَ ؼـ ضبل ـ یًٍَىی ىّت ؽٌ. RNA بّی ووت ـاوت ثل ؽٌتف اق RNA بّی ووت زپ ىّت ؽٌ په اق ظًف تؼؽاؼ لًًَئ تَیؽ بّ، RNA بّی ووت ـاوت تؼؽاؼ لًًَئ تَیؽ ثی تًفی ؼاـ ؽً، ث بٌثفایي خ تْ ـ یًٍَىی اق زپ ث ـاوت اوت. -51 »2« گشينه ي اگف ز ؽٌ RNA پلی هفاق ث ـَِت نّ قهبى اق ـ یٍ یي لى ـ یًٍَىی ؽًٌٌ آى گب RNA بّی وبغت ؽٌ اق ـ یٍ لى وبغتبـ پفهب ؽًٌی ـا ث وًبی هی گؿاـ ؽً. ایي وبغتبـ ث وًي پف تٍئیي بّی هػ یَِّ ث بًم ػ اَهل ـ یًٍَىی لٌٌ هی گیفؼ. -51 »3« گشينه ي ؽً ىٍ بّ ـهك بّی و ضفكی ؼـ mRNA ىّت ؽٌ، لؿا ؼـ وبغتبـ غ ؼَ كبهؽ ثبق آلی تیویي هی ثب ؽٌٌ. اق ف٘كی یي عًَ آهی اٌَویؽ هی ت اَ ؽً ثب ز ؽٌ عًَ ؽً ىٍ هػتلق ـهك ؼٌَ لٍی یي ؽً ىٍ وًی ت اَ ؽً ثفای ز ؽٌ عًَ آهی اٌَویؽ هػتلق ه ـَؼ اوتلبؼ هفاـ گیفؼ. ؼهت ؼا تٌ ثب یٌؽ ؽً ىٍ بّ ػو هَی ىّت ؽٌ، یؼ یٌ ؼـ خب ؽًاـاى هػتلق ی ىٌبى هی ثب ؽٌٌ. -52 »4« گشينه ي آ تًی ؽً ىٍ تؼییي هی ؽًٌ آى tRNA ز آهی اویؽی ـا ثبیؽ ضول ؽًٌ. آ تًی ؽً ىٍ هتی یًَي نّ UAC اوت. -53 »2« گشينه ي ویتف لٍیي پی هبؼ ی آهی اٌَویؽ اوت آهی اٌَویؽ، ث بٌثفایي ؼـ DNA ـهكی ثفای آى خٍ ؼَ ؽًاـؼ. -54 »3« گشينه ي ؼـ آقهبی یًف جًف فِكبً اق لًًَئ تَیؽ بّی ی ـَاویل ؼاـ ) U( اوتلبؼ ؽٌ بًٍى ؼاؼ ثؽ ىٍ AUG آؿبقی یًك تفخو اه بٌى پؿیف اوت.وبیف گكی بّ تًید ی پم وبیف هطووبى ث ؼَ. -55 »1« گشينه ي یًف جًف وّ بٌـاى ا ا لٍیي گف یٍّ ث ؼَ ؽً ه كَن ث قًٍ ـهك DNA ؽٌ ؽً. هجل اق آى ث وٍیل ی آقهبی بًّیی ه ػٍ ؽٌ ث ؼَ ـهك بّی DNA ؼـ تًید ـهك بّی RNA و لًًَئ تَیؽی ىّت ؽٌ.
  7. 7. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 7 »3« -56 گشينه ي پی ؽًَ یّؽـ لٍ یً خٍ ؼَ ؼاـؼ. هط لَّ كؼبلیت DNA اوت. ثیي ؼ ـ تٌ یِ DNA پلیهفاق، ه لَ لٌَ DNA هط لَّ كؼبلیت یًك پی ؽًَ یّؽـ لٍیً خٍ ؼَ ؼاـؼ. tRNA اوت. ؼـ ثفغی ه بٌ ن٘ RNA پلیهفاق، ه لَ لٌَ RNA ثفـوی وبیف گكی بٌِّ: پلی هفاق ث هىوتی اق لى ث بًم ـا اُ ؽًاق فٌ عٍ هی ؼٌَ. RNA ـ یًٍَىی ثب ات بّل :»1« گكی ی اوتلبؼ فًؼ ؽً. آ بًى ا اًَع غب یِ اق ه لَ لٌَ DNA ثفای بٌٌوبیی ـهك بّی mRNA یًف جًف وّ بٌـا اق :»2« گكی ی ـا وبغت ؽٌ. mRNA هی ت اَ ؽً ق دًیف ای اق mRNA ، ؼـ ل لَ ی آقهبی یٍ آهی اٌَویؽ بّ تؼؽاؼی آ كًین خٍ ؼَ ؼا تٌ ثب ؽٌ :»4« گكی ی آهی اٌَویؽ بّ ـا ثىبقؼ. قدًیف یُ آهی اٌَویؽ بّ وّبى پلی پپتیؽ اوت. »2« -57 گشينه ي ت لَیؽ فًؼ ؽً. mRNA ثفاوبن خول تًبة ؼـوی ؼـ لِط ی 12 ، یًف جًف وّ بٌـا ا اًَع غب یِ اق ه لَ لٌَ بّی ـؼ وبیف گكی بّ: و ضفكی اوت هجل اق یًف جًف ادًبم ؽٌ ث ؼَ. DNA قًٍ ای ـهك بّی :»1« گكی ثؼؽاً هطووبى ؼیگف ثب اخفای آقهبی بًّی ه بٍث ت اَ ىًت ؽٌ ـهك فّ یي اق 21 عًَ آهی اویؽ ـا بٌٌوبیی ؽًٌٌ. :»3« گكی ؼـ ل لَ ی آقهبی هبیغ اوتػفاخی اق ویت پَلاون ول لَی ث ؼَ. :»4« گكی »2« -58 گشينه ي ـاثٙ ی ه وٌلی ثیي لًًَئ تَیؽ بّی ه خَ ؼَ ؼـ ایي ه لَ لٌَ ، ه خَت ایدبؼ ز یٌي وبغتبـی ؽٌ اوت. »3« -59 گشينه ي اوت. L ؼـ ول لَ، جٌی ضفف tRNA وبغتبـ و ثؼؽی »4« -61 گشينه ي ی الگ DNA: AGC.GAC.CAG.CTG ؽً ىٍ بّ : UCG.CUG.GUC.GAC آ تًی ؽً ىٍ : AGC.GAC.CAG.CUG »4« -61 گشينه ي ی بًهل ث گً ؼاـی آى ـ یٍ ـیج قَ مٍ وًي هی ؽًٌ. RNA یب tRNA ؼ ضلو ی خب جًی پی ؽًَ یّؽـ لٍ یً ایدبؼ هی ؼٌَ ضلو ی آى هفث ث ثػ بّیی اوت ـاثٙ ی ه وٌلی ؽًاـؼ. tRNA ثیي ثػ بًّی ه وٌل بّ ؼاـای یي خبیگب ات بّل آهی اٌَویؽ tRNA ؼـ ؼـ ىٍ ـیج قَ مٍ هی ت اَ ؽً ثی اق یي آهی اٌَویؽ هت لّ ثب ؽٌ. وّ ی tRNA ث ىّت ؽٌ . CCA ثب ت اَلی »3« -62 گشينه ي هی ثب ؽٌ اق ف٘ین لًًَئ تَیؽ CCA اوت ؼاـای خبیگب ات بّل آهی اٌَویؽ اغت بّ یِ tRNA ه لَ لٌَ ؼاـای آ تًی ؽً ىٍ وّبى آؼ یًي ؼاـ ث آهی اویؽ اغت بّ یِ هت لّ هی ؼٌَ. ـؼ وبیف ه اَـؼ: بّی پف بًٍـی تَی بِؼم یًىت. tRNA ؼـ ه ـَؼ :» الق « ه ـَؼ اوت. L ؼـ ول لَ جٌی ضفف tRNA وبغتبـ و ثؼؽی :» ج« ه ـَؼ 3 ضلو ؼاـؼ 2 ضلو ث گً ؽْاـی آى ثف ـ یٍ ـیج قَ مٍ وًي هی ؽًٌٌ. tRNA فّ :» ؼ« ه ـَؼ »4« -63 گشينه ي هفاـ هیگیفؼ. P ی آؿبقگف كو ؼـ خبیگب tRNA - - ػلا ثف آ تًی ؽً ىٍ ت وَ ؼ ثبق یٍ بًٌـی غ ؼَ ـ یٍ ـیج قَ مٍ گً ؽْاـی هی ؼٌَ. اوت. L - وبغتبـ و ثؼؽی آى ؼـ ول لَ جٌی ضفف آمينواسيد لوسين
  8. 8. 8 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. »3« -64 گشينه ي تؼییي هی ؽًٌ ز عًَ آهی اٌَویؽی ثبیؽ ضول ؼٌَ، ت اَلی آ تًی ؽً ىٍ اوت اق ف٘كی ز ىَ ثفای ؽً ىٍ بّی tRNA ت اَلی ؼـ اوت، وًی ت اَ ؽً ثفای یّر عًَ UAG ه وٌل ؽً ىٍ پبیبى )AUC( ای خٍ ؼَ ؽًاـؼ، لؿا گكی ی 3 tRNA پبیبى یّر آهی اٌَویؽی خٍ ؼَ ؼا تٌ ثب ؽٌ. »4« -65 گشينه ي ثب ت خَ ث لٌٌ قیف ه ظٌ ـَ اق بًهل ؽٌى وبغتبـ ـیج قَ مٍ، ات بّل ثػ ثكـ ث ثػ زًَي اوت. وپه هفضل ی اؼاه ـیج قَ مٍ ـَِت هی گیفؼ. تفخو ی ا لٍیي ؽً ىٍ هجل اق ات بّل ؼ ثػ A فٌ عٍ هی ؼٌَ، لؿا تفخو ی ؼ هٍیي ؽً ىٍ ؼـ خبیگب ـَِت گفكت اوت. ، P ـیج قَ مٍ ث نّ ؼـ خبیگب »4« -66 گشينه ي یي ـیج قَ مٍ وبغت هی ؼٌَ لٍی ثفای فّ آهی اٌَویؽ یًبق ث یي mRNA یي ق دًیف ی پلی پپتیؽی ت وَ یي لى، یي یًبق اوت. tRNA اوت، لؿا ؼـ ایي خب ث تؼؽاؼ قیبؼی tRNA »3« -67 گشينه ي ؼـ هفضل ی آؿبق پف تٍئیي وبقی پی ؽًَ یّؽـ لٍ یً ثیي ؽً ىٍ آ تًی ؽً ىٍ ت یٌٍل هی ؼٌَ، ؼـ ضبلی ؼـ هفضل ی پبیبى ز ىَ یّر آ تًی ؽً یًٍ ثفای ؽً ىٍ پبیبى خٍ ؼَ ؽًاـؼ، لؿا یّر پی ؽًَ یّؽـ لٍ یً ت یٌٍل وًی ؼٌَ لٍی گٌّبم خؽا ؽٌى وّ ی اخكا اق نّ پی ؽًَ ثیي ؽً ىٍ آ تًی ؽً ىٍ ىٌٌت هی ؼٌَ. »2« -68 گشينه ي ؼـ كفای ؽٌ تفخو ؼـ اٍهغ قثبى لًًَئیي اویؽی ثب ضف فٍ لًًَئ تَیؽی اوت ث قثبى پف تٍئیي ثب ضف فٍ آهی اٌَویؽی اوت، mRNA ـ یٍ tRNA تفخو هی ؼٌَ. ث بٌثفایي ج٘ن خول ی تًبة ؼـوی، تفخو ؼـ اٍهغ قهب یً ـظ هی ؼ ؽّ آ تًی ؽً ىٍ هفاـ گفكت هؼبؼل آهی اٌَویؽی یي ؽً ىٍ ه ػٍ ؼٌَ. »2« -69 گشينه ي وًی ت اَ ؽً الگ یَ وبغت آ تًی TGA آ تًی ؽً ىٍ خٍ ؼَ ؽًاـؼ. ث بٌثفایي ت اَلی )UAG UGA ،UAA( ثفای ؽً ىٍ بّی پبیبى ؽً ىٍ ثب ؽٌ. »2« -71 گشينه ي ز ىَ پلی پپتیؽ وبغت ؽٌ 3 آهی اویؽ ؼاـؼ ، ث بٌثفایي، اق ـهك آؿبق تب پبیبى 4 ؽً ىٍ غ اَ یّن ؼا تٌ اق ف٘كی ؽً ىٍ پبیبى اٍـؼ 1 هت خَ غ اَ یّؽ ؽٌ الق ػبهل پبیبى تفخو اوت، ثب ـٍ ؼٍ ػبهل پبیبى تفخو ،ِ - وًی ؼٌَ. ثب هفاخؼ ث لٌٌ 8 P خبیگب ـا ثب پلی پپتیؽ یّؽـ لٍیك هی ؽًٌ. P ؼـ خبیگب tRNA یي آ كًین پی ؽًَ ثیي آغفیي »2« -71 گشينه ي ی غ ؼَ خؽا هی ؽًٌَ. ث ؿیف اق آغفیي tRNA ـیج قَ مٍ اق P ت خَ ؼا تٌ ثب یٌؽ وّ ی آهی اٌَویؽ بّ وّ اَـ ؼـ خبیگب خؽا tRNA ی غ ؼَ خؽا هی ؼٌَ، وبیف آهی اٌَویؽ بّ ؼـ هفضل ی اؼاه اق tRNA آهی اٌَویؽ ؼـ هفضل ی پبیبى تفخو اق هی ؽًٌَ. »4« -72 گشينه ي هی ؽًٌَ كو ؽً ىٍ پبیبى اٍـؼ P یی هثلاً ثب 11 ؽً ىٍ، 9 ؽً ىٍ 9 آ تًی ؽً ىٍ اٍـؼ خبیگب mRNA ؼـ كفای ؽٌ تفخو ی هی ؼٌَ. ث گ ای كو ؽً ىٍ آؿبق اٍـؼ آى خبیگب وًی ؼٌَ A وًی ؼٌَ. ؼـ ایي ضبلت 9 ؽً ىٍ نّ اٍـؼ خبیگب P خبیگب وًی ؼٌَ، په ؼـ هدو عَ 8 آ تًی ؽً ىٍ A لٍی آ تًی ؽً ىٍ ه وٌل ؽً ىٍ پبیبى)ا لِاً خٍ ؼَ ؽًاـؼ( آ تًی ؽً ىٍ آؿبق اٍـؼ خبیگب هی ؼٌَ. A اٍـؼ خبیگب
