Les facteurs génétiques d'hôte en relation avec le paludisme

1 610 vues

Publié le

Les facteurs génétiques d'hôte en relation avec le paludisme - Conférence de la 2e édition du Cours international « Atelier Paludisme » - MIGOT-NABIAS Florence - Institut de Recherche pour le Développement - Florence.Migot-Nabias@ird.sn

0 commentaire
0 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Vues
Nombre de vues
1 610
Sur SlideShare
0
Issues des intégrations
0
Intégrations
2
Actions
Partages
0
Téléchargements
21
Commentaires
0
J’aime
0
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive

Les facteurs génétiques d'hôte en relation avec le paludisme

  1. 1. Facteurs génétiques humains & paludisme à P. falciparum Florence Migot-NabiasUR 10 « Santé de la mère et de l’enfant » IRD, Dakar, Sénégal migot@ird.sn
  2. 2. Existence d’une régulation génétique des réponses immunitaires spécifiques du paludismeDifférences individuelles, familiales ou ethniques desréponses immunitaires contre P. falciparum, dans desconditions d’exposition identiquesConcordance plus importante entre jumeauxmonozygotes que dizygotes: Pour le développement de fièvre lors d’un accès palustre: régulation génétique des cytokines pyrogènes Pour la production d’anticorps dirigés contre différents antigènes plasmodiaux
  3. 3. Système HLA & paludismeSouris: restriction génétique des réponses lymphocytaires à des épitopes de la CSP et de Pf155/RESAAccès palustre grave: Protection contre le neuropaludisme (HLA-B53) et contre l’anémie sévère liée au paludisme (HLA-DRB1*1302-DQB1*0501) Plus grande susceptibilité au neuropaludisme chez les sujets homozygotes ou hétérozygotes pour l’allèle TNF-308A Allèle TNF-238A associé (+) à l’anémie sévère liée au paludisme ou (-) au neuropaludismeAccès palustre simple: HLA I et II non associés à la résistance aux accès simples Présence ou non de relations entre allèles HLA I et II et réponse immunitaire à des antigènes des stades sanguins de P. falciparum
  4. 4. Organisation génétique du système HLA Classe II Classe III Classe ICentromère duchromosome 6 D C4A, C4B, C2 α β B C A 21-OHase TNF (α2) α1 (α) (α2) α1 α DP DN D DQ DR O (β2) β1 (β1) (β2) β1 β1 β3 β4
  5. 5. Association peptide/HLA I et reconnaissance par les LyT cytotoxiques Ly T cytotoxique Lyse de la cellule infectée TCR CD 8 CPA Vésicule de sécrétion cytoplasme Golgi Réticulum endoplasmiqu e protéine protéasome peptide HLA classe I β2-microglobuline In: « Immunologie », Revillard, 1994
  6. 6. Association peptide/HLA II et reconnaissance par les LyT auxiliaires•Production d’anticorps par les Ly B Ly T•Relargage de cytokines induisant la lyse auxiliaire des micro-organismes intracellulaires par les macrophages Protéine exogène TCR CD 4récepteur CPA -cytoplasme- Compartiment des molécules HLA classe II Dissociation et + Endosome dégradation de la chaîne I peptides (protéases ) Réticulum endoplasmique Golgi Lysosome + + = I α β αβ + I In: « Immunologie », Revillard, 1994
  7. 7. Facteurs non-HLA de régulation génétiqueContribution importante de gènes non liés à la régionHLA dans la régulation génétique des réponsesimmunitaires dirigées contre P. falciparumLa région chromosomique 5q31-q33 (gènes decytokines, gènes de régulation de la réponse immune)interviendrait dans le contrôle des niveaux d’infectionpar P. falciparum
