Ce diaporama a bien été signalé.
Nous utilisons votre profil LinkedIn et vos données d’activité pour vous proposer des publicités personnalisées et pertinentes. Vous pouvez changer vos préférences de publicités à tout moment.
M K REDDY
GROUP LEADER
CROP IMPROVEMENT GROUP
INTERNATIONAL CENTRE FOR GENETIC ENGINEERING AND BIOTECHNOLOGY
Editing rice-...
One can edit any genome by expressing Cas9 Protein and gRNA
Maize
Ubiquitin
Promoter
Cas9
NOS
terminator
Rice U6
Promoter ...
MTU1010 high yielding popular rice mega-verity
Cas9 & sgRNA encoding genes
Together cloned into single
plant transformatio...
1234567891011121314151617MPN
PCR Screening transgenic plants for Cas9 integration
PCRamplificationoftargetregionfromtheCas...
Single allelic rice TB1 (Os03g49880) locus editing in different MTU1010 edited lines
GGCGGGCAAGGCGTCGACGCCGG
GCAAGAACAATTGAGGCACCTTGG
ControlriceplantEditedriceplant Bi-allelic DEP1 (Os09g26999) editing in rice MTU1010 cultivar
MTU1010 high yielding popular rice mega-verity
Cas9 & sgRNA encoding genes
Together cloned into single
plant transformatio...
Bi-allelic rice TB1 (Os03g49880) locus editing in different MTU1010 edited lines
MTU1010 high yielding popular rice mega-verity
Cas9 & sgRNA encoding genes
Together cloned into single
plant transformatio...
Cytokinin Oxidase Regulates Rice spike architecture and increase he grain number
• The rice OsCKX2 differentially expresse...
GACGTCGAGCTCTAGCACGTTGG
TWO NUCLETIDE DELEATION IN CKX2 GENE IN RICE MTU1010
MTU1010 high yielding popular rice mega-verity
Cas9 & sgRNA encoding genes
Together cloned into single
plant transformatio...
GW2 QTL for rice grain and weight encodes a RING-type E3 ubiquitin ligase
GW2 loss of function increased cell divisions in...
PCR fragment cut with Sca1 (AGTACT) edited line will cut control won’t Cut
OsDEP1 (Os09g26999)
knockout rice line
OsTB1 (Os03g49880)
knockout rice line
RBLB
WDV ALS repair template
A P W S
96 171 548 627
122 197 574 653
Four known ALS herbicide resistance endowing mutations...
Introduction of of precise SNP (C to T, or G to A) mutations
without any double strand break and without HDR template
THANK YOU
Editing rice-genome with CRISPR/Cas9:  To improve agronomic traits for increased crop productivity
Editing rice-genome with CRISPR/Cas9:  To improve agronomic traits for increased crop productivity
Editing rice-genome with CRISPR/Cas9:  To improve agronomic traits for increased crop productivity
Editing rice-genome with CRISPR/Cas9:  To improve agronomic traits for increased crop productivity
Editing rice-genome with CRISPR/Cas9:  To improve agronomic traits for increased crop productivity
Editing rice-genome with CRISPR/Cas9:  To improve agronomic traits for increased crop productivity
Prochain SlideShare
Chargement dans…5
×

Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increased crop productivity

53 vues

Publié le

Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increased crop productivity by MK Reddy during the Regional Expert Consultation on Gene Editing in Agriculture and its Regulations Technical Session III