  9. 9. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 9 - 73 »3« گشينه ي آ تًی ؽً ىٍ UGA ه وٌل ؽً ىٍ ACU اوت. ایي ؽً ىٍ اثتؽا اٍـؼ خبیگب A هی ؼٌَ، وپه اٍـؼ خبیگب P هی ؼٌَ. ثؼؽ اق اٍـؼ ؽٌى ایي tRNA ث خبیگب A ، آهی اٌَویؽ یب پلی پپتیؽ هت لّ ث tRNA ی ه خَ ؼَ ؼـ خبیگب P اق هطل غ ؼَ ثل ؽٌ ؽٌ ث آهی اٌَویؽ ایي tRNA هت لّ ؽٌ وپه tRNA ی ه خَ ؼَ ؼـ خبیگب P ، ایي خبیگب ـا تفى هی ؽًٌ خبیگب P پؿیفای tRNA ی ه خَ ؼَ ؼـ خبیگب A هی ؼٌَ. -74 »3« گشينه ي آهی اٌَویؽ بّ ث لًًَئ تَیؽ آؼ یًي ؼاـ tRNA هت لّ ا ؽً گٌّبم تفخو ،ِ ؼـ خبیگب P ـیج قَ مٍ اق آى خؽا هی ؽًٌَ. -75 »4« گشينه ي ؼـ ی بًَـی تَ بّ، ػلا ثف ـا ا ؽًاق، هؼو لَاً ت اَلی بّی ؼیگفی اق DNA یًك ؼـ ـ یًٍَىی ؼغبلت ؼاـ ؽً ػ اَهل ـ یًٍَىی ث آى بّ یًك هت لّ هی ؽًٌَ. اككای ؽٌ ،ُ ثػ یٍ اق ه لَ لٌَ DNA اوت ث وًي ػ اَهل ـ یًٍَىی هت لّ ث آى، ػول ـ یًٍَىی ـا تو یَت هی ؽًٌ. اككای ؽٌ ،ُ ثفغلاف ـا ا ؽًاق، هو يٌ اوت كّاـاى لًًَئ تَیؽ اق لى كب لِ ؼا تٌ ثب ؽٌ. -76 »4« گشينه ي ثىیبـی اق پف تٍئیي بّ ؼـ وبغتبـ غ ؼَ ز ؽٌ ق دًیف ی پلی پپتیؽی ؼاـ ؽً وبغت فّ ق دًیف ت وَ یي لى ـ جّفی هی ؼٌَ. ثب 2ٍ بًؼـوت هی ؽًٌَ اگف پف تٍئیي اق یي ق دًیف ی پلی پپتیؽی ت یٌٍل ؽٌ ثب ؽٌ، ثب یي ایي ت یَٔص تًبة، گكی بّی 1 ـیج قَ مٍ وبغت هی ؼٌَ لؿا گكی ی 3 یًك بًؼـوت هی ثب ؽٌ، اهب اگف پف تٍئیي یي ق دًیف ای یب ز ؽٌ ق دًیف ای ثب ؽٌ ؼـ فّ ؼ ضبلت ثفای وبغت آى ث ز ؽٌیي آ كًین هثل ا اًَع RNA پلی هفاق نّ ز یٌي آ كًین بّی فٌ تً ؽًٌٌ ؼـ كفای ؽٌ پفؼاقي mRNA تفخو یًبق اوت. -77 »4« گشينه ي -78 »3« گشينه ي وبغتبـ و ثؼؽی tRNA ؼـ ىٍ ول لَ، جٌی ضفف L اوت. وّ ی tRNA بّ ث خك tRNA ی آؿبقگف، ث خبیگب A ـیج قَ مٍ اٍـؼ اق خبیگب P ـیج قَ مٍ غبـج هی ؽًٌَ ؼـ ضبلی tRNA ی آؿبقگف ث خبیگب P اٍـؼ اق وّبى خب یًك غبـج هی گفؼؼ. ؼـ ؤي، ت اَلی CCA ؼـ یي ا تً بْی tRNA هفاـ ؼاـؼ لًًَئ تَیؽ A ؼاـ آى، هطل ات بّل آهی اٌَویؽ اوت. -79 »3« گشينه ي ؼـ هفضل ی آؿبق تفخو ،ِ ؼـ خبیگب P ـیج قَ مٍ، پی ؽًَ یّؽـ لٍ یً ت یٌٍل هی ؼٌَ، اهب ؼـ هفضل ی پبیبى تفخو ز ىَ tRNA اٍـؼ خبیگب A ـیج قَ مٍ وًی ؼٌَ، پی ؽًَ یّؽـ لٍ یً ت یٌٍل وًی گفؼؼ. -81 »3 « گشينه ي ثب ت خَ ث لٌٌ لِط یِ 12 هت خَ هی یٌَن UUU ؽً ىٍ ك یٌل آلا یًي اوت ) آ تًی ؽً ىٍ ك یٌل آلا یًي( آ تًی ؽً ىٍ آى ثف ـ یٍ ه لَ لٌَ tRNA ، AAA هیثب ؽٌ. آهی اٌَویؽ وٌبـ یُ 1، هتی یًَي اوت. ؼـ ؤي ؼـ لِط یِ 15 تًبة هیغ اَ یًؽ ؽً ىٍ آؿبق ؼـ خبیگب P تفخو هی ؼٌَ، ؼـ ضبلی ؽً ىٍ وبیف آهی اٌَویؽ بّ ؼـ خبیگب A تفخو هی ؼٌَ.
  10. 10. 11 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. -81 »2« گشينه ي هٍتی آغفیي tRNA اٍـؼ خبیگب A هی ؼٌَ، پی ؽًَ پپتیؽی ت یٌٍل هی ؼٌَ، وپه ـیج قَ مٍ یي ؽً ىٍ خبث خب هی ؼٌَ تب ث ؽً ىٍ پبیبى ثفوؽ. ثب ـٍ ؼٍ ػبهل پبیبى تفخو ث خبیگب A ، آ كًیوی كؼبل هی ؼٌَ پی ؽًَ ثیي آغفیي tRNA پلی پپتیؽ هت لّ ث آى ـا یّؽـ لٍیك هی ؽًٌ، وپه وّ ی اخكا اق نّ خؽا هی ؽًٌَ. -82 »4« گشينه ي ؽً ىٍ بّی پبیبى ) UGA (، آ تًی ؽً ىٍ ؽًاـ ؽً! GCA. AUG. UGU. UUU. UGC. UGA. GUA پبیبى ویىتئیي ك یٌل آلا یًي ویىتئیي هتی یًَي – - - - ثب ت خَ ث ف٘ش ثبلا، آغفیي tRNA ی اٍـؼ ؽٌ ث خبیگب A، آ تًی ؽً ىٍ ACG غ اَ ؽّ ؼا تٌ. -83 »1« گشينه ي هفضل ی پبیبى تفخو :ِ هٍتی ی یٌ اق ؽً ىٍ بّی پبیبى ؼـ ىٍ خبیگب A هفاـ گیفؼ، تفخو پبیبى هی پؿیفؼ. ز ىَ یّر tRNA ای ثفای ؽً ىٍ بّی پبیبى خٍ ؼَ ؽًاـؼ. ؼـ ایي ضبلت ؼ ثػ ـیج قَ مٍ، mRNA پف تٍئیي وبغت ؽٌ اق یي ؼیگف خؽا هی ؽًٌَ. -84 »2« گشينه ي ثب ت خَ ث ؽً ىٍ آؿبق پبیبى، ا لٍیي آ تًی ؽً یًٍ ؼـ خبیگب A هفاـ هی گیفؼ ثب ت خَ ث ؽً ىٍ UCC ، AGG اوت آغفیي ؽً یًٍ ؼـ خبیگب P هفاـ هی گیفؼ، UGC هی ثب ؽٌ. -85 »3« گشينه ي tRNA ی كبهؽ آهی اٌَویؽ اق خبیگب P غبـج هی گفؼؼ، ث بٌثفایي،ضف تً ـیج قَ مٍ ث ووت ثػ )الق( یؼ یٌ ث ووت خبیگب A هی ثب ؽٌ.ثب ت خَ ث خٍ ؼَ و آهی اٌَویؽ، tRNA ی ه خَ ؼَ ؼـ خبیگب A ، tRNA ی و مَ اوت. اق آى خبیی tRNA ی آؿبقگف اٍـؼ P ؽٌ اق وّبى خبیگب نّ غبـج هی ؼٌَ ث بٌثفایي خبیگب A تب ىًٌَ ؼ tRNA ؼـیبكت فًؼ اوت.ـیج قَ مٍ ؼـ ا لٍیي ضف تً غ ؼَ اق ؽً ىٍ بّی 2ٍ 1 ث ؽً ىٍ بّی 3ٍ 2 ه تٌول ؽٌ ؼـ ضبل ضب فٔ آهبؼ ی ا دًبم ؼ هٍیي ضف تً غ ؼَ هی ثب ؽٌ. -86 »2« گشينه ي RNA پلی هفاق II ؼـ ىّت ی ول لَ، پی وًبق بّی mRNA ( mRNA ا لٍی (ِ ـا هی وبقؼ. وبیف گكی بّ: آهی اٌَویؽ بّ ؼـ خبیگب :»1« گكی ی P ـیج قَ مٍ اق لًًَئ تَیؽ آؼ یًي ؼاـ خؽا هی ؽًٌَ. هٍتی :»3« گكی ی tRNA خبیگب A ضب یٍ 11 اویؽآهی ثب ؽٌ، ؽً ىٍ 9 ؼـ خبیگب P هفاـ ؼاـؼ. ثفای ت یٌٍل پ دٌویي پی ؽًَ پپتیؽی، ـ تٌ ی پپتیؽی ضب یٍ 5 اویؽآهی ث :»4« گكی ی tRNA ی خبیگب A ه تٌول هی ؼٌَ. -87 »2« گشينه ي هفضل ی اؼاه ی تفخو ،ِ ثب ـٍ ؼٍ tRNA ی ضبهل ؼ هٍیي آهی اٌَویؽ ث خبیگب A ـیج قَ مٍ فٌ عٍ هی ؼٌَ. -88 »1« گشينه ي ـ تٌ یِ ه وٌل ATG.GAC.ACT.TGA ؼـ ه لَ لٌَ DNA ث ـَِت TAC.CTG.TGA.ACT اوت گٌّبم ـ یًٍَىی اق آى، ـ تٌ یِ mRNA ث ـَِت AUG.GAC.ACU.UGA ت لَیؽ هی ؼٌَ. گٌّبم تفخو یِ ایي mRNA ث اقای ؽً ىٍ پبیبى UGA یّر آ تًی ؽً یًٍ خٍ ؼَ ؽًاـؼ ث اقای وبیف ؽً ىٍ بّ، ث تفتیت آ تًی ؽً ىٍ بّی UAC.CUG.UGA فٌ تً ؼاـ ؽً. اق هیبى ایي آ تًی ؽً ىٍ بّ، ت اَلی UAC هفث ث tRNA ی آؿبقگف ث ؼَ ثؽ ىٍ ـٍ ؼٍ ث خبیگب A ث ـَ٘ هىتوین اٍـؼ خبیگب P هی ؼٌَ؛ ث بٌثفایي، ث تفتیت آ تًی ؽً ىٍ بّی CUG.UGA اٍـؼ خبیگب A هی ؽًٌَ.