  8. 8. Polymorphisme érythrocytaire & paludismeProtection clinique Trait drépanocytaire, alpha-thalassémie, déficit en G6PD, ovalocytose, groupe sanguin ABO, groupe DuffyMécanismes proposés Modification des antigènes érythrocytaires de surface favorisant la reconnaissance immunitaire (alpha-thal) Sensibilité accrue au stress oxydant favorisant la phagocytose des parasites (déficit G6PD) Ralentissement de la croissance parasitaire dans les hématies anormales (Hb S) Facilitation (groupe A) ou limitation (groupe O) de la formation de rosettesAutres polymorphismes érythrocytaires moins directementliés à la protection Hb C, Hb E, béta-thalassémie, récepteur du complément CR1
  9. 9. Pourquoi s’intéresser en 2004 aupolymorphisme érythrocytaire en relation avec le paludisme ?Les particularités des érythrocytes « anormaux » peuventêtre utilisées pour la conception d’un vaccin Utilisation de la réponse anticorps anti-bande 3 (protéine exprimée à la surface des érythrocytes sénescents, ou infectés par Plasmodium, ou de sujets drépanocytaires, déficitaires en G6PD ou béta-thalassémiques) JR Kennedy, Int J Parasitol 2001 & Med Sci Monit 2002Les modifications des réponses immunitaires spécifiquesengendrées par les facteurs génétiques affectantl’érythrocyte restent méconnues Nos programmes de recherche au Gabon (1995-2001) puis au Sénégal (2002-2005)
  10. 10. Structure de l’hémoglobine αβ β Gγ Αγ δ β Gγ Αγ δ β Chromosome 11 α hème α2 α1 α2 α1 Chromosome 16 naissance α β γ δ Hb F Hb A Hb A2 α2 γ2 α2 β 2 α2 δ2
  11. 11. Trait drépanocytaire & PaludismeMutation ponctuelle au locus des β globines(hémoglobine S): Hb ASFréquence variant de >20% en Afriqueéquatoriale à <5% en Afrique du nordProtection des jeunes enfants Hb AS contre lesaccès simples (60%) et graves (90%) (Hill 1992)Mécanismes: Élimination plus rapide des GRP falciformes par la rate Persistance de Hb F qui retarde la croissance du parasite
  12. 12. Détermination du variant HbS (PCR-RFLP) Séquence du fragment amplifié du variant HbS (chromosome 11, exon 6 du gène de la béta-globine, 369 pb)HbS-F5’agtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcc(93pb)/tgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc(201pb)/ttAggctgctggtggtctacccttggacccagaggttctttgagtcctttggggatctgtccactcctgatgctg(75pb) HbS-R: 3’agacaggtgaggactacgac 5’ Substitution nucléotidique A>T entraînant une modification d’acide aminé Glu>Val 294 pb 201 pb Digestion par l’enzyme de restriction Dde I: La mutation abolit le site de coupure 93 pb 75 pb Ho Hé PM Hé N
  13. 13. Alpha-thalassémie & PaludismeDélétion d’1 à 4 gènes de l’alpha globineAfrique: -α3.7 thalassémie (5-40%)La délétion α+ homozygote (-α/-α) favorisel’infestation précoce des enfants par P. vivax.Ceci permettrait le développement ultérieur d’unemeilleure immunité vis-à-vis de P. falciparum etaussi envers d’autres agents infectieux (Williams1996, Allen 1997)
  14. 14. Détermination des –α3.7 thalassémies par PCR TS1 TS2 TS1 TS35’ α2 α1 3’ La délétion -α 3.7 de 3.7 kb entraîne la formation d’un gène hybride fonctionnel α2α1 α2 α1 Appellation Génotype TS1/TS2 (α2) TS1/TS3 (α1) αα/αα 1,9 kb 2,1 kb α+ hétérozygote -α3.7/αα 1,9 1,9 + 2,1 α+ homozygote -α3.7/-α3.7 - 1,9 α0/α+ --/-α3.7 - 1,9
  15. 15. Déficit en G6PD & PaludismeEtudes épidémiologiques 400 millions de personnes concernées dans le monde Variant G6PD A- associé à 46% (58%) de réduction du risque d’infection sévère chez les filles hétérozygotes (garçons hémizygotes) – Ruwende 1995 -Mécanismes en jeu Le déficit en G6PD crée un stress oxydant qui altère la croissance du parasite dans le GR Après 4 à 5 cycles de schizogonie, le parasite s’adapte en exprimant sa propre G6PD – Usanga & Luzzatto 1985 -
