SlideShare une entreprise Scribd logo
1  sur  12
Télécharger pour lire hors ligne
Sample Preparation for
Diagnostics & Life Science
A
G
C
T
Next Generation
Sequencing Products
CancerSeq-Characterized Cancer FFPE tissue samples
by Next Generation Sequencing (NGS)
Sample and Services for Next Generation Sequencing
Cancer Gene Panel-NGS Testing Service
RapidSeq-Directonal mRNA Sample Prep Kit for NGS
RapidSeq-Small RNA Sample Prep Kit for NGS
Sample Preparation for
Diagnostics & Life Science
www.biochain.com
1-888-762-2568 (Main)
order@biochain.com (Order)
BioChain’s CancerSeq™
genetically characterized FFPE blocks give you
and your data more power
Blocks and Slides available for:
- Breast Cancers
- Colon Cancers
- Lung Cancers
- Melanomas
- Other Cancers (via request)*
Cancer Gene Panel Includes:
The Illumina TruSeq® Amplicon - Cancer Panel
(TSACP) to characterize 48 cancer genes,
including BRAF, KRAS, EGFR, ALK, and Tp53.
Features
- Tissue from a wide variety of sources, Whole FFPE blocks, slides, and DNA
- Suitable for immunohistochemistry, in situ hybridization assays,
and molecular applications
ABL1 ERBB4 JAK2 PIK3CA
AKT1 FBXW7 JAK3 PTEN
ALK FGFR1 KDR PTPN11
APC FGFR2 KIT RB1
ATM FGFR3 KRAS RET
BRAF FLT3 MET SMAD4
CDH1 GNA11 MLH1 SMARCB1
CDKN2A GNAQ MPL SMO
CSF1R GNAS NOTCH1 SRC
CTNNB1 HNF1A NPM1 STK11
EGFR HRAS NRAS TP53
ERBB2 IDH1 PDGFRA VHL
CATALOG # PRODUCT NAME SIZE
T2235086-SB CancerSeq™ Paraffin Tissue Tumor Block: Breast 1 Block
T2235090-SB CancerSeq™ Paraffin Tissue Tumor Block: Colon 1 Block
T2235152-SB CancerSeq™ Paraffin Tissue Tumor Block: Lung 1 Block
T2235218A-SB CancerSeq™ Paraffin Tissue Tumor Block: Skin Melanoma 1 Block
- Make sense out of ambiguous IHC results by knowing the genetics
- Buy just the blocks with the right genetic background
- Search our databases for blocks with novel mutations
- Take advantage of NGS without expensive infrastructure
NGS Samples and
Services
As a provider of tissues and nucleic acids derived from them,
BioChain is uniquely positioned to extract DNA and RNA from the
most challenging tissues, and perform re-sequencing and RNAseq.
Tissues:
We have over 300,000 Frozen and FFPE blocks to collect DNA and RNA
from. You may also contract with us to procure rare materials for your
sequencing project.
Extraction:
We have provided high quality DNA and RNA from the most challenging
tissues including FFPE blocks, cartilage, and brain for over 15 years.
Library preparation:
We are Experienced with all Illumina library preparation kits as well as
our proprietary RapidSeqTM small RNA library prep kit.
Illumina MiSeq NGS:
With special expertise in RNAseq and resequencing with Trueseq
Custom and Cancer Amplicon panels, we handle a wide variety of
sequencing projects.
Data analysis and consultation:
We can help with experimental design through variant calling and anno-
tation.
Cancer Driver Gene Panel
NGS Testing Service
One - Step Shop Cancer Sequencing Test
Services from Beginning to End
NGS Leading Platform
-
- Greater than 35 kb of cancer
consensus targets including BRAF,
KRAS & EGFR
- 212 amplicons in one tube; 48 genes
Unrivaled Multiplexing
- Up to 96 sample pooling on MiSeq
- >90% specificity and uniformity
- Detect low frequency variants (<5%)
Unparalleled Workflow
- FFPE-enabled with sample QC Kit
- Automated paired end sequencing
with MiSeq
Industry Standard Delivery
- Cost-effective solution
- Quick turn-around time
ABL1 EGFR GNAS MLH1 RET
AKT1 ERBB2 HNF1A MPL SMAD4
ALK ERBB4 HRAS NOTCH1 SMARCB1
APC FBXW7 IDH1 NPM1 SMO
ATM FGFR1 JAK2 NRAS SRC
BRAF FGFR2 JAK3 PDGFRA STK11
CDH1 FGFR3 KDR PIK3CA TP53
CDKN2A FLT3 KIT PTEN VHL
CSF1R GNA11 KRAS PTPN11
CTNNB1 GNAQ MET RB1
48 Cancer Biomarker
AATTCCGGCCGATCAGGGG
TTTACACCAATGGGACCATTAC
CCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGG
AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACC
CAAAGGCC
TTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGAATTCCGGCCGATCAGGGGTTTACACCAAT
GGTTTACACCAATGGGACCATTACCAAC
Directional mRNA
Sample Prep Kit
Sample Prep System for mRNA Sequencing
Features
• Low RNA Input
Requires as little as 50 ng of total RNA input
• Directional
Increased useful number of reads
• < 1 Hour Hands-on Time
Streamlined workflow
Library construction in < 7 hours
• All-in-One Kit
Includes all necessary enzymes and plastics
• FFPE RNA Compatible
High Quality Libraries without
Artifacts or Contaminations
Bioanalyzer Trace of Constructed Library
of mRNA from corn
Description
The RapidSeq Directional mRNA Sample Prep kit provides strand-specific cDNA synthesis
with reduced costs and increased sensitivity.
Directionality Assessment
Comparison with TruSeq in Prokaryotic Cells
mRNA Input (ng) Sample Type % Sense
100 (Competitor I Kit) FFPEmRNA (1 year) 97.85%
100 (RapidSeq Kit) FFPEmRNA (1 year) 97.88%
500 (Competitor I Kit) FFPEmRNA (10 years) 97.59%
500 (RapidSeq Kit) FFPEmRNA (10 years) 97.57%
Parameter TruSeq RapidSeq
Coverage Rate 44.00% 65.00%
rRNA Contamination with 23s, 16s, and 5s
removal
2.70% 1.50%
tRNA contamination 64.00% 57.00%
Unknown sequence percentage 5.00% <1%
Directional Percentage 74% 77.50%
Average Quality Score (range from 0 to 40,
with 40 being the highest quality)
26 37
CATALOG # PRODUCT NAME
KS073012 RapidSeq High Yield Directional mRNA Sample Prep Kit - Without Aligner
KS073012 I-IV RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligners 1-48
K2012008 MagSeq mRNA Purification Kit
AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGGTGGCCATGGAACCTTGGAC
AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGGTGGCCATGGAACCTTGGACCCATTTAGAACAG
Small RNA Sample
Prep Kit Everything you need in one box
Applications
• Small RNA discovery and quantification
• miRNA expression profiling
• miRNA related functional assessments
Description
The RapidSeq Small RNA Sample Prep Kit
is a cost effective and reliable solution for small
RNA library preparation using Illumina’s
sequencing platform. Our reagents are master
mixed for optimal performance and simple
experiment setup, which minimizes human error.
RapidSeq can be used for a variety of studies
involving small RNA libraries.
Construct Pure Libraries
with no Artifacts or Contamination
Bioanalyzer Trace of FFPE microRNA Library
Highly Consistent and
Reproducible Results
Normalized R2 Plot of miRNA counts
from Two Replicate Libraries
CATALOG # PRODUCT NAME
KS071012-I RapidSeq Small RNA Sample Prep Kit - With Aligner 1-12
KS071012-II RapidSeq Small RNA Sample Prep Kit - With Aligner 13-24
KS071012-III RapidSeq Small RNA Sample Prep Kit - With Aligner 25-36
KS071012-IV RapidSeq Small RNA Sample Prep Kit - With Aligner 37-48
Save time
Less than 1 hour hands-on (7 hours with incubations).
Avoid purchasing headaches
Includes all necessary enzymes and plastics.
Don’t worry about RNA quantity
Good results with as little as 1 ng or as much as 10 µg of total RNA.
Have FFPE RNA? No problem!
FFPE RNA compatible
NGS Related
Products
T2235086-SB CancerSeq Parafin Tissue Tumor Block: Breast 1 Block
T2235090-SB CancerSeq Parafin Tissue Tumor Block: Colon 1 Block
T2235152-SB CancerSeq Parafin Tissue Tumor Block: Lung 1 Block
T2235218A-SB CancerSeq Parafin Tissue Tumor Block: Skin Melanoma 1 Block
KS073012-I RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 1-12 1 Kit
KS073012-II RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 13-24 1 Kit
KS073012-III RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 25-36 1 Kit
KS073012-IV RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 37-48 1 Kit
KS073012 RapidSeq High Yield Directional mRNA Sample Prep Kit - Without Aligner 1 Kit