  11. 11. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 11 - 89 »4« گشينه ي هٍتی آ تًی ؽً ىٍ AAG ؼـ تًید ؽً ىٍ UUC ؼـ ىٍ خبیگب P ـیج قَ مٍ هفاـ هی گیفؼ، ؽً ىٍ CAC نّ ؼـ ىٍ خبیگب A هفاـ هی گیفؼ ث بٌثفایي ث اقای 6 ؽً ىٍ هكث ـَ ؼـ ـَِت وؤال، ـیج قَ مٍ ز بْـ ثبـ ـ یٍ mRNA خبث خب ؽٌ اوت. -91 »4« گشينه ي ػبهل پبیبى تفخو اٍـؼ خبیگب A ؽٌ توبم پی ؽًَ بّی پپتیؽی ؼـ خبیگب A ت یٌٍل هی ؼٌَ. -91 سوال تکزاري است. عينا سوال 33 است، -92 »3« گشينه ي ثب ـٍ ؼٍ tRNA ی ضبهل ؼ هٍیي آهی اٌَویؽ ث خبیگب A ـیج قَ مٍ، هفضل ی اؼاه ی تفخو فٌ عٍ هی ؼٌَ. -93 »4« گشينه ي ا لٍیي ؽً یًٍ اٍـؼ خبیگب P ـیج قَ مٍ هی ؼٌَ، ؽً ىٍ آؿبق یؼ یٌ AUG اوت آغفیي ؽً ىٍ اٍـؼ ؽٌ ث خبیگب P ـیج قَ مٍ، ؽً ىٍ هجل اق ؽً ىٍ پبیبى )ؼـ ای دٌب UCG ( اوت. -94 »4« گشينه ي خؽا ؽٌى آهی اٌَویؽ اغت بّ یِ اق tRNA ی ضبهل آى كو ؼـ خبیگب P ـیج قَ مٍ ـظ هی ؼ ؽّ. -95 »3« گشينه ي ثىیبـ لًیؽی اوت. ه اَـؼ )الق، ة ؼ( طِیصا ؽً ز ىَ ؼـ هفضل یِ اؼاه :ِ »ِ هفضل یِ اؼاه یِ تفخو « ؼـ ایي وؤال، ت خَ ث الق ثب ضف تً ـیج قَ مٍ ثف ـ یٍ - mRNA ، ؽً ىٍ بّ اثتؽا اٍـؼ خبیگب A هی ؽًٌَ، وپه ثب خبث خِبییِ ـیج قَ مٍ ث خبیگب P هیـو ؽٌ. ة وّ ی - tRNA بّ اٍـؼ خبیگب A هی ؽًٌَ وپه ثب ضف تً ـیج قَ مٍ ث خبیگب P هی ـو ؽٌ ثب ضف تً ثؼؽی اق خبیگب P غبـج هی ؽًٌَ. ؼ توبم ا اًَع آ تًی ؽً ىٍ هفث ث آهی اٌَویؽ بّ ىّت ؽٌ وّ یِ ا اًَع آهی اٌَویؽ بّ ت وَ - tRNA بّی اغت بّ یِ غ ؼَ هی ت اَ ؽًٌ اٍـؼ خبیگب A وپه اٍـؼ خبیگب P ؽًٌَ. اهب ه ـَؼ )ج( بًؼـوت اوت ز ىَ ؼـ هفضل ی اؼاه ،ِ ؽً ىٍ بّی پبیبى اٍـؼ خبیگب A وًی ؽًٌَ! -96 »3« گشينه ي پف تٍئیي وبقی ـ یًٍَىی فّ ؼ اق كفای ؽٌ بّی و تٌكی ؼـ ىٍ ول لَ ىّت ؽٌ. په ث آ كًین ا فًلی یًبق ؼاـ ؽً. ؼـ پف تٍئیي وبقی ثیي ؽً ىٍ آ تًی ؽً ىٍ ؼـ ـ یًٍَىی ثیي RNA ی ؼـ ضبل وبغت ـ تٌ ی الگ یَ DNA ، پی ؽًَ یّؽـ لٍ یً ایدبؼ هی ؼٌَ. ؼـ ـ یًٍَىی ث ض ـَٕ DNA ی الگ ؼـ تفخو ث mRNA ، tRNA rRNA یًبق اوت. پلیپپتیؽ RNA فّ ؼ ثؽ ىٍ ا ؼًٍبة ىّت ؽٌ. -97 »1« گشينه ي ؼـ هفضل ی آؿبق تفخو ثػ زًَي ـیج قَ مٍ ث mRNA هت لّ هی ؼٌَ، tRNA ی آؿبقگف ثب ؽً ىٍ آؿبق ـاثٙ ی ه وٌلی ثفهفاـ هی ؽًٌ. -98 »3« گشينه ي 51 آ تًی ؽً ىٍ اق خبیگب A ث خبیگب P اٍـؼ ؽٌ ا ؽً. ؽً ىٍ آؿبق كو اٍـؼ خبیگب P ؽً ىٍ پبیبى كو اٍـؼ خبیگب A ؽٌ اوت. ث بٌثفایي ایي mRNA 52 ؽً ىٍ ؼاـؼ. تؼؽاؼ خبث خِبیی، پی ؽًَ پپتیؽی ه لَ لٌَ آة ت لَیؽ ؽٌ وّی ؼ تب نًتف اق تؼؽاؼ ؽً ىٍ بّوت. -99 »3« گشينه ي 4 هفث ث پف تٍئیي بّی ثؽى ا ىًبى هی ثب ؽٌٌ، لى بّ گىىت ا ؽً. 2 ، لى بّی ی بًَـی تَی گىىت ا ؽً. ث بٌثفایي، ؼـ گكی بّی 1 -111 »3« گشينه ي فّ و لًًَئ تَیؽ mRNA ی ثبلؾ ػبهل اوتوفاـ یي آهی اویؽ ؼـ ـ تٌ ی پلی پپتیؽی هی ثب ؽٌ په تؼؽاؼ آهی اویؽ بّی ـ تٌ ی پلی پپتیؽ اق تؼؽاؼ لًًَئ تَیؽ بّی mRNA ی ثبلؾ ایدبؼ ؽًٌٌ ی آى نً تف اوت. ث بٌثفایي، تؼؽاؼ پی ؽًَ پپتیؽی آى نّ نً تف اوت. ـؼ گكی بّی ؼیگف : ی یٌ اق تـییفاتی ؼـ اؿلت :»2 1« گكی بّی RNA بّی ی بًَـی تَی ) كو mRNA ( ا دًبم هی ؼٌَ، تًَب ؽٌى RNA ی ا لٍی اوت. هطل ت لَیؽ : »4« گكی ی mRNA ی ا لٍی ثبلؾ ؼـ ول لَ ی بًَـی تَی ؼـ ىّت اوت قیفا ضؿف ـ تًٌٍَ ای تٌف ىٍ ؼـ ىّت ا دًبم هی ؼٌَ.
  12. 12. 12 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. تًٌ :ِ ثب ت خَ ث هٙبلجی تًبة ؼـوی ؼـ اـتجب ثب لى بّی گىىت هٙفش فًؼ اوت، ایي اث بْم پی هی آیؽ تًَب ؽٌى لَ٘ RNA بّی ی بًَـی تَی فِكبً ؼـ ه ـَؼ mRNA اتلبم هی اكتؽ وبیف RNA بّ. ضبل آى تًبة ؼـوی ؼـ ؼ ه ـَؼ ا بٌـ ی هىتوین ث ا اًَع RNA بّ ؼاـؼ: ی یٌ اق تـییفات ؼـ اؿلت « : آغفیي غ پبـاگفاف یي ؼـ لِط ی 18 RNA بّی ی بًَـی تَی تًَب ؽٌى ه لَ لٌَ RNA ». ا لٍی اوت وّبى ـَ٘ هی ؼا یًؽ لى بّی ی بًَـی تَی بٌهل لى بّی ث ـهك ؼـ ». لى بّی ی بًَـی تَی ، گىىت ا ؽً « : ػ اٌَى تیتف لِط ی 18 آ ـٍ ؽً ی پف تٍئیي بّ )پی وًبق بّی mRNA بّ (، لى بّی tRNA بّ ، لى بّی rRNA بّ . . . ىّت ؽٌ. -111 »2« گشينه ي ؼـ ی بًَـی تَ بّ mRNA ی ثبلؾ ؼـ ىّت ایدبؼ ؽٌ وپه اٍـؼ ویت پَلاون هی ؼٌَ. ث بٌثفایي، mRNA ی ثبلؾ نّ ؼـ ىّت نّ ؼـ ویت پَلاون ؼیؽ هی ؼٌَ. -112 »4« گشينه ي ای تٌف ىٍ بّ ه بٌ و٘ی اق DNA ىّت ؽٌ په اق ـ یًٍَىی ؼـ كفای ؽٌ تًَب ؽٌى mRNA ی ا لٍی ،ِ ـ تًٌٍَ آى بّ ضؿف هی ؼٌَ ؼـ mRNA ی ثبلؾ خٍ ؼَ ؽًاـ ؽً. ثب ت خَ ث لٌٌ لِط ی 19 خبیگب آؿبق ـ یًٍَىی ؼـ بًضی ی اگك یًٍ هفاـ ؼاـؼ، قیفا ا لٍیي ثػ اق آى ـ یًٍَىی هی ؼٌَ یي هٙؼ ی اگك یًٍ اوت. ـؼ وبیف گكی بّ: ـ تًٌٍَ ای تٌف ىٍ بّ اق :»1« گكی ی mRNA ی ا لٍی خؽا هی ؼٌَ اق غ ؼَ لى. ـ تًٌٍَ ای تٌف ىٍ بّ ضؿف هی ؼٌَ، ؼـ تًید تفخو وًی ؼٌَ په كبهؽ ـهك آهی اٌَویؽ بّ هی ثب ؽٌ. :»2« گكی ی ای تٌف ىٍ بّ ت اَلی بّی ؼـ ىٍ ل یً ىّت ؽٌ ثیي ل یً. :»3« گكی ی -113 »2« گشينه ي ؼـ ضیي آغفیي خبث خبیی ثب هفاـ گفكتي ؽً ىٍ پبیبى ؼـ خبیگب A، ػبهل پبیبى تفخو اٍـؼ خبیگب A هی ؼٌَ، قیفا یّر آ تًی ؽً ىٍ ثبلٙجغ tRNA ای ثفای آى خٍ ؼَ ؽًاـؼ. ـؼ وبیف گكی بّ: :»1« گكی ی tRNA ی ؼاـای آ تًی ؽً ىٍ UAC ضبهل آهی اٌَویؽ هتی یًَي اوت هی ت اَ ؽً ػلا ثفهفاـ گفكتي ؼـ خبیگب P ث ػ اٌَى tRNA ی آؿبقگف ؼـ فّ خبیی ـهك AUG ؼـ mRNA ثب ؽٌ، ث خبیگب A اٍـؼ ؽٌ ؼـ ضیي خبث خبیی ـیج قَ مٍ اق خبیگب A ث خبیگب P اٍـؼ ؼٌَ. ؼـ خبیگب پلی پپتیؽ ـیج قَ مٍ، آ كًیوی پی ؽًَ ثیي آغفیي :»3« گكی ی tRNA ی ه خَ ؼَ ؼـ ایي خبیگب ثب پلی پپتیؽ ـا یّؽـ لٍیك هی ؽًٌ ث اٍوٙ ی كفای ؽٌ یّؽـ لٍیك، آة ه فّف هی ؼٌَ ؼـ خبیگب آهی اٌَویؽ ث اٍوٙ ی ت یٌٍل پی ؽًَ پپتیؽی ثیي آهی اٌَویؽ بّ آة ت لَیؽ هی ؼٌَ. ؼـ هفضل ی آؿبق تفخو ثػ زًَي تف ـیج قَ مٍ ث :»4« گكی ی mRNA هت لّ هی ؼٌَ، وپه ثػ ثكـ ث ثػ زًَي هی پی ؽًَؼ. -114 »2« گشينه ي ث ف٘ش قیف ت خَ یًٌؽ: ATG CTT TTT TGA : ـ تٌ ی ه وٌل ؼـ DNA TAC GAA AAA ACT : ـ تٌ ی الگ ؼـ DNA AUG CUU UUU UGA : mRNA ث بٌثفایي، آ تًی ؽً ىٍ بّی ث بًـ ـكتِ UAC GAA AAA اوت. ك یٌل آلا یًي ل وَیي هتی یًَي : ـ تٌ ی پلی پپتیؽ. ؼلایل بًؼـوتی وبیف گكی بّ: ثفای ؽً ىٍ پبیبى، آ تًی ؽً یًٍ ؽًاـین. :»3 1« گكی بّی ؼـ هفضل ی اؼاه ،ِ ػًىت :»4« گكی ی tRNA ی ضبهل ل وَیي اٍـؼ خبیگب A هی ؼٌَ.