  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increased crop productivity

  1. 1. M K REDDY GROUP LEADER CROP IMPROVEMENT GROUP INTERNATIONAL CENTRE FOR GENETIC ENGINEERING AND BIOTECHNOLOGY Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increased crop productivity
  2. 2. One can edit any genome by expressing Cas9 Protein and gRNA Maize Ubiquitin Promoter Cas9 NOS terminator Rice U6 Promoter sgRNA Terminator
  3. 3. MTU1010 high yielding popular rice mega-verity Cas9 & sgRNA encoding genes Together cloned into single plant transformation vector Agrobacterium mediated Rice transformation & regeneration Cas9 & sgRNA expressing Transgenic rice plants were identified Targeted genome edited rice plants were identified Transgenic component free genome edited rice lines generated Through sequence analysis Through Molecular analysis Segregating out the transgenic component Cas9 and sgRNA Through crossing, selfing and subsequent selection Putative transgenic rice plants generated OsDEP1 (Os09g26999) knockout rice line OsTB1 (Os03g49880) knockout rice line OsCKX2 (Os08g0509600) knockout rice line OsGW2 (Os02g2914720) knockout rice line Non-transgenic high yielding genome edited rice lines Background work done related to the project
  4. 4. 1234567891011121314151617MPN PCR Screening transgenic plants for Cas9 integration PCRamplificationoftargetregionfromtheCas9positivetransgeneiclines 1 2 3 4 5 6 7 10 11 13 14 15168 9 12 17 Generating Cas9 and sgRNA expressing transgenic rice
  5. 5. Single allelic rice TB1 (Os03g49880) locus editing in different MTU1010 edited lines GGCGGGCAAGGCGTCGACGCCGG
  6. 6. GCAAGAACAATTGAGGCACCTTGG ControlriceplantEditedriceplant Bi-allelic DEP1 (Os09g26999) editing in rice MTU1010 cultivar
  7. 7. MTU1010 high yielding popular rice mega-verity Cas9 & sgRNA encoding genes Together cloned into single plant transformation vector Agrobacterium mediated Rice transformation & regeneration Cas9 & sgRNA expressing Transgenic rice plants were identified Targeted genome edited rice plants were identified Transgenic component free genome edited rice lines generated Through sequence analysis Through Molecular analysis Segregating out the transgenic component Cas9 and sgRNA Through crossing, selfing and subsequent selection Putative transgenic rice plants generated OsDEP1 (Os09g26999) knockout rice line OsTB1 (Os03g49880) knockout rice line OsCKX2 (Os08g0509600) knockout rice line OsGW2 (Os02g2914720) knockout rice line Non-transgenic high yielding genome edited rice lines Background work done related to the project
  8. 8. Bi-allelic rice TB1 (Os03g49880) locus editing in different MTU1010 edited lines
  9. 9. MTU1010 high yielding popular rice mega-verity Cas9 & sgRNA encoding genes Together cloned into single plant transformation vector Agrobacterium mediated Rice transformation & regeneration Cas9 & sgRNA expressing Transgenic rice plants were identified Targeted genome edited rice plants were identified Transgenic component free genome edited rice lines generated Through sequence analysis Through Molecular analysis Segregating out the transgenic component Cas9 and sgRNA Through crossing, selfing and subsequent selection Putative transgenic rice plants generated OsDEP1 (Os09g26999) knockout rice line OsTB1 (Os03g49880) knockout rice line OsCKX2 (Os08g0509600) knockout rice line OsGW2 (Os02g2914720) knockout rice line Non-transgenic high yielding genome edited rice lines Background work done related to the project
  10. 10. Cytokinin Oxidase Regulates Rice spike architecture and increase he grain number • The rice OsCKX2 differentially expresses in rice inflorescence • Cytokinin oxidase degrades cytokine and negatively regulates the inflorescence branching • Absence of OsCKX2 expression cytokine accumulation and increases the grain number Ashikari et al 2005 Science: 309, 741-745
  11. 11. GACGTCGAGCTCTAGCACGTTGG TWO NUCLETIDE DELEATION IN CKX2 GENE IN RICE MTU1010
  12. 12. MTU1010 high yielding popular rice mega-verity Cas9 & sgRNA encoding genes Together cloned into single plant transformation vector Agrobacterium mediated Rice transformation & regeneration Cas9 & sgRNA expressing Transgenic rice plants were identified Targeted genome edited rice plants were identified Transgenic component free genome edited rice lines generated Through sequence analysis Through Molecular analysis Segregating out the transgenic component Cas9 and sgRNA Through crossing, selfing and subsequent selection Putative transgenic rice plants generated OsDEP1 (Os09g26999) knockout rice line OsTB1 (Os03g49880) knockout rice line OsCKX2 (Os08g0509600) knockout rice line OsGW2 (Os02g2914720) knockout rice line Non-transgenic high yielding genome edited rice lines Background work done related to the project
  13. 13. GW2 QTL for rice grain and weight encodes a RING-type E3 ubiquitin ligase GW2 loss of function increased cell divisions in spikelet hull resulting in enhanced grain width, weight and yield GW2: Os02g14720
  14. 14. PCR fragment cut with Sca1 (AGTACT) edited line will cut control won’t Cut
  15. 15. OsDEP1 (Os09g26999) knockout rice line OsTB1 (Os03g49880) knockout rice line
  16. 16. RBLB WDV ALS repair template A P W S 96 171 548 627 122 197 574 653 Four known ALS herbicide resistance endowing mutations Chlorsulfuron Bensulfuron methyl Imazaquin Imazapyr Bispyribac sodium Pyrithiobac sodium Pyriminobac A/V P/S W/L S/I 10 190 55 14 20 1 140 300 9100 25 3.7 5.3 56 13 8300 9100 56 14 2800 2900 6500 4.2 43 21 14 83 350 3300 2.4 73 6.8 10 41 200 2500 200 14000 45 10 16000 9100 13000 Arabidopsis Rice Viral based vectors for delivery of repair template Rep expression cassette Rep terPromoter sgRNA
  17. 17. Introduction of of precise SNP (C to T, or G to A) mutations without any double strand break and without HDR template
  18. 18. THANK YOU

×