KS073012-T
RapidSeq High Yield Directional mRNA Sample Prep Kit, Trial version enough
for 2 rxn. Customer select aligners
1 Kit
KS074012-I RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 1-12 1 Kit
KS074012-II RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 13-24 1 Kit
KS074012-III RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 25-36 1 Kit
KS074012-IV RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 37-48 1 Kit
KS074012 RapidSeq High Yield Small RNA Sample Prep Kit - Without Aligners 1 Kit
KS074012-T
RapidSeq High Yield Small RNA Sample Prep Kit, Trial version enough for 2 rxn.
Customer select aligners
1 Kit
KS075012-I RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 1-12 1 Kit
KS075012-II RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 13-24 1 Kit
KS075012-III RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 25-36 1 Kit
KS075012-IV RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 37-48 1 Kit
KS075012 RapidSeq Mastermix Directional mRNA Sample Prep Kit - Without Aligners 1 kit
KS071012-I RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 1-12 1 Kit
KS071012-II RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 13-24 1 Kit
KS071012-III RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 25-36 1 Kit
KS071012-IV RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 37-48 1 Kit
KS071012 RapidSeq MasterMix Small RNA Sample Prep Kit - Without Aligner 1 Kit
CATALOG # DESCRIPTION UNITS
Other Related
Products
D1B34999-G02 Control Genomic DNA - Bovine Female 100 µg
D1B34999-G01 Control Genomic DNA - Bovine Male 100 µg
D1C34999-G02 Control Genomic DNA - Chicken Female 100 µg
D1C34999-G01 Control Genomic DNA - Chicken Male 100 µg
D1534999-Cy-G02 Control Genomic DNA - Cynomolgus Monkey Female 100 µg
D1534999-Cy-G01 Control Genomic DNA - Cynomolgus Monkey Male 100 µg
D1734999-G02 Control Genomic DNA - Dog Female 100 µg
D1734999-G01 Control Genomic DNA - Dog Male 100 µg
D1G34999-G02 Control Genomic DNA - Guinea Pig Female 100 µg
D1G34999-G01 Control Genomic DNA - Guinea Pig Male 100 µg
D1H34999-G02 Control Genomic DNA - Hamster Female 100 µg
D1H34999-G01 Control Genomic DNA - Hamster Male 100 µg
D1234999-G02 Control Genomic DNA - Human Female 100 µg
D1234999-G01 Control Genomic DNA - Human Male 100 µg
D1334999-G02 Control Genomic DNA - Mouse Female 100 µg
D1334999-G01 Control Genomic DNA - Mouse Male 100 µg
D1934999-G02 Control Genomic DNA - Porcine Female 100 µg
D1934999-G01 Control Genomic DNA - Porcine Male 100 µg
D1834999-G02 Control Genomic DNA - Rabbit Female 100 µg
D1834999-G01 Control Genomic DNA - Rabbit Male 100 µg
D1434999-G02 Control Genomic DNA - Rat Female 100 µg
D1434999-G01 Control Genomic DNA - Rat Male 100 µg
D1534999-G02 Control Genomic DNA - Rhesus Monkey Female 100 µg
D1534999-G01 Control Genomic DNA - Rhesus Monkey Male 100 µg
R1234010-50 Total RNA - Human Adult Normal Tissue: Bladder 50 µg
R1234035-50 Total RNA - Human Adult Normal Tissue: Brain 50 µg
R1234086-50 Total RNA - Human Adult Normal Tissue: Breast 50 µg
R1234090-50 Total RNA - Human Adult Normal Tissue: Colon 50 µg
R1234090-P Total RNA - Human Adult Normal Tissue 5 Donor Pool: Colon 50 µg
R1234122-50 Total RNA - Human Adult Normal Tissue: Heart 50 µg
R1234142-50 Total RNA - Human Adult Normal Tissue: Kidney 50 µg
R1235010-10 Total RNA - Human Tumor Tissue: Bladder 10 µg
R1235023-10 Total RNA - Human Tumor Tissue: Bone 10 µg
R1235086-50 Total RNA - Human Tumor Tissue: Breast 50 µg
R1235090-50 Total RNA - Human Tumor Tissue: Colon 50 µg
R1235142-50 Total RNA - Human Tumor Tissue: Kidney 50 µg
R1235149-50 Total RNA - Human Tumor Tissue: Liver 50 µg
Control Genomic DNA
Total RNA
Sample Preparation for Diagnostics & Life Science
www.biochain.com
1-888-762-2568 (Main)
order@biochain.com (Order)