  13. 13. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 13 - 115 »4« گشينه ي اق آى خبیی اپفاى ؼـ ىّت ی ول لَ بّی ی بًَـی تَی خٍ ؼَ ؽًاـؼ، ثبلٙجغ توبم RNA بّی ت لَیؽ ؽٌ تي لیً هی ثب ؽٌٌ اق آى خبیی فّ لى ؼ ـ تٌ ای اوت بًضی ی ـا ا ؽًاق لى یًك ـ یًٍَىی وًی ؼٌَ ث ـَ٘ هٙغ هی ت اَى گلت RNA ی ضب لِ اق ـ یًٍَىی وّ اَـ اق لى وبق ؽً ی غ ؼَ تؼؽاؼ لًًَئ تَیؽ بّی نً تفی ؼاـؼ. ـؼ وبیف گكی بّ: ثفای وّ ی :»1« گكی ی RNA بّ بِؼم یًىت قیفا ی یٌ اق تـییفات ؼـ اؿلت RNA بّی ی بًَـی تَی وّ ی آى بّ تًَب ؽٌى ه لَ لٌَ RNA ی ا لٍی اوت. ؼـ ه ـَؼ :»2« گكی ی RNA بّی ـیج قَ هٍی بًهل بِؼم یًىت. ؼـ ه ـَؼ :»3« گكی ی tRNA ؽِم وًی ؽًٌ. -116 »1« گشينه ي لى ت ظٌین ؽًٌٌ ؼوت ـَ وبغت پف تٍئیي ه بْـ ؽًٌٌ ـا هی ؼ ؽّ ؼـ ؿیبة لا تً قَ ث اپفات ـَ هت لّ هی ؼٌَ. :»2« گكی ی RNA پلی هفاق II ؼـ ی بًَـی تَ بّ خٍ ؼَ ؼاـؼ ؼـ ثب تًفی ا فٌی یٍب لًای اپفاى لي :»3« گكی ی mRNA ی و لیً هی وبقؼ. تـییفاتی ؼـ لٌٌ پف تٍئیي ت ظٌین ؽًٌٌ هفث ث ض ـَٕ آل لَا تً قَ ؼـ ول لَ اوت. :»4« گكی ی -117 »1« گشينه ي هٍتی پف تٍئیي ت ظٌین ؽًٌٌ )ه بْـ ؽًٌٌ (ُ ث ثػ ت ظٌین ؽًٌٌ )اپفات ـَ( هت لّ هی ؼٌَ، اپفاى لي غبه يَ ؽٌ لؿا آ كًین بّی خؿة تدكی ی لا تً قَ وبغت وًی ؽًٌَ. -118 »4« گشينه ي لا ةًَ ه ؼـ ه ـَؼ ثب تًفی اِ. لًای هٙبلؼ وً ؼَ ؽً. ثب تًفی بّ ضب یٍ یي عًَ ـیج قَ مٍ ىّت ؽٌ ىًجت ث ی بًَـی تَ بّ وبغتبـ وبؼ تفی ؼاـؼ. ػول ـ یًٍَىی تفخو ؼـ ایي خب ؽًاـاى، ؼـ ىٍ ویت پَلاون ول لَ ادًبم هی ؼٌَ. نّ ز یٌي DNA ثب تًفی بّ ضلو یَ اوت، ضب یٍ یي وًٙ ی آؿبق وّب ؽًٌوبقی اوت هؼو لَاً 2 ؼ ـا یّ وّب ؽًٌوبقی ت یٌٍل هی ؼ ؽّ. ؼـ ؤي بٌٌوبیی ـا ا ؽًاق ؼـ پف بًٍـی تَ بّ ث ت بٌْیی ت وَ RNA پلی هفاق ؼـ ی بًَـی تَ بّ ث وًي ػ اَهل ـ یًٍَىی ـَِت هی گیفؼ. -119 »1« گشينه ي ثب خؿة لا تً قَ، اپفاى لي ـ يٌٍ ؽٌ ،ُ ث بٌثفایي آ كًین بّی خؿة تدكی ی لا تً قَ وبغت هی ؽًٌَ. آ كًین بّی خؿة لا تً قَ ه خَت اككای لً ؾَ پؿیفی ؿ بٍی ثب تًفی هی ؽًٌَ. -111 »1« گشينه ي گ ی ه ـَؼ هٙبلؼ ی لا ةًَ ه ثب تًفی ا فٌی یٍب لًای ث ؼَ. وّبى ـَ٘ هی ؼا یًؽ ت ظٌین ثیبى لى ؼـ پف بًٍـی تَ بّ ػوؽتبً گٌّبم ـ یًٍَىی ا دًبم هی ؼٌَ. -111 »1« گشينه ي ثفای ثیبى فّ عًَ لیً، اثتؽا ـ یًٍَىی ـَِت هی گیفؼ پی ؽًَ كىل ؼَی اوتف خ تْ ایدبؼ RNA ی ضب لِ اق لى هفث ت یٌٍل هی ؼٌَ. اگف لى، هفث ث پف تٍئیي ثب ؽٌ تفخو نّ ا دًبم هی ؼٌَ پی ؽًَ پپتیؽی ت لَیؽ ؽٌ tRNA اٍـؼ ػول هی ؼٌَ. اهب ؼـ ه ـَؼ لى بّی rRNA tRNA كو ـ یًٍَىی ا دًبم هی پؿیفؼ. -112 »3« گشينه ي ػبهلی وجت كؼبل ؽٌى اپفاى لي هی ؼٌَ، آل لَا تً قَ بًم ؼاـؼ. هٍتی ؼـ هطی لا تً قَ خٍ ؼَ ؽًا تٌ ثب ؽٌ، ه بْـ ؽًٌٌ ی اپفاى لي ث اپفات ـَ هت لّ اوت هب غً ضف تً RNA پلی هفاق ثف ـ یٍ لى هی ؼٌَ. اهب هٍتی لا تً قَ ؼـ هطی خٍ ؼَ ؼا تٌ ثب ؽٌ ؼـ ىٍ ول لَ ث آل لَا تً قَ تجؽیل هی ؼٌَ. آل لَا تً قَ ث ه بْـ ؽًٌٌ ی اپفاى لي هت لّ هی ؼٌَ وجت ـ يٌٍ ؽٌى اپفاى لي هی ؼٌَ. تًٌ :ِ آل لَا تً قَ وّبى لا تً قَ اوت الجت ثب وًی تـییف ؼـ وبغتبـ. ث بٌثفایي هب یّتی فًث یَّؽـاتی ؼاـؼ.
  14. 14. 14 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. جايگاه آغاس جايگاه پايان راه انداس محل رونويسي -113 »1« گشينه ي B آل لَا تً قَ اوت اق تـییف لٌٌ ؼی وب بًـیؽ لا تً قَ ضب لِ هی ؼٌَ. ات بّل آل لَا تً قَ (B) ث پف تٍئیي ه بْـ ؽًٌٌ (D) ، وجت تـییف لٌٌ ایي پف تٍئیي خؽا ؽٌى آى اق اپفات ـَ (C) هی ؼٌَ. اپفات ـَ ز ىَ ؼـ وبغتبـ DNA ی پف بًٍـی تَ بّ هفاـ ؼاـؼ، په ؼـ ی٘ وّب ؽًٌوبقی ؼـ ویت پَلاون وبغت هی ؼٌَ. ت اَلی A ، ـا ا ؽًاق اوت ؼـ كًؼی یٌ خبیگب آؿبق ـ یًٍَىی هفاـ ؼاـؼ، ؼـ تًید اق ـ یٍ غ ؼَ آى ـ یًٍَىی وًی ؼٌَ. -114 »4« گشينه ي پف تٍئیي ت ظٌین ؽًٌٌ ؼـ ؿیبة لا تً قَ ؼـ تًید ،ِ آل لَا تً قَ، ث اپفات ـَ)ثیي لى 1 ـا ا ؽًاق( هت لّ هی ؼٌَ اق ضف تً RNA پلی هفاق پف بًٍـی تَی خل گَیفی هی ؽًٌ. -115 »2« گشينه ي ه بْـ ؽًٌٌ ت اَ بًیی ات بّل ث اپفات ـَ ػبهل ت ظٌین ؽًٌٌ )آل لَا تً قَ( ـا ؼاـؼ آل لَا تً قَ ػًَی فًث یَّؽـات اوت اپفات ـَ ثػ یٍ اق DNA اوت، ؼـ وبغتبـ لًًَئ تَیؽ بّی غ ؼَ ه ؽٌ ؼئ ىًَی ـیج قَ ؼاـؼ اهّب اپفات ـَ ثفغلاف آل لَا تً قَ ؼاـای ثبقآلی اوت یّر ؽًام پی ؽًَ پپتیؽی ؽًاـ ؽً. اپفات ـَ ؼاـای پی ؽًَ یّؽـ لٍ یً اوت. -116 »1« گشينه ي لى ت ظٌین ؽًٌٌ غبـج اق اپفاى لي ث ؼَ اق ـ یٍ آى mRNA وبغت هی ؼٌَ په اق تفخو ،ِ ه بْـ ؽًٌٌ ـا ایدبؼ هی ؽًٌ. ایي لى ؼاـای ـا ا ؽًاق اوت. وّبى ـَ٘ ؼـ ثػ ت ظٌین ؽًٌٌ ی اپفاى لي، ـا ا ؽًاق خٍ ؼَ ؼاـؼ. ؼـ لى ت ظٌین ؽًٌٌ ،ُ ـا ا ؽًاق، خبیگب آؿبق پبیبى ـ یًٍَىی خٍ ؼَ ؼاـؼ. -117 »2« گشينه ي ػبهل ت ظٌین ؽًٌٌ )آل لَا تً قَ( ثب تـییف لٌٌ پف تٍئیي ه بْـ ؽًٌٌ وجت ـ يٌٍ ؽٌى اپفاى لي هی ؼٌَ. -118 »4« گشينه ي اق ـ یًٍَىی لى بّی rRNA ، RNA ی ـیج قَ هٍی ث خٍ ؼَ هی آیؽ ؼـ وبغتبـ ـیج قَ مٍ بّ فٌ تً ؼاـؼ. :»2 1« ـؼ وبیف گكی بّ: گكی بّی خبیگب آؿبق پبیبى نّ ـ یًٍَىی هی ؽًٌَ. ث فّ ـهك 3 لًًَئ تَیؽی ؼـ : »3« گكی ی mRNA ؽً ىٍ گلت هی ؼٌَ DNA . -119 »1« گشينه ي ثب ت خَ ث لٌٌ 1 9 وّبى ـَ٘ ه بٍ ؽّ هی كفهبییؽ ؼـ ؿیبة آل لَا تً قَ - RNA پلی هفاق ث ـا ا ؽًاق اپفاى لي هت لّ اوت اهب ث وجت ات بّل پف تٍئیي ه بْـ ؽًٌٌ ث بًضی ی اپفات ـَ آى، اه بٌى ـ یًٍَىی خٍ ؼَ ؽًاـؼ اپفاى لي غبه يَ اوت. ثفـوی وبیف گكی بٌِّ: پف تٍئیي ت ظٌین ؽًٌٌ ،ُ هط لَّ لى ت ظٌین ؽًٌٌ اوت. :»2« گكی ی لا تً قَ ؼـ ىٍ ثب تًفی ث آل لَا تً قَ تجؽیل هی ؼٌَ. آل لَا تً قَ ثب ات بّل ث ه بْـ ؽًٌٌ ،ُ لٌٌ آى ـا تـییف هیؼ ؽّ. :»3« گكی ی ثب تًفی كو یي عًَ :»4« گكی ی RNA پلیهفاق ؼاـؼ ؼـ وبغتبـ ـیج قَ مٍ نّ كو rRNA بّ ض ـَٕ ؼاـ ؽً. -121 »2« گشينه ي اگف اپفاى تي ل یً ثب ؽٌ ،»4« هط لَّات اپفاى لي و عًَ آ كًین، ثفای خؿة تدكی ی لا تً قَ ىّت ؽٌ. ؼـ ه ـَؼ گكی ی اپفات ـَ هی ت اَ ؽً ؼـ ت ظٌین ثیبى یي لى ؼغبلت ؼا تٌ ثب ؽٌ. -121 »4« گشينه ي ثب تًفی E.Coli وّ اَـ ىًجت ث لا تً قَ لً ؾَپؿیف اوت اهب ؼـ گٌّبهی اپفاى لي ـ يٌٍ اوت لً ؾَپؿیفتف هی ؼٌَ. قهب یً اپفاى لي ـ يٌٍ اوت، گل كًَ ؼـ هطی خٍ ؼَ ؽًاـؼ اهب لا تً قَ خٍ ؼَ ؼاـؼ. لى ت ظٌین ؽًٌٌ وّ اَـ ـ يٌٍ اوت. اق ـ یٍ اپفاى لي یي عًَ mRNA و ل یً وبغت هی ؼٌَ. -122 »4« گشينه ي لى ت ظٌین ؽًٌٌ هىئ لَ وبغت پف تٍئیي ت ظٌین ؽًٌٌ اوت. ایي پف تٍئیي ثب ات بّل ث اپفات ـَ هب غً اق ـ يٌٍ ؽٌى اپفاى لي هی گفؼؼ. اپفاى لي یًك ؼـ ت لَیؽ آ كًین بّی خؿة تدكی لا تً قَ ؼغبلت ؼاـؼ.