  16. 16. Déficit en G6PD / PhysiologieLa Glucose-6-Phospho-Déshydrogénase (G6PD) Enzyme cytoplasmique qui catalyse la première réaction de la voie des pentoses phosphates contribue à diminuer le stress oxydant subi par les cellulesGène porté par le chromosome X Phénomène de lyonisation de l’X Nécessité de mener des analyses séparées en fonction du sexe A un génotype donné ne correspond pas un phénotype donné
  17. 17. Variants G6PD en Afrique sub- saharienne3 variants alléliques principaux parmi les 400identifiés G6PD B, 60 à 80% activité enzym. normale G6PD A, 15 à 40% activité enzym. de 85% mutation ponctuelle 376G G6PD A-, 0 à 25% activité enzym. de 12% mutation ponctuelle 202A additionnelle à 376G autres mutations additionnelles: 542T (Santamaria), 680T et 968CGénotypes et phénotypes Normal Déficitaire Homme B, A A- Femme BB, BA, AA BA-, AA-, A-A-
  18. 18. Détermination du variant G6PD A (PCR- RFLP) Séquence du fragment amplifié du variant G6PD A (chromosome X, exon 5, 585 G6PD-3 pb) 5’ctgcgttttctccgccaatcatagttgggtgtcatgattttggagagagagctttctccagtgtatttctcccaggtcaaaa tatcctgaaatctggcctctgtcctaaggcacaggggtcccagcctggggcagtgtctgtgctgcctgctttggcctccctccc tctGgatgtgcagagct(183pb)/gctaagatggggctgaacccagtgtgggacggggacactgacttctgagggcaccctcc ctggacctccagggaagaccctccactcccctggggcagaacacacacggactcaaagagaggggctgacatctgtctgtgtgt ctgtctgtccgtgtctcccaggccaccccagaggagaagctcaagctggaggacttctttgcccgcaactcctatgtggctggc cagtacgatgatgcagcctcctaccagcgcctcaacagccacatGgatgccctccacc(285pb)/tggggtcacaggccaacc gcctcttctacctggccttgcccccgaccgtctacgaggccgtcaccaagaacattcacgagtcctgcatgagccagatgtaag gcttgccgttgccct(117pb) 3’ G6PD- 2:3’cattccgaacggcaacggga 5’ Substitution nucléotidique A>G en position 376 de la partie codante, entraînant une modification402 pb d’acide aminé Asn>Asp en position 126 de la protéine285 pb Digestion par l’enzyme de restriction Fok183 pb I: la mutation crée le site de coupure117 pb M = homo- ou hémi-zygote H = hétérozygote
  19. 19. Détermination du variant G6PD A- (PCR- RFLP)Séquence du fragment amplifié du variant G6PD A- (chromosome X, exon 4, 109 pb) G6PD-6 5’gtggctgttccgggatggccttctgcccgaaaacaccttcatcAtg(46pb)/ggctatgcccgttcccgcctca cagtggctgacatccgcaaacagagtgagcccttcttcaag(63pb) G6PD-7: 3’cgtttgtctcactcgggaagaagttc 5’ Substitution nucléotidique G>A en position 202 de la partie codante, entraînant une modification d’aa Val>Meth en position 68 de la protéine 109 pb Digestion par Nla III: la mutation 63 pb crée le site de coupure 46 pbHét PM N Hom PM Hém
  20. 20. Génotypage de la G6PD / Niakhar, Sénégal403 enfants d’origine Sereer, sans lien de parentédirect G6PD A: Filles G6PD BA = 38% et G6PD AA = 9% Garçons G6PD A = 30% G6PD A-: seulement 1,2% (3 G6PD BA-, 1 G6PD AA-, 1 G6PD A-)Hypothèses Particularité génétique de l’ethnie Sereer Autre mutation additionnelle associée à un déficit enzymatique que la mutation 202APoursuite du génotypage (collaboration Hôp. Robert Debré, Paris) Enfants G6PD A: recherche des mutations 968C, 542T (Santamaria) et 680T Enfants G6PD B: recherche de la mutation 542T (Malaga)
  21. 21. ConclusionDiscordance des études Association possible de plusieurs anomalies génétiquesModifications géniques importantes de l’hôte en réponseà la pression de sélection exercée par P. falciparum Hématie: site direct d’action de l’infection palustre Système immunitaire (MBP, répertoire TCR, cytokines …) Autres systèmes (HTA, surcharge en fer)Polymorphisme antigénique du parasite Complexité des interactions hôte-parasite Implications vaccinales potentielles

×