Contenu connexe

Tendances

20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA Roberto Scarafia
 
Knowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsKnowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsGolden Helix Inc
 
Next-generation sequencing course, part 1: technologies
Next-generation sequencing course, part 1: technologiesNext-generation sequencing course, part 1: technologies
Next-generation sequencing course, part 1: technologiesJan Aerts
 
Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...QBiC_Tue
 
High Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can KnowHigh Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can KnowBrian Krueger
 
A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...Alexander Jueterbock
 
QIAseq Targeted DNA, RNA and Fusion Gene Panels
QIAseq Targeted DNA, RNA and Fusion Gene PanelsQIAseq Targeted DNA, RNA and Fusion Gene Panels
QIAseq Targeted DNA, RNA and Fusion Gene PanelsQIAGEN
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencingDayananda Salam
 
140127 abrf interlaboratory study proposal
140127 abrf interlaboratory study proposal140127 abrf interlaboratory study proposal
140127 abrf interlaboratory study proposalGenomeInABottle
 
Next Generation Sequencing (NGS)
Next Generation Sequencing (NGS)Next Generation Sequencing (NGS)
Next Generation Sequencing (NGS)LOGESWARAN KA
 
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Thermo Fisher Scientific
 
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeThe Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeJustin Johnson
 
Aug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plansAug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plansGenomeInABottle
 
Exploring new frontiers with next-generation sequencing
Exploring new frontiers with next-generation sequencingExploring new frontiers with next-generation sequencing
Exploring new frontiers with next-generation sequencingQIAGEN
 
Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)Sebastian Schmeier
 
Molecular QC: Interpreting your Bioinformatics Pipeline
Molecular QC: Interpreting your Bioinformatics PipelineMolecular QC: Interpreting your Bioinformatics Pipeline
Molecular QC: Interpreting your Bioinformatics PipelineCandy Smellie
 
Next generation sequencing methods
Next generation sequencing methods Next generation sequencing methods
Next generation sequencing methods Mrinal Vashisth
 
Next Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisNext Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisBastian Greshake
 
Introduction to Next-Generation Sequencing (NGS) Technology
Introduction to Next-Generation Sequencing (NGS) TechnologyIntroduction to Next-Generation Sequencing (NGS) Technology
Introduction to Next-Generation Sequencing (NGS) TechnologyQIAGEN
 

Tendances (20)

20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �20160219 - S. De Toffol -  Dal Sanger al NGS nello studio delle mutazioni BRCA �
20160219 - S. De Toffol - Dal Sanger al NGS nello studio delle mutazioni BRCA
 
Knowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsKnowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and Variants
 
Next-generation sequencing course, part 1: technologies
Next-generation sequencing course, part 1: technologiesNext-generation sequencing course, part 1: technologies
Next-generation sequencing course, part 1: technologies
 
Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...
 
High Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can KnowHigh Throughput Sequencing Technologies: What We Can Know
High Throughput Sequencing Technologies: What We Can Know
 
A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...
 
QIAseq Targeted DNA, RNA and Fusion Gene Panels
QIAseq Targeted DNA, RNA and Fusion Gene PanelsQIAseq Targeted DNA, RNA and Fusion Gene Panels
QIAseq Targeted DNA, RNA and Fusion Gene Panels
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
 
140127 abrf interlaboratory study proposal
140127 abrf interlaboratory study proposal140127 abrf interlaboratory study proposal
140127 abrf interlaboratory study proposal
 
Next Generation Sequencing (NGS)
Next Generation Sequencing (NGS)Next Generation Sequencing (NGS)
Next Generation Sequencing (NGS)
 
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
Massively Parallel Sequencing - integrating the Ion PGM™ sequencer into your ...
 