  15. 15. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 15 »4« -123 گشينه ي لى وبق ؽً ی ه بْـ ؽًٌٌ ی اپفاى لي، وّ اَـ ـ يٌٍ ث ؼَ ثب ـ یًٍَىی اق آى تفخو ،ِ پف تٍئیي ه بْـ ؽًٌٌ وبغت هی ؼٌَ. لاقم ث ؾ فً اوت پف تٍئیي خؿة تدكی ؽًٌٌ ی لا تً قَ ـا لى بّی اپفاى لي هی وبق ؽً. »4« -124 گشينه ي ثفای پبوع گ یَی ث ایي وؤال لاقم اوت ث گٌّبم ثفـوی گكی بّ ث خول ی اثتؽای وؤال یًك ت خَ یًٌن: اق ایي ـ ثبیؽ ت خَ یًٌن فّ ز ؽٌ گكی بّ ث ت بٌْیی ؼـوت ىّت ؽٌ؛ آیب هبؼـ ث ت وٌیل ػجبـت ث ـَِت » ... ؼـ اپفاى لي « ؼـوت ىّت ؽٌ یب غیف. ضبل ث ثفـوی گكی بّ تًٌ بّی آى بّ ت خَ یًٌؽ: ثب ؽٌ زفا ػجبـتی ثىیبـ آ بٌٌ پف ت فٌاـ ؼـ آقه ىَ بّی »1« بٌیؽ تًٌ ؼاـتفیي گكی ی ایي وؤال گكی ی :»1« گكی ی وفاوفی اوت ث ت بٌْیی ػجبـتی طِیص اوت ت بٌْ ا بٌٌلی ایي ػجبـت ـا ثفای ت وٌیل ػجبـت بًه بٌوت هی ؽًٌ، ایي اوت لى ت ظٌین ؽًٌٌ ا لِاً ؼـ اپفاى لي هفاـ گًفكت اوت. په وًی ت اَ یًن آى ـا ثفای ت وٌیل ػجبـت ث بٌـ ثجفین زفا بًه ثػ ا لٍ آى اوت. ؼهت یًٌن ثب ت خَ ث هتي تًبة ؼـوی ض ـَٕ یب ػؽم ض ـَٕ لا تً قَ ث ت بٌْیی تؼییي ؽًٌٌ یًىت ثل ض ـَٕ یب :»2« گكی ی ػؽم ض ـَٕ گل كًَ یًك اق ػ اَهل تؼییي ؽًٌٌ اوت. ث ـَ٘ی ایي ول لَ بّ ؼـ جً ؼَ گل كًَ اق لا تً قَ ث ػ اٌَى ه جٌغ ا فًلی اوتلبؼ هی ؽًٌٌ. آل لَا تً قَ ؼـ هطی ثب تًفی ه خَ ؼَ یًىت زفا ایي تف یًت ) ایك هٍف لا تً قَ اوت( په اق ـٍ ؼٍ لا تً قَ ث : »3« گكی ی ؼـ ىٍ ول لَ ثب تًفی ت لَیؽ هی ؼٌَ. ؼـ اپفاى لي و لى ثفای و آ كًین وبقهبى ؼ یّ ؽٌ اوت، په فّ آ كًین یي لى ؼاـؼ. هی ؼا یًن فّ لى هىئ لَ :»4« گكی ی وبغت یي ـ تٌ ی پلی پپتیؽی اوت په فّ آ كًین كو یي ـ تٌ ی پلی پپتیؽی ؼاـؼ. »3« -125 گشينه ي پف تٍئیي ت ظٌین ؽًٌٌ ثفای ه بْـ ثیبى لى ث ت اَلی اپفات ـَ هت لّ هی ؼٌَ. ت فٍیص وبیف گكی بّ: ػبهل ت ظٌین ؽًٌٌ آل لَا تً قَ اوت وًی ت اَ ؽً ث ثػ ت ظٌین ؽًٌٌ ی لى هت لّ ؼٌَ. :»1« گكی ی mRNA ؼـ ول لَ ـ یًٍَىی یي لى هفث ث پف تٍئیي اوت )لى ت ظٌین ؽًٌٌ (ُ ه دٌف ث ت لَیؽ :»2« گكی ی ث اپفات ـَ هت لّ وًی ؼٌَ. په هط لَّ بًْیی لى ت ظٌین ؽًٌٌ هی ت اَ ؽً ث اپفات ـَ ثسىجؽ، هط لَّ mRNA . هی ؼٌَ ـ یًٍَىی آى. وّبى ـَ٘ گلت ؽٌ لى ت ظٌین ؽًٌٌ وّبى لى ـهك ؽًٌٌ ی پف تٍئیي ت ظٌین ؽًٌٌ اوت. پف تٍئیي ت ظٌین ؽًٌٌ ث :»4« گكی ی ثػ ت ظٌین ؽًٌٌ ی لى هی زىجؽ ث لى ت ظٌین ؽًٌٌ .ُ »2« -126 گشينه ي II پلی هفاق RNA پلی هفاق وًی ت اَ ؽً هىتویوبً ث ـا ا ؽًاق هت لّ ؼٌَ. ث ػ اٌَى هثبل آ كًین RNA ؼـ ی بًَـی تَ بّ، آ كًین )وبق ؽً ی ؽً ىٍ( ثفای ات بّل ث ـا ا ؽًاق یًبق ث پف تٍئیي بّیی ث بًم ػ اَهل ـ یًٍَىی ؼاـؼ. »4« -127 گشينه ي ثب ؽٌ ؼـ rRNA ثب ؽٌ، تفخو ـَِت هی گیفؼ لٍی اگف هثلاً mRNA پف تٍئیي، اگف ه لَ لٌَ RNA ثیبى لى یؼ یٌ وبغت وبغتبـ ـیج قَ مٍ فٌ تً هی ؽًٌ، ث بٌثفایي هی ت اَى تًید گفكت ثیبى لى وّ اَـ ه دٌف ث ت لَیؽ ه لَ لٌَ بّیی هی ؽًٌَ ؼـ وبغتبـ غ ؼَ پی ؽًَ كىل ؼَی اوتف ؼاـ ؽً. ث هتي قیف ت خَ یًٌؽ: هٍتی یي لى ه ـَؼ اوتلبؼ هفاـ هی گیفؼ، هی گ یَ ؽٌ آى لى ثیبى ؽٌ ث ا ِٙلاش ـ يٌٍ اوت. هٍتی لى ه ـَؼ اوتلبؼ هفاـ وًی گیفؼ، آى لى، غبه يَ اوت. ایي ؼـ یي قهبى ه ػٍ ،ُ ؽًام لى بّ ـ يٌٍ ؽًام لى بّ غبه يَ ثب ؽٌٌ، ث ت ظٌین ثیبى لى هؼف فٍ اوت. ؼـ ی بًَـی تَ بّ یًك هی ت اَى هثبل بّی هتؼؽؼی اق ت ظٌین ثیبى لى هٙفش فًؼ. ت ظٌین ثیبى لى ػلا ثف پبوع ث تـییف فٌای هطی ،ٗ هثل ؼـ ؼوتفن ث ؼَى یب جً ؼَى یي ه جٌغ ؿؿایی، ؼـ وً خب ؽًاـ وً ه وْی ؼاـؼ. »3« -128 گشينه ي ت ظٌین ثیبى لى ؼـ پف بًٍـی تَ بّ هب ؽًٌ ا فٌی یٍب لًای ؼـوٙ شَ قیف ا دًبم هی گیفؼ: ـ یًٍَىی- تفخو -ِ په اق تفخو ت ظٌین ثیبى لى ؼـی بًَـی تَ بّ هب ؽًٌ ـًَ وٍپ ـَا فًاوب ؼـ وٙ شَ قیف ا دًبم هی گیفؼ: اق ىّت -ِ گٌّبم تفخو -ِ ثؼؽ اق تفخو mRNA هجل اق ـ یًٍَىی- گٌّبم ـ یًٍَىی- ثؼؽ اق ـ یًٍَىی- ثؼؽ اقغف جٍ تًٌ :ِ كفای ؽٌ ت ظٌین ثیبى لى وٙ شَ هػتلق آى نّ ؼـ ی بًَـی تَ بّ نّ ؼـ پف بًٍـی تَ بّ هىتول اق زفغ ی ول لَی اوت، په ت ظٌین ثیبى لى ؼـ فّ ؼ خب ؽًاـ هی ت اَ ؽً هجل اق وّب ؽًٌوبقی یًك ـَِت پؿیفؼ.
  16. 16. 16 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. -129 »3« گشينه ي ت عٌَ ػ اَهل ـ یًٍَىی، ایدبؼ تف یًجبت هػتلق اق آى بّ ات بّل ایي ػ اَهل ث بًضی ی اككای ؽٌ ضب یً اق وً هؤثف ایي ػ اَهل ؼـ ت ظٌین ثیبى لى اوت. ایدبؼ وؽ ضف تًی ؼـ بًضی ی اپفات ـَ هفث ث پف تٍئیي ت ظٌین ؽًٌٌ )ه بْـ ؽًٌٌ (ُ اوت. -131 »2« گشينه ي ػ اَهل ـ یًٍَىی، پف تٍئیي بّی هػ یَِّ ؼـ ی بًَـی تَ بّ ىّت ؽٌ ث RNA پلی هفاق وًي هی ؽًٌٌ تب ـا اُ ؽًاق ـا بٌٌوبیی ؽًٌ اهب وً یٍ ؼـ هفاضل ؼ مٍ و مَ ـ یًٍَىی ؽًاـ ؽً. ػ اَهل ـ یًٍَىی هتؼؽؼ ؽً تف یًت بّی هػتللی اق آى بّ ایدبؼ هی ؼٌَ. ایي تف یًت بّ وً بًّی هػتللی ـا ؼـ ت ظٌین ثیبى لى ؼاـ ؽً. هطل كؼبلیت ػ اَهل ـ یًٍَىی، ؼـ ىٍ ىّت اوت اهب ؼـ ىٍ ىّت ،ِ پف تٍئیيوبقی ا دًبم وًی ؼٌَ. ث بٌثفایي ایي پف تٍئیي بّ په اق ت لَیؽ ؼـ ویت پَلاون، ث ؼـ ىٍ ىّت ه تٌول هی ؽًٌَ. ػ اَهل ـ یًٍَىی هت لِّ ث اككای ؽٌ ،ُ پف تٍئیي بّی كؼبل ؽًٌٌ بًم ؼاـ ؽً. وّ ی ایي پف تٍئیي بّ په اق ت یٌٍل ضلو ،ِ هىتویوبً ث RNA پلیهفاق هت لّ وًی ؽًٌَ، ثل ثب ات بّل هىتوین ث ػ اَهل ـ یًٍَىیِ هت لّ ث ـا اُ ؽًاق، آى بّ ـا كؼبل هی ؽًٌٌ. -131 »3« گشينه ي ایي ؼـ یي قهبى ه ػٍ ،ُ ؽًام لى بّ ـ يٌٍ ؽًام لى بّ غبه يَ ثب ؽٌٌ، ث ت ظٌین ثیبى لى هؼف فٍ اوت. په ؼـ ـَِتی هفاـ ثب ؽٌ ل یً غبه يَ ثوب ؽً ثفای ه اَـؼ )الق ج( بِؼم یًىت ه ـَؼ )ة( یًك ث ؼلیل ایي ؼـ خؽا ؽٌى ـ تًٌٍَ بّی ای تٌف ىٍ اق اگك ىٍ، پی ؽًَ كىل ؼَی اوتف ىٌٌت هی ؼٌَ نّ بًؼـوت اوت. -132 »2« گشينه ي كؼبل ؽًٌٌ پف تٍئی یٌ هتؼلن ث ی بًَـی تَ بّ ه بْـ ؽًٌٌ پف تٍئی یٌ هتؼلن ث پف بًٍـی تَ بّوت. ی بًَـی تَ بّ و عًَ RNA پلی هفاق پف بًٍـی تَ بّ یي عًَ RNA پلی هفاق ؼاـ ؽً. اهب ثفای وبغت پف تٍئیي نّ ؼـ ی بًَـی تَ نّ ؼـ پف بًٍـی تَ بّ ث mRNA ، tRNA rRNA یًبق اوت. -133 »4« گشينه ي ؼـ فّ عًَ ول لَ ق ؽً كو ثؼ یٕ اق لى بّ ثیبى هی ؽًٌَ. ـؼ وبیف گكی بّ: ث ػ اٌَى هثبل ثیبى لى :»2 1« گكی ی RNA پلی هفاق II ؼـ ول لَ بّی هػتلق ـظ هی ؼ ؽّ. ثیبى لى بّی اپفاى لي یب ثیبى لى بّی ػ اَهل ـ یًٍَىی ؼـ ثیبى وبیف لى بّ تأثیفگؿاـ اوت. :»2« گكی ی ثیبى لى بّی وبق ؽً ی پف تٍئیي بّی بًٍ ای یب ـَّه ىَ بّی پف تٍئی یٌ ؼـ ثیبى لى بّ ؼـ ؼیگف ول لَ بّ تأثیفگؿاـ :»3« گكی ی اوت. -134 »1« گشينه ي ػ اَهل ـ یًٍَىی پف تٍئیي بّی هػ یَِّ ىّت ؽٌ ث RNA پلی هفاق ؼـ بٌٌوبیی ـا ا ؽًاق وًي هی ؽًٌٌ. RNA یب mRNA ـاث ثیي DNA پف تٍئیي اوت. ـؼ وبیف گكی بّ: اككای ؽٌ ثػ یٍ اق ه لَ لٌَ :»2« گكی ی DNA اوت ث وًي ػ اَهل ـ یًٍَىی هت لّ ث آى، ػول ـ یًٍَىی ـا تو یَت هی ؽًٌ. ػ اَهل ـ یًٍَىی ؼـ ویت پَلاون ت لَیؽ هی ؽًٌَ. :»3« گكی ی وً آى بّ ؿبلجبً ؼـ فٌ عٍ ـ یًٍَىی اوت اؼاه ی ـ یًٍَىی. :»4« گكی ی -135 »1« گشينه ي ؼـ ی بًَـی تَ بّ ثفغلاف پف بًٍـی تَ بّ، آ كًین RNA پلی هفاق ث ت بٌْیی وًی ت اَ ؽً ـا ا ؽًاق ـا بٌٌوبیی ؽًٌ. بٌٌوبیی ـا ا ؽًاق ث وًي پف تٍئیي بّی هػ یَِّ ث بًم ػ اَهل ـ یًٍَىی ـَِت هی گیفؼ. -136 »3« گشينه ي mRNA بّی تي ل یً وّ اَـ یي عًَ پلی پپتیؽ ایدبؼ هی ؽًٌٌ ؼـ ضبلی mRNA بّی ز ؽٌل یً ث تؼؽاؼ لى بّ، پلی پپتیؽ ت لَیؽ هی ؽًٌٌ. ـؼ وبیف گكی بّ: هی ت اَ ؽًٌ ت وَ :»1« گكی ی RNA پلی هفاق پف بًٍـی تَی یًك ت لَیؽ ؽًٌَ. :»2« گكی ی mRNA بّی ز ؽٌ ل یً ث اقای فّ لى یي ؽً ىٍ آؿبق یي ؽً ىٍ پبیبى ؼاـ ؽً، ؼـ ؤي نّ ؼـ mRNA بّی تي ل یً نّ ؼـ mRNA بّی ز ؽٌ ل یً هی ت اَ ؽً ز ؽٌیي ؽً ىٍ AUG ثب ؽٌ. :»4« گكی ی mRNA بّی ز ؽٌ ل یً ؼـ پف بًٍـی تَ بّ خٍ ؼَ ؼاـ ؽً كبهؽ ىّت ه ػٍ وبقهبى یبكت ا ؽً.