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single MoleculeThe Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
The Next, Next Generation of Sequencing - From Semiconductor to Single Molecule
 
Aug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plansAug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plans
 
Exploring new frontiers with next-generation sequencing
Exploring new frontiers with next-generation sequencingExploring new frontiers with next-generation sequencing
Exploring new frontiers with next-generation sequencing
 
Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)Next-generation sequencing and quality control: An Introduction (2016)
Next-generation sequencing and quality control: An Introduction (2016)
 
Molecular QC: Interpreting your Bioinformatics Pipeline
Molecular QC: Interpreting your Bioinformatics PipelineMolecular QC: Interpreting your Bioinformatics Pipeline
Molecular QC: Interpreting your Bioinformatics Pipeline
 
Next generation sequencing methods
Next generation sequencing methods Next generation sequencing methods
Next generation sequencing methods
 
Next Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisNext Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome Analysis
 
Introduction to Next-Generation Sequencing (NGS) Technology
Introduction to Next-Generation Sequencing (NGS) TechnologyIntroduction to Next-Generation Sequencing (NGS) Technology
Introduction to Next-Generation Sequencing (NGS) Technology
 
Ngs part i 2013
Ngs part i 2013Ngs part i 2013
Ngs part i 2013
 

En vedette

En vedette (11)

Facts About America’s Power Grid
Facts About America’s Power GridFacts About America’s Power Grid
Facts About America’s Power Grid
 
Biochain PCR Products
Biochain PCR ProductsBiochain PCR Products
Biochain PCR Products
 
De Turbo
De TurboDe Turbo
De Turbo
 
Nigerian objectsquiz
Nigerian objectsquizNigerian objectsquiz
Nigerian objectsquiz
 
Verslag van Deskundig Onderzoek
Verslag van Deskundig OnderzoekVerslag van Deskundig Onderzoek
Verslag van Deskundig Onderzoek
 
Eindwerk De Turbo UptoDate
Eindwerk De Turbo UptoDateEindwerk De Turbo UptoDate
Eindwerk De Turbo UptoDate
 
All About Workplace Electrical Safety
All About Workplace Electrical SafetyAll About Workplace Electrical Safety
All About Workplace Electrical Safety
 
Electrical Safety In The Workplace
Electrical Safety In The WorkplaceElectrical Safety In The Workplace
Electrical Safety In The Workplace
 
Top 5 Causes of Electrical Accidents
Top 5 Causes of Electrical AccidentsTop 5 Causes of Electrical Accidents
Top 5 Causes of Electrical Accidents
 
Electrical Power Distribution Systems Design
Electrical Power Distribution Systems DesignElectrical Power Distribution Systems Design
Electrical Power Distribution Systems Design
 
Doc1
Doc1Doc1
Doc1
 

Similaire à Sample Preparation for Next Generation Sequencing

Technical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideTechnical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideQIAGEN
 
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-Seq
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-SeqNUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-Seq
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-SeqHimanshu Sethi
 
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for AllThe QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for AllQIAGEN
 
FFPE Applications Solutions brochure
FFPE Applications Solutions brochureFFPE Applications Solutions brochure
FFPE Applications Solutions brochureAffymetrix
 
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...QIAGEN
 
Apac distributor training series 3 swift product for cancer study
Apac distributor training series 3  swift product for cancer studyApac distributor training series 3  swift product for cancer study
Apac distributor training series 3 swift product for cancer studySwift Biosciences
 
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...Merck Life Sciences
 
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...MilliporeSigma
 
2012 10-24 - ngs webinar
2012 10-24 - ngs webinar2012 10-24 - ngs webinar
2012 10-24 - ngs webinarElsa von Licy
 
Achieve Complete Coverage of the SARS-CoV-2 Genome
Achieve Complete Coverage of the SARS-CoV-2 GenomeAchieve Complete Coverage of the SARS-CoV-2 Genome
Achieve Complete Coverage of the SARS-CoV-2 GenomeCamille Cappello
 
ATAC-seq protocol--Creative Biogene
ATAC-seq protocol--Creative BiogeneATAC-seq protocol--Creative Biogene
ATAC-seq protocol--Creative BiogeneDonglin Bao
 
Sensitive and Reliable Variant Detection From Challenging Samples
Sensitive and Reliable Variant Detection From Challenging SamplesSensitive and Reliable Variant Detection From Challenging Samples
Sensitive and Reliable Variant Detection From Challenging SamplesQIAGEN
 
Simultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleSimultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleQIAGEN
 
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012sequencing_columbia
 

Similaire à Sample Preparation for Next Generation Sequencing (20)

Technical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideTechnical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the Guide
 
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-Seq
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-SeqNUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-Seq
NUGEN-X-Gen_2011_poster_trancriptome_sequencing_RNA-Seq
 
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for AllThe QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
 
FFPE Applications Solutions brochure
FFPE Applications Solutions brochureFFPE Applications Solutions brochure
FFPE Applications Solutions brochure
 
Pcr array 2013
Pcr array 2013Pcr array 2013
Pcr array 2013
 
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
Application Note: A Simple One-Step Library Prep Method To Enable AmpliSeq Pa...
 
Mutation pp
Mutation ppMutation pp
Mutation pp
 
Apac distributor training series 3 swift product for cancer study
Apac distributor training series 3  swift product for cancer studyApac distributor training series 3  swift product for cancer study
Apac distributor training series 3 swift product for cancer study
 
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...
Rapid replication competent adenovirus (rRCA) detection: Accelerate your lot ...
 
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...
Rapid Replication Competent Adenovirus (rRCA) Detection: Accelerate your Lot ...
 
Ffpe pcr array
Ffpe pcr arrayFfpe pcr array
Ffpe pcr array
 
2012 10-24 - ngs webinar
2012 10-24 - ngs webinar2012 10-24 - ngs webinar
2012 10-24 - ngs webinar
 
Achieve Complete Coverage of the SARS-CoV-2 Genome
Achieve Complete Coverage of the SARS-CoV-2 GenomeAchieve Complete Coverage of the SARS-CoV-2 Genome
Achieve Complete Coverage of the SARS-CoV-2 Genome
 
ATAC-seq protocol--Creative Biogene
ATAC-seq protocol--Creative BiogeneATAC-seq protocol--Creative Biogene
ATAC-seq protocol--Creative Biogene
 
Pcrarray
PcrarrayPcrarray
Pcrarray
 
Epigenetics 2013
Epigenetics 2013Epigenetics 2013
Epigenetics 2013
 
Sensitive and Reliable Variant Detection From Challenging Samples
Sensitive and Reliable Variant Detection From Challenging SamplesSensitive and Reliable Variant Detection From Challenging Samples
Sensitive and Reliable Variant Detection From Challenging Samples
 
Simultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleSimultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE Sample
 
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012
Peter Nagy, Columbia Agilent Symposium, Jan, 27 2012
 
Wnt part ii 2013
Wnt part ii 2013Wnt part ii 2013
Wnt part ii 2013
 

Plus de biochain

Biochain Ready to-use Genomic DNA
Biochain Ready to-use Genomic DNABiochain Ready to-use Genomic DNA
Biochain Ready to-use Genomic DNAbiochain
 
Biochain QPCR SuperMix, Dye- and Probe-based
Biochain QPCR SuperMix, Dye- and Probe-basedBiochain QPCR SuperMix, Dye- and Probe-based
Biochain QPCR SuperMix, Dye- and Probe-basedbiochain
 
Biochain Ready to-use Tissue Sections and Panels
Biochain Ready to-use Tissue Sections and PanelsBiochain Ready to-use Tissue Sections and Panels
Biochain Ready to-use Tissue Sections and Panelsbiochain
 
Biochain RNA Research Tools
Biochain RNA Research ToolsBiochain RNA Research Tools
Biochain RNA Research Toolsbiochain
 
Biochain DNA Isolation Kits
Biochain DNA Isolation KitsBiochain DNA Isolation Kits
Biochain DNA Isolation Kitsbiochain
 
Biochain Cancer Tissue Array
Biochain Cancer Tissue ArrayBiochain Cancer Tissue Array
Biochain Cancer Tissue Arraybiochain
 

Plus de biochain (6)

Biochain Ready to-use Genomic DNA
Biochain Ready to-use Genomic DNABiochain Ready to-use Genomic DNA
Biochain Ready to-use Genomic DNA
 
Biochain QPCR SuperMix, Dye- and Probe-based
Biochain QPCR SuperMix, Dye- and Probe-basedBiochain QPCR SuperMix, Dye- and Probe-based
Biochain QPCR SuperMix, Dye- and Probe-based
 
Biochain Ready to-use Tissue Sections and Panels
Biochain Ready to-use Tissue Sections and PanelsBiochain Ready to-use Tissue Sections and Panels
Biochain Ready to-use Tissue Sections and Panels
 
Biochain RNA Research Tools
Biochain RNA Research ToolsBiochain RNA Research Tools
Biochain RNA Research Tools
 
Biochain DNA Isolation Kits
Biochain DNA Isolation KitsBiochain DNA Isolation Kits
Biochain DNA Isolation Kits
 
Biochain Cancer Tissue Array
Biochain Cancer Tissue ArrayBiochain Cancer Tissue Array
Biochain Cancer Tissue Array
 

Dernier

call girls in Connaught Place DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in Connaught Place  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...call girls in Connaught Place  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in Connaught Place DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...saminamagar
 
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service MumbaiVIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbaisonalikaur4
 
Noida Sector 135 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few C...
Noida Sector 135 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few C...Noida Sector 135 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few C...
Noida Sector 135 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few C...rajnisinghkjn
 
call girls in munirka DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in munirka  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in munirka  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in munirka DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️saminamagar
 
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original PhotosCall Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photosnarwatsonia7
 
Russian Call Girls Gunjur Mugalur Road : 7001305949 High Profile Model Escort...
Russian Call Girls Gunjur Mugalur Road : 7001305949 High Profile Model Escort...Russian Call Girls Gunjur Mugalur Road : 7001305949 High Profile Model Escort...
Russian Call Girls Gunjur Mugalur Road : 7001305949 High Profile Model Escort...narwatsonia7
 
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment BookingCall Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Bookingnarwatsonia7
 
Housewife Call Girls Hsr Layout - Call 7001305949 Rs-3500 with A/C Room Cash ...
Housewife Call Girls Hsr Layout - Call 7001305949 Rs-3500 with A/C Room Cash ...Housewife Call Girls Hsr Layout - Call 7001305949 Rs-3500 with A/C Room Cash ...
Housewife Call Girls Hsr Layout - Call 7001305949 Rs-3500 with A/C Room Cash ...narwatsonia7
 
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service BangaloreCall Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalorenarwatsonia7
 
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdfHemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdfMedicoseAcademics
 
Call Girls Viman Nagar 7001305949 All Area Service COD available Any Time
Call Girls Viman Nagar 7001305949 All Area Service COD available Any TimeCall Girls Viman Nagar 7001305949 All Area Service COD available Any Time
Call Girls Viman Nagar 7001305949 All Area Service COD available Any Timevijaych2041
 
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort Service
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort ServiceCollege Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort Service
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort ServiceNehru place Escorts
 
Hematology and Immunology - Leukocytes Functions
Hematology and Immunology - Leukocytes FunctionsHematology and Immunology - Leukocytes Functions
Hematology and Immunology - Leukocytes FunctionsMedicoseAcademics
 
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...narwatsonia7
 
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...narwatsonia7
 
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment BookingCall Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment BookingNehru place Escorts
 
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service Chennai
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service ChennaiCall Girls Service Chennai Jiya 7001305949 Independent Escort Service Chennai
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service ChennaiNehru place Escorts
 

Dernier (20)

call girls in Connaught Place DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in Connaught Place  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...call girls in Connaught Place  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in Connaught Place DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
 
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
 
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service MumbaiVIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
 
Noida Sector 135 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few C...
Noida Sector 135 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few C...Noida Sector 135 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few C...
Noida Sector 135 Call Girls ( 9873940964 ) Book Hot And Sexy Girls In A Few C...
 
call girls in munirka DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in munirka  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in munirka  DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in munirka DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
 
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original PhotosCall Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
 
Russian Call Girls Gunjur Mugalur Road : 7001305949 High Profile Model Escort...
Russian Call Girls Gunjur Mugalur Road : 7001305949 High Profile Model Escort...Russian Call Girls Gunjur Mugalur Road : 7001305949 High Profile Model Escort...
Russian Call Girls Gunjur Mugalur Road : 7001305949 High Profile Model Escort...
 