  17. 17. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 17 »2« -137 گشينه ي خ بًّیی یي یب ز ؽٌ لًًَئ تَیؽ لى ـا، ـ یٍ یي فً هٍ قَ مٍ، تـییف هی ؼ ؽٌّ ث خ بًّی وًٙ ای ه وَ مَ ا ؽً.ث ـَ٘ ػوؽ ؼ عًَ خ وًٙ ای خٍ ؼَ ؼاـؼ: ؼـ عًَ ا لٍ یي لًًَئ تَیؽ یي لى ثب لًًَئ تَیؽ عًَ ؼیگفی ػ هی ؼٌَ، ث ز یٌي خ یٍْ خ خب یًٍ یٌ گلت هی ؼٌَ. عًَ ؼ مٍ خ بّی وًٙ ای، خ تـییف زبـز ةَ اوت. »4« -138 گشينه ي تـییف هی ؽًٌ فّ ؼ هفث ث آهی اٌَویؽ ویىتئیي ىّت ؽٌ. نّ ز یٌي ؼـ خ ؼ مٍ UGC ث UGU ؼـ خ ا لٍ ؽً ىٍ تـییف هی ؽًٌ فّ ؼ ؽً ىٍ پبیبى ىّت ؽٌ، ث بٌثفایي یّر گ تـییفی ؼـ ت اَلی آهی اٌَویؽ بّ، عًَ UAA ث UGA ؽً ىٍ آهی اٌَویؽ بّ لَ٘ ـ تٌ ی پلی پپتیؽی ایدبؼ وًی ؼٌَ. »4« -139 گشينه ي خ )ل یً یب فً هٍ قَ هٍی( اگف ؼـ ول لَ بّی خ ىٌی ثب ؽٌ، هو يٌ اوت ث ىًل ثؼؽ ه تٌول ؼٌَ لٍی ؼـ ول لَ بّی پی فٌی ث ىًل ثؼؽ ه تٌول وًی ؼٌَ. »2« -141 گشينه ي ث لِط ی 25 پبـاگفاف و مَ هفاخؼ یًٌؽ »3« -141 گشينه ي ـؼ وبیفگكی بّ: ثفای خب ـًَا یً هثل یّؽـ ت لَیؽهثل ؿیفخ ىٌی ؼاـ ؽً، بِؼم یًىت. :»1« گكی ی ؼـ تًبة ا بٌـ ؽٌ هو يٌ اوت ث ىًل ثؼؽ ه تٌول ؽًٌَ، ز ىَ لوبش كفآی ؽٌی ت بّؼكی اوت. :»2« گكی ی ؼـ ه ـَؼ ا ىًبى لى بّی ویت پَلاووی اوپفم ث ىًل ثؼؽ ه تٌول وًی ؽًٌَ ز ىَ ؼـ لوبش كو وف اوپفم اٍـؼ تػوي :»4« گكی ی هی ؼٌَ هٙؼ ی هیب یً ؼاـای هیت ؽًٌَـی اوت ؼـ ثیف ىٍ تػوي ثبهی هی هب ؽً. »1« -142 گشينه ي ثب ت خَ ث خ ـظ ؼاؼ ،ُ ؽً ىٍ آهی اٌَویؽ ؼ مٍ ث ؽً ىٍ پبیبى تـییف هی یبثؽ ؼـ تًید یّر پلی پپتیؽی ت لَیؽ وًی ؼٌَ. ت بٌْ یي ؽً ىٍ تفخو هی ؼٌَ یي آهی اٌَویؽ ت یٌٍل پلی پپتیؽ وًی ؼ ؽّ. »4« -143 گشينه ي ی ـ یًٍَىی ؽٌ هجل اق خ :ًْ mRNA AUGUGCUUAAUUUGUUGACGA  5 آهی اٌَویؽ ؼـ ـ تٌ ی پلی پپتیؽ په اق تفخو خٍ ؼَ غ اَ ؽّ ؼا تٌ. ی ـ یًٍَىی ؽٌ ثؼؽ اق خ :ًْ mRNA AUGGCUUAAUUUGUUGACGA  2 آهی اٌَویؽ ؼـ ـ تٌ ی پلی پپتیؽ په اق تفخو خٍ ؼَ غ اَ ؽّ ؼا تٌ. »4« -144 گشينه ي ی ضبهل ) بًهل( آهی اٌَویؽ وّبى RNA . خل گَیفی ؽًٌ tRNA هی ت اَ ؽً اق و تٌك III پلی هفاق RNA خ ؼـ ـا اُ ؽًاق بّی هیثب ؽٌ. tRNA »4« -145 گشينه ي 3 هی ت اَ ؽًٌ ثیي خ بًّی خب یًٍ یٌ وًٙ ای تـییف زبـز ةَ ه تٍفى ثب ؽٌٌ اهب ػ ؽٌى 2 ، ه اَـؼ 1 یي لًًَئ تَیؽ، ث لًًَئ تَیؽ ؼیگف ثف ـ یٍ لى ثیب گًف خ اق عًَ خب یًٍ یٌ اوت ایي خ بًّی خب یًٍ یٌ ثب ف٘ش ك مَ بًٍى ؼاؼ هی ؽًٌَ. ) فّ كل بًٍى ؼ ؽٌّ ی ػ ؽٌى یي لًًَئ تَیؽ ثب لًًَئ تَیؽ ؼیگف اوت.( »3« -146 گشينه ي ت بٌْ ـهك ه خَ ؼَ ثفای آهی اٌَویؽ هتی یًَي اوت. فّ گ خ وًٙ ای خب یًٍ یٌ ه دٌف ث تـییف AUG اق آى خبیی ؽً ىٍ آهی اٌَویؽ هی ؼٌَ ث ـَ٘ هٙغ ثف ـ یٍ ثیبى لى تأثیف گؿاـ اوت. كدون پايان كدون پايان
  18. 18. 18 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. »2« -147 گشينه ي ـظ ؼ ؽّ DNA اق خول لًًَئ تَیؽ بّی آى خ بًم ؼاـؼ. اگف خ ؼـ لًًَئ تَیؽ بّی DNA فّ گ تـییف ؼـ وبغتبـ بّ یًك تـییف ث خٍ ؼَ DNA پلی هفاق ا ؽً ثبهی هی هب ؽً ؼـ ایي DNA بّی ؼغتفی هط لَّ آ كًین DNA ا لِاش ؼًٍَ، هٙؼبً ؼـ آهؽ پب ثفخبی هی هب ؽً. ـؼ وبیف گكی بّ: پلی هفاق وّفا ثب ؽٌ . RNA ت بٌْ خ بّیی ؼـ ـ تٌ ی الگ یَ لى ـظ ؼ ؽّ هی ت اَ ؽً ثب تـییف هط لَّ :»1« گكی ی ی ثیي لى بّ ـظ هی ؼ ؽّ، ثب تـییف ؼـ هط لَّ DNA خ بّیی ؼـ ـ تٌ ی ؿیف الگ ـظ هی ؼ ؽّ یب خ بّیی ؼـ پلی هفاق وّفا یًىت. RNA ضتی اگف خ ؼـ ـ تٌ ی الگ یَ لى نّ ـظ ؼ ؽّ، اگف خ خب یًٍ یٌ ثی اثف ثب ؽٌ )هثلاً ؽً ىٍ :»4 3« گكی بّی ویىتئیي ثبق نّ عًَ تف یًت آهی اٌَویؽ بّ ثؽ ىٍ تـییف هی هب ؽً.  ویىتئیي UGCUGU »4« -148 گشينه ي فّ خ یٍْ الكاهبً ػول فٌؼ یب ظب فّ ول لَ ـا تـییف وًی ؼ ؽّ. هثلاً اگف خ وًٙ ای اق عًَ خب یًٍ یٌ ـهك ل تًی یٌ خؽیؽ وّب ؽًٌ ـهك هجلی هتؼلن ث یي آهی اویؽ ثب ؽٌ، یّر تـییفی ؼـ ول لَ ایدبؼ وًی ؼٌَ. ثفـوی وبیف گكی بّ: هو يٌ اوت كؼبلیت آ كًین بّ تـییف ؽًٌٌ تطت تأثیف ػ اَهل خ قای هطیٙی كو هبؼ ی ل تًیي ، خ یبثؽ. :»1« گكی ی وّبى ـَ٘ گلت ؽٌ وّ ی خ بّ بً یٌ اق آ كًین بّی وّب ؽًٌوبقی یًىت، په ه بْـ آى بّ ث ت بٌْیی بًكی :»2« گكی ی یًىت. هو يٌ اوت ا لِاً اغتلال ایدبؼ ؽًٌٌٌ، هثلاً: ثف هط لَّات آ كًین بّی پف تٍئیي وبقی تأثیف گؿاـؼ . . . :»3« گكی ی »4« -149 گشينه ي لًًَئ تَیؽ بّ پی ؽًَ یّؽـ لٍ یً ؽًاـ ؽً اهب ؼـ وبیف گكی بّ : ، DNA ؼـ یي ـ تٌ اق ه لَ لٌَ ؼـ ضیي ػول تفخو )tRNA( ثب آ تًی ؽً ىٍ )mRNA( ؽً ىٍ :»1« هثبل گكی ی tRNA ثؼ یٕ اق لًًَئ تَیؽ بّی :»2« هثبل گكی ی ؼـ ضیي ػول ـ یًٍَىی DNA ثب RNA : »3« هثبل گكی ی »1« -151 گشينه ي ثب ت خَ ث لٌٌ قیف ه ػٍ هی ؼٌَ خبیگب ـا ا ؽًاق تؼؽاؼ قیبؼی لًًَئ تَیؽ ؼاـؼ و لًًَئ تَیؽ )AUG( ؽً ىٍ آؿبق )CCA( ؼـ ضبلی خبیگب ات بّل آهی اٌَویؽ خبیگب آؿبق ـ یًٍَىی یًك یي لًًَئ تَیؽ ؼاـؼ . »3« -151 گشينه ي خؽا هی ؼٌَ. DNA پلی هفاق په اق ـ یًٍَىی اق خبیگب پبیبى ـ یًٍَىی اق RNA ؼهت ؼا تٌ ثب یٌؽ آ كًین ؼلیل بًؼـوت ث ؼَى وبیف گكی بّ : ؼـ اؼـاـ اكفاؼ هجتلا ث ثیوبـی آل بٌپت ـًََیب ، هبؼ ی وّ خَ تٌیىیي اویؽ خٍ ؼَ ؼاـؼ. :»1« گكی ی اوت. RNA ا لٍیي هؽم ثفای وبغت یي پف تٍئیي، وبغت :»2« گكی ی هجل اق یًف جًف ه ػٍ ؽٌ ث ؼَ ـهك بّ و ضفكی ىّت ؽٌ. :»4« گكی ی »1« -152 گشينه ي ؼـ یي ول لَ ی بًَـی تَی: ی ثبلؾ ىّت mRNA هطل ت یٌٍل پی ؽًَ ثیي ـ تًٌٍَ بّی اگك ىٍ ثفای ت یٌٍل ىّت ای ؽً ىٍ ىّت DNA هطل ت یٌٍل پی ؽًَ ثیي ـهك بّی ی ا لٍی ىّت mRNA هطل ىٌٌت ؽٌى پی ؽًَ ثیي ه هًََف بّی هطل ت یٌٍل پی ؽًَ ثیي ؼ آهی اٌَویؽ ؼـ ـیج قَ مٍ ویت پَلاون هطل ت یٌٍل پی ؽًَ كىل ؼَی اوتف ثیي ؼ ؽً ىٍ ىّت هطل ت یٌٍل پی ؽًَ ثیي ؽً ىٍ آ تًی ؽً ىٍ ویت پَلاون ویت پَلاون tRNA هطل ىٌٌت ؽٌى پی ؽًَ ثیي آهی اٌَویؽ ی ا لٍی ىّت mRNA هطل ت یٌٍل پی ؽًَ ثیي ه هًََف بّی
  19. 19. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 19 - 153 »3« گشينه ي ؿبلجبً ت ظٌین ثیبى لى ؼـ ی بًَـی تَ بّ، گٌّبم فٌ عٍ ـ یًٍَىی اوت. ؼـ ی بًَـی تَ بّ، ثفغلاف پف بًٍـی تَ بّ، آ كًین RNA پلی هفاق ث ت بٌْیی وًی ت اَ ؽً ـا ا ؽًاق ـا بٌٌوبیی ؽًٌ. بٌٌوبیی ـا ا ؽًاق ث وًي پف تٍئیي بّی هػ یَِّ ث بًم ػ اَهل ـ یًٍَىی ـَِت هی گیفؼ. -154 »2« گشينه ي وّ كَیل نَ آ لًل آَ كًا ػًَی ثب تًفی اوت كؼبل ؽًٌٌ ) ػًَی ػبهل ـ یًٍَىی( ؽًاـؼ. :»1« گكی ی ه هًََف وبق ؽً ی ػبهل ـ یًٍَىی، آهی اٌَویؽ ه هًََف وبق ؽً ی ت اَلی اككای ؽٌ ،ُ لًًَئ تَیؽ هی ثب ؽٌ. :»4« گكی ی -155 »4« گشينه ي ثب ـٍ ؼٍ ػبهل پبیبى تفخو ث خبیگب A ـیج قَ مٍ، یي آ كًین پی ؽًَ ثیي آغفیي tRNA ی ه خَ ؼَ ؼـ خبیگب P ـا ثب پلی پپتیؽ یّؽـ لٍیك هی ؽًٌ. ثفـوی وبیف گكی بّ: خبیگب :»1« گكی ی CCA ؼـ tRNA ، خبیگب ات بّل آهی اٌَویؽ اغت بّ یِ هی ثب ؽٌ ؼاـای ؼ عًَ ثبق آلی ویت قَیي آؼ یًي اوت. آهی اٌَویؽ ث لًًَئ تَیؽ آؼ یًي ؼاـ هت لّ هی ؼٌَ. ث لٌٌ بّی لِط بّی 15 تب 17 تًبة ؼـوی ؼهت وًبییؽ. :»2« گكی ی :»3« گكی ی RNA پلی هفاق III ـ یًٍَىی اق لى بّی tRNA ثفغی RNA بّی زًَي ـا ا دًبم هی ؼ ؽّ. اگفز ه لَ لٌَ tRNA تي ـ تٌ ای اوت، اهب وّب ًٙ ـَ ؼـ لٌٌ 1 5 تًبة ؼـوی ه بٍ ؽّ هی ؼٌَ، ثفغی اق ثػ بًّی - tRNA ؼـ اثف تبغ ـَؼگی ؼ ـ تٌ ای ؽٌ ضب یٍ پی ؽًَ بّی یّؽـ لٍ یً اوت. -156 »4« گشينه ي RNA بّی زًَي ؼـ ی بًَـی تَ بّ ت وَ RNA پلی هفاق II RNA پلی هفاق III وبغت هی ؼٌَ، اگف ه لَ لٌَ ثبلؾ mRNA ثب ؽٌ ؼـ وبغتبـ غ ؼَ ؽً ىٍ ـ تًٌٍَ اگك ىٍ ؼاـؼ لٍی اگف tRNA ثب ؽٌ، ؼـ وبغتبـ غ ؼَ آ تًی ؽً ىٍ خبیگب ات بّل آهی اٌَویؽ غ اَ ؽّ ؼا تٌ. -157 »2« گشينه ي ه ؽٌ ه خَ ؼَ ؼـ خبیگب ات بّل آهی اٌَویؽی اق عًَ ـیج قَ ) RNA ( اوت ه ؽٌ ه خَ ؼَ ؼـ و گكی ی ؼیگف اق عًَ ؼئ ىًَی ـیج قَ ( DNA ( ىّت ؽٌ. -158 »3« گشينه ي فًاتیي ی یٌ اق پف تٍئیي بّی ه اوت ثب ت خَ ث كؼبلیت لِط ی 19 تًبة ؼـ وبغتبـ آى آهی اٌَویؽ ك یٌل آلا یًي خٍ ؼَ ؼاـؼ. -159 »4« گشينه ي ثفای اپفاى لي یي لى ت ظٌین ؽًٌٌ خٍ ؼَ ؼاـؼ پف تٍئیي ت ظٌین ؽًٌٌ )پف تٍئیي ه بْـ ؽًٌٌ (ُ ـا ـهكؼ یّ هی ؽًٌ. ثفـوی وبیف گكی بّ: :»1« گكی ی mRNA ی ا لٍی ) بًثبلؾ( په اق تـییفاتی هتطول هی ؼٌَ ث mRNA ی ثبلؾ تجؽیل هی ؼٌَ ی یٌ اق ایي تـییفات تًَب ؽٌى )ضؿف ـ تًٌٍَ بّی ای تٌف یًٍ( اوت. هط لَّات اپفاى لي ثفای خؿة تدكی ی لا تً قَ لاقم ىّت ؽٌ. :»2« گكی ی كفآی ؽٌ پف تٍئیي وبقی، وّب ؽًٌ ؼیگف كفآی ؽٌ بّی و تٌكی ؼـ ىٍ ول لَ یًبقه ؽٌ آ كًین ا فًلی اوت، كو هفضل ی :»3« گكی ی پبیب یً آى. -161 »2« گشينه ي ثب ت خَ ث ایي ت ظٌین ثیبى لى ؼـ ی بًَـی تَ بّ ؼـ هفاضل ثؼؽ اق غف جٍ mRNA اق ىّت ،ِ گٌّبم تفخو یب ثؼؽ اق ػول تفخو ،ِ یًك هو يٌ اوت ـظ ؼ ؽّ، ایي اه بٌى خٍ ؼَ ؼاـؼ تفخو ی mRNA بّی ج٘یؼی ه خَ ؼَ ؼـ ویت پَلاون یًك ـَِت گًیفؼ، اهب ؼـ فّ ضبل ایي mRNA بّ هبثلیت تفخو ؽٌى ـا ؼاـ ؽً. -161 »2« گشينه ي خب ؽًاـ ه ـَؼ هٙبلؼ ی ثیؽل تیت مَ پًي ـًَ وٍپ ـَا )ی بًَـی تَ( اوت. خب ؽًاـ ه ـَؼ هٙبلؼ ی لا ةًَ ه ثب تًفی ا. لًای اوت. بٌٌوبیی ـا ا ؽًاق ؼـ ی بًَـی تَ بّ ث ت بٌْیی ت وَ RNA پلی هفاق ـَِت وًی گیفؼ ثل ث وًي ػ اَهل ـ یًٍَىی اوت.
  20. 20. 21 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. -162 »4« گشينه ي اپفاى ز ؽٌ ل یً ت لَیؽ ز ؽٌ ـ تٌ ی پلی پپتیؽی ـا تًٌفل هی ؽًٌ. اؿلت RNA بّ ) وّ ی آى بّ(، ثؼؽ اق ت لَیؽ تًَب هی ؽًٌَ. ثفای ت یٌٍل وبغتبـ پف هب ؽًٌ، ز ؽٌ RNA پلی هفاق ثب كب لِ ی قهب یً) ث ـَ٘ نّ قهبى( ـ یٍ ـا ا ؽًاق هفاـ هی گیف ؽً. -163 »2« گشينه ي خب ؽًاـ ه ـَؼ آقهبی ثیؽل تیت مَ، پًي ـًَ وٍپ ـَا هی ثب ؽٌ. هبـذ بّ ی بًَـی تَ ىّت ؽٌ ؼـ ی بًَـی تَ بّ، ت ظٌین ثیبى لى، ؿبلجبً گٌّبم فٌ عٍ ـ یًٍَىی اوت. ـؼ وبیفگكی بّ: خب ؽًاـ ه ـَؼ آقهبی لا ةًَ ه ،ًََ ثب تًفی ا فٌی یٍب لًای اوت :»1« گكی ی RNA پلی هفاق پف بًٍـی تَی ؼاـؼ. ت ظٌین ثیبى لى ؼـ ا فٌی یٍب لًای، ؼـ خؿة لا تً قَ اق هطی وً ؼاـؼ. :»3« گكی ی پًي ـًَ وٍپ ـَا، ی بًَـی تَ اوت ػبهل ت ظٌین ؽًٌٌ ،ُ ؼـ ویىتن اپفا یً ثب تًفی ؼیؽ هی ؼٌَ. :»4« گكی ی -164 »2« گشينه ي آ تًی ؽً ىٍ ACA ه وٌل ؽً ىٍ UGU هی ثب ؽٌ ایي ت اَلی هفث ث ؽً ىٍ آهی اٌَویؽ ویىتئیي اوت. tRNA بّ ؼـ خبیگب ات بّل آهی اٌَویؽ ت اَلی CCA ـا ؼاـ ؽً. ؼـ ؤي وّ ی tRNA بّ ث خك tRNA ی آؿبقگف وّی ث خبیگب A ـیج قَ مٍ اٍـؼ اق خبیگب P غبـج هی ؽًٌَ. ت خَ ؼاـیؽ tRNA ؼـ ی بًَـی تَ بّ ت وَ RNA پلی هفاق III ؼـ پف بًٍـی تَ بّ ت وَ RNA پلی هفاق پف بًٍـی تَی وبغت هی ؼٌَ. -165 »3« گشينه ي ؼـا تً بْی لى 2ٍ 1 اپفاى لي، خبیگب پبیبى ـ یًٍَىی خٍ ؼَ ؽًاـؼ. ـا ا ؽًاق ؼـ كًؼی یٌ خبیگب آؿبق ـ یًٍَىی هفاـ ؼاـؼ. ت بٌْ ؼـ ؿیبة گل كًَ ض ـَٕ لا تً قَ، اپفاى لي ـ يٌٍ هی ؼٌَ. mRNA ی ز ؽٌ ل یً بًضی ی لًًَئ ئَیؽی ؼـ پف بًٍـی تَ بّ ؼیؽ هی ؽًٌَ. -166 »4« گشينه ي ثػ ت ظٌین ؽًٌٌ ی اپفاى لي اق ؼ هىوت ـا ا ؽًاق اپفات ـَ وبغت ؽٌ اوت اق ـ یٍ ـا ا ؽًاق ـ یًٍَىی ا دًبم وًی ؼٌَ. ول لَی ؼاـای ػبهل ـ یًٍَىی اوت ول لَ ی بًَـی تَ اوت ث بٌثفایي ؼـ آى اپفات ـَ ؼیؽ وًی ؼٌَ. اق ثیبى لى ت ظٌین ؽًٌٌ ،ُ پف تٍئیي ت ظٌین ؽًٌٌ ػبهل ت ظٌین ؽًٌٌ ؼـ ول لَ وبغت هی ؼٌَ. قهب یً اپفاى لي غبه يَ اوت، هط لَّات آى ؼـ ول لَ نً اوت. -167 تکزار سوال 111 است، حذف شود. -168 »4« گشينه ي آ كًین وبق ؽً ی ؽً ىٍ RNA پلی هفاق II اوت ثفای ات بّل ث ـا ا ؽًاق یًبق ث پف تٍئیي بّیی ث بًم ػ اَهل ـ یًٍَىی ؼاـؼ. -169 »3« گشينه ي فّ ـیج قَ مٍ ؼ خبیگب ؼاـؼ. ی یٌ خبیگب P )ثفای پلی پپتیؽ ؼـ ضبل وبغت( ؼیگفی خبیگب A )ثفای آهی اٌَویؽ(. ؽً ىٍ بّی پبیبى ظًیف UGA فِكبً ؼـ ىٍ خبیگب A اٍـؼ هی ؽًٌَ. ـؼ وبیف گكی بّ: ثفای ؽً ىٍ بّی پبیبى یّر آ تًی ؽً یًٍ خٍ ؼَ ؽًاـؼ، لؿا ث آهی اٌَویؽ نّ تفخو وًی ؽًٌَ. :»4 1« گكی بّی یي آهی اٌَویؽ هو يٌ اوت ثی اق یي ـهك ؼا تٌ ثب ؽٌ، په هی ت اَ ؽً ث وّبى تؼؽاؼ، ؽً ىٍ ؼا تٌ ثب ؽٌ. : »2« گكی ی -171 »1« گشينه ي كو ه ـَؼ ج، خول ـا ث ـَ٘ بًؼـوتی ت وٌیل هی ؽًٌ، قیفا ه لَ لٌَ بّی ضب لِ اق ـ یًٍَىی، RNA بّیی ىّت ؽٌ ت وَ آ كًین بّی RNA پلی هفاق ـ یًٍَىی هی ؽًٌَ. الق هو يٌ یًىت یي لى، یي ثبـ ت وَ - RNA پلی هفاق I ثبـ ؼیگف ت وَ RNA پلی هفاق II ـ یًٍَىی ؼٌَ. ة ی یٌ اق ق دًیف بّی پلی لًًَئ تَیؽی فّ لى ؼـ ـ یًٍَىی ت وَ - RNA پلی هفاق ؼـ وّب ؽًٌ وبقی ت وَ DNA پلی هفاق ث ػ اٌَى الگ ه ـَؼ اوتلبؼ هفاـ هی گیفؼ. ؼ ؼـ ضیي ـ یًٍَىی پی ؽًَ بّی یّؽـ لٍ یً ؼ ـ تٌ ی - DNA ت وَ آ كًین RNA پلی هفاق ىٌٌت هی ؽًٌَ. -171 »4« گشينه ي خبیگب آؿبق ـ یًٍَىی ث ا لٍیي لًًَئ تَیؽی گلت هی ؼٌَ ـ یًٍَىی هی ؼٌَ، یؼ یٌ یي لًًَئ تَیؽ اوت. لٍی وبیف ه اَـؼ اق و لًًَئ تَیؽ ت یٌٍل ؽٌ ا ؽً.
  21. 21. ) فصل 1 : پروتئين سبزي علی کرامت )ویژه کنکور 49 Keramat A. 21 - 172 »1« گشينه ي ایي ؼ هطون ثفای ثفـوی ػول لى اق بّ بٍّی هبـزی ث بًم پًي ـًَ وٍپ ـَا فًاوب اوتلبؼ فًؼ ؽً. پًي ـًَ وٍپ ـَا فًاوب ی بًَـی تَ اوت ؼاـای RNA پلی هفاق بّی I ، II III هی ثب ؽٌ. هط لَّ RNA پلی هفاق I ، rRNA هط لَّ RNA پلی هفاق III ، tRNA اوت تفخو وًی ؽًٌَ. ؽً ىٍ :»2« گكی ی UUU ه وٌل آ تًی ؽً ىٍ tRNA ای اوت ضبهل آهی اٌَویؽ ك یٌل آلا یًي هی ثب ؽٌ. ؼـ ی بًَـی تَ بّ هطل ـ یًٍَىی ىّت هطل تفخو ویت پَلاون اوت. :»3« گكی ی :»4« گكی ی RNA پلی هفاق III لى بّی tRNA ـا ـ یًٍَىی هی ؽًٌ. -173 »3« گشينه ي ؼـ هفضل ی آؿبق كفای ؽٌ تفخو ،ِ tRNA ی ضبهل هتی یًَي ث ـَ٘ هىتوین اٍـؼ خبیگب p ـیج قَ مٍ هی ؼٌَ. ؼـ :»1« گكی ی mRNA ی ا لٍی ـ تًٌٍَ اگك ىٍ ای تٌف ىٍ ؼـ mRNA ی ثبلؾ كو ـ تًٌٍَ اگك ىٍ خٍ ؼَ ؼاـؼ. ثل ؽَ :»2« گكی ی mRNA ؼـ ىّت ـظ هی ؼ ؽّ. ؼـ ی٘ ثل ؽَ mRNA ، RNA هتطول تـییفاتی هی ؼٌَ. ی یٌ اق تـییفات ؼـ اؿلت RNA بّی ی بًَـی تَی تًَب ؽٌى ه لَ لٌَ RNA ی ا لٍی اوت. تؼؽاؼ خبث خبیی ـیج قَ مٍ ثف ـ یٍ :»4« گكی ی mRNA ثب تؼؽاؼ پی ؽًَ پپتیؽی ؼـ ـ تٌ ی پلی پپتیؽی ضب لِ اق تفخو ثفاثف اوت. -174 »2« گشينه ي ثی تًف آهی اٌَویؽ بّ ثی اق یي ؽً ىٍ ؼاـ ؽً. ؽً ىٍ بّی پبیبى، آ تًی ؽً ىٍ ؽًاـ ؽً. آ تًی ؽً ىٍ بٌهل و ثبق اوت ) و خلت ثبق!(. اهب فّ آ تًی ؽً ىٍ هٙؼبً هفث ث یي عًَ آهی اٌَویؽ غب اوت. -175 »4« گشينه ي ضیي ـ یًٍَىی اق خبیگب پبیبى ـ یًٍَىی، ثیي ـیج لًًََئ تَیؽ بّ پی ؽًَ كىل ؼَی اوتف ت یٌٍل هی ؼٌَ ثیي ؼئ ىًَی ـیج لًًََئ تَیؽ بّ، قیفا هط لَّ كفای ؽٌ ـ یًٍَىی ه لَ لٌَ RNA اوت DNA ثبیؽ ػ اٌَى »3« . ؼـ ه ـَؼ گكی ی فًؼ ؼـ اپفاى بّی ضب یٍ ز ؽٌ لى وبغتبـی mRNA بّی ز ؽٌ ل یً ایدبؼ هی ؽًٌٌ، لى بّی هیب یً ) ظًیف لى 2 ؼـ اپفاى لي( ؼاـای خبیگب آؿبق ـ یًٍَىی اٍخؽ خبیگب پبیبى ـ یًٍَىی هی ثب ؽٌٌ. -176 »3« گشينه ي ؼـ ی بًَـی تَ بّ هطل ت لَیؽ ثل ؽَ mRNA ؼـ ىّت اوت. خب ؽًاـ ه ـَؼ هٙبلؼ یِ ثیؽل تیت مَ، پًي ـًَ وٍپ ـَا فًاوب هی ثب ؽٌ. ی یٌ اق تـییفات RNA بّی ا لٍی ثفای ثبلؾ ؽٌى ضؿف ـ تًٌٍَ ای تٌف ىٍ اوت. لً كفای ؽٌ پف تٍئیي وبقی وّب ؽًٌ ؼیگف كفای ؽٌ بّی و تٌكی ؼـ ىٍ ول لَ، یًبقه ؽٌ آ كًین ا فًلی اوت، ایي كو هفضل ی پبیبى پف تٍئیي وبقی یًبقه ؽٌ آ كًین ثب ؽٌ. ی یٌ اق تـییفاتی ؼـ اؿلت RNA بّی ی بًَـی تَی ) ت بٌْ mRNA ( ـ یٍ هیؼ ؽّ تًَب ؽٌى RNA اوت. -177 »4« گشينه ي ات بّل آهی اٌَویؽ بّ ؼـ ول لَ ت وَ ػًَی rRNA ه خَ ؼَ ؼـ وبغتوبى ـیج قَ مٍ ـَِت هی گیفؼ په وّ ی آ كًین بّی پف تٍئی یٌ ت وَ rRNA ه خَ ؼَ ؼـ ـیج قَ مٍ و تٌك هی ؽًٌَ په تًید هی گیفین اگف آ كًیوی ت وَ یي آ كًین پف تٍئی یٌ و تٌك ؼٌَ ؼـ وبغتوب آهی اٌَویؽ ؽًاـؼ لٍی آیب ز یٌي آ كًیوی خٍ ؼَ ؼاـؼ؟ ثل غ ؼَ rRNA ، وً آ كًیوی ؼاـؼ، ت وَ آ كًین پف تٍئی یٌ RNA پلی هفاق ت لَیؽ هی ؼٌَ. ثفـوی وبیف گكی بّ: ؼیؽین ثب ایي :»1« گكی ی rRNA ؼـ وبغتوبى غ ؼَ آهی اٌَویؽ ؽًاـؼ لٍی هبؼـ ث بًتبلیك كفای ؽٌ و تٌك آثؽ یّ اوت. كو گف یٍّ اق :»2« گكی ی RNA بّی زًَي ت وَ RNA پلی هفاق III وبغت هی ؽًٌَ ثوی ت وَ RNA پلی هفاق II وبغت هی ؽًٌَ هبؼـ ث و تٌك RNA بًهل یًىت. آ كًین لّی بٌق :»3« گكی ی RNA پلی هفاق پی ؽًَ یّؽـ لٍ یً ـا هی ؽٌٌٌٌ لٍی پی ؽًَ كىل ؼَی اوتف ـا وًی ؽٌٌٌٌ. -178 »2« گشينه ي ه ـَؼ الق هی ت اَ ؽً ثفای ول لَ بّی پف بًٍـی تَی بِؼم جًب ؽٌ ه ـَؼ ة هٙؼبً ثفای ول لَ بّی پف بًٍـی تَی بِؼم یًىت. ه ـَؼ الق ث غب ف٘ خٍ ؼَ اپفاى بّی ز ؽٌل یً ثبلٙجغ تفخو ی ز ؽٌیي پلی پپتیؽ ه ـَؼ ة ث ؼلیل ػؽم خٍ ؼَ ىّت ؼـ پف بًٍـی تَ بّ.
  22. 22. 22 علی کرامت )ویژه کنکور 49 ( هرگونه کپی برداری از این مجموعه ممنوع است! فصل 1: پروتئين سبزي Keramat A. -179 »4« گشينه ي ثفای وبغت یي ق دًیف ی پلی پپتیؽی ت بٌْ یي ـیج قَ مٍ فٌ تً ؼاـؼ. ـؼ وبیف گكی بّ: ثفای پف تٍئیي بّیی ثی اق یي ق دًیف ی پلی پپتیؽی ؼاـ ؽً، اه بٌى پؿیف اوت. :»1« گكی ی ؼـ كفای ؽٌ وّب ؽًٌوبقی :»2« گكی ی DNA ، ـا ا ؽًاق لى یًك ث ػ اٌَى الگ ه ـَؼ اوتلبؼ هفاـ هی گیفؼ. ثفای پف بًٍـی تَ بّ كبهؽ ىّت ا ؽً هطل وّب ؽًٌوبقی، ـ یًٍَىی تفخو ی یٌ اوت، اه بٌى پؿیف اوت. :»3« گكی ی -181 »3« گشينه ي ه اَـؼ الق، ة ؼ طِیص ىّت ؽٌ. ثفـوی ه اَـؼ: الق( ؼـ ی بًَـی تَ بّ mRNA ی ا لٍی په اق تـییفاتی هتطول هی ؼٌَ، ث mRNA ی ثبلؾ تجؽیل ثفای تفخو ث ویت پَلاون كفوتبؼ هی ؼٌَ. ة( ـاث ثیي DNA پف تٍئیي، mRNA اوت ؼـ پف بًٍـی تَ بّ ؼـ ویت پَلاون یؼ یٌ هطل كؼبلیت ـیج قَ مٍ بّ وبغت هی ؼٌَ. ج( ؼـ هفاضل پف كٍبق، هتبكبق آ بًكبق هیت قَ هی قَ ؼـ زفغ ی ول لَی ث ػلت بًپؽیؽ ؽٌى ؿ بٍء ىّت ،ِ هبؼ ی ل تًی یٌ ؼـ توبن هىتوین ثب ویت پَلاون اوت. ؼ( ؼـ ضیي كفای ؽٌ تفخو )پف تٍئیي وبقی( ؼ خكء زًَي ثكـ ـیج قَ مٍ ث نّ هی پی ؽًَ ؽً، په فّ ز تؼؽاؼ ایي ـیج قَ مٍ بّ ثی تًف ثب ؽٌ پف تٍئیي وبقی ؽٌیؽتف اوت. -181 »2« گشينه ي mRNA ای هىتویوبً ؼـ اثف ـ یًٍَىی لى ت لَیؽ هی ؼٌَ ؼـ ی بًَـی تَ بّ اق عًَ mRNA ا لٍی اوت اق خول تـییفاتی ـ یٍ ایي mRNA ؼـ ىّت ـظ هی ؼ ؽّ، تًَب ؽٌى آى اوت. ز ىَ ایي كفآی ؽٌ هجل اق غف جٍ mRNA اق ىّت ا دًبم هی گیفؼ، په ت وَ آ كًین بّی ه خَ ؼَ ؼـ یٌف ی ىّت ا دًبم هی ؼٌَ. ثفـوی وبیف گكی بّ: آ كًین :»1« گكی ی RNA پلی هفاق كو اق ـ یٍ یي ـ تٌ ـ یًٍَىی هی ؽًٌ. هفاـگیفی آ تًی ؽً ىٍ :»3« گكی ی UAC ؼـ خبیگب P ـیج قَ مٍ ؼـ هفضل ی آؿبق تفخو ا دًبم هی ؼٌَ. )ثفای ا لٍیي ثبـ( ثؽ ىٍ خٍ ؼَ ػ اَهل ـ یًٍَىی ا لِاً آ كًین :»4« گكی ی RNA پلی هفاق ی بًَـی تَی هبؼـ ث بٌٌوبیی ـا ا ؽًاق ػً اَ ؽّ ث ؼَ.

×