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment BookingCall Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
 
Housewife Call Girls Hsr Layout - Call 7001305949 Rs-3500 with A/C Room Cash ...
Housewife Call Girls Hsr Layout - Call 7001305949 Rs-3500 with A/C Room Cash ...Housewife Call Girls Hsr Layout - Call 7001305949 Rs-3500 with A/C Room Cash ...
Housewife Call Girls Hsr Layout - Call 7001305949 Rs-3500 with A/C Room Cash ...
 
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service BangaloreCall Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
 
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hsr Layout Just Call 7001305949 Top Class Call Girl Service Available
 
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdfHemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdf
 
Call Girls Viman Nagar 7001305949 All Area Service COD available Any Time
Call Girls Viman Nagar 7001305949 All Area Service COD available Any TimeCall Girls Viman Nagar 7001305949 All Area Service COD available Any Time
Call Girls Viman Nagar 7001305949 All Area Service COD available Any Time
 
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort Service
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort ServiceCollege Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort Service
College Call Girls Vyasarpadi Whatsapp 7001305949 Independent Escort Service
 
Hematology and Immunology - Leukocytes Functions
Hematology and Immunology - Leukocytes FunctionsHematology and Immunology - Leukocytes Functions
Hematology and Immunology - Leukocytes Functions
 
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...
 
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
 
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment BookingCall Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
 
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service Chennai
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service ChennaiCall Girls Service Chennai Jiya 7001305949 Independent Escort Service Chennai
Call Girls Service Chennai Jiya 7001305949 Independent Escort Service Chennai
 

Sample Preparation for Next Generation Sequencing

  • 1. Sample Preparation for Diagnostics & Life Science A G C T
  • 3. CancerSeq-Characterized Cancer FFPE tissue samples by Next Generation Sequencing (NGS) Sample and Services for Next Generation Sequencing Cancer Gene Panel-NGS Testing Service RapidSeq-Directonal mRNA Sample Prep Kit for NGS RapidSeq-Small RNA Sample Prep Kit for NGS Sample Preparation for Diagnostics & Life Science www.biochain.com 1-888-762-2568 (Main) order@biochain.com (Order)
  • 4. BioChain’s CancerSeq™ genetically characterized FFPE blocks give you and your data more power Blocks and Slides available for: - Breast Cancers - Colon Cancers - Lung Cancers - Melanomas - Other Cancers (via request)* Cancer Gene Panel Includes: The Illumina TruSeq® Amplicon - Cancer Panel (TSACP) to characterize 48 cancer genes, including BRAF, KRAS, EGFR, ALK, and Tp53. Features - Tissue from a wide variety of sources, Whole FFPE blocks, slides, and DNA - Suitable for immunohistochemistry, in situ hybridization assays, and molecular applications ABL1 ERBB4 JAK2 PIK3CA AKT1 FBXW7 JAK3 PTEN ALK FGFR1 KDR PTPN11 APC FGFR2 KIT RB1 ATM FGFR3 KRAS RET BRAF FLT3 MET SMAD4 CDH1 GNA11 MLH1 SMARCB1 CDKN2A GNAQ MPL SMO CSF1R GNAS NOTCH1 SRC CTNNB1 HNF1A NPM1 STK11 EGFR HRAS NRAS TP53 ERBB2 IDH1 PDGFRA VHL CATALOG # PRODUCT NAME SIZE T2235086-SB CancerSeq™ Paraffin Tissue Tumor Block: Breast 1 Block T2235090-SB CancerSeq™ Paraffin Tissue Tumor Block: Colon 1 Block T2235152-SB CancerSeq™ Paraffin Tissue Tumor Block: Lung 1 Block T2235218A-SB CancerSeq™ Paraffin Tissue Tumor Block: Skin Melanoma 1 Block - Make sense out of ambiguous IHC results by knowing the genetics - Buy just the blocks with the right genetic background - Search our databases for blocks with novel mutations - Take advantage of NGS without expensive infrastructure
  • 5. NGS Samples and Services As a provider of tissues and nucleic acids derived from them, BioChain is uniquely positioned to extract DNA and RNA from the most challenging tissues, and perform re-sequencing and RNAseq. Tissues: We have over 300,000 Frozen and FFPE blocks to collect DNA and RNA from. You may also contract with us to procure rare materials for your sequencing project. Extraction: We have provided high quality DNA and RNA from the most challenging tissues including FFPE blocks, cartilage, and brain for over 15 years. Library preparation: We are Experienced with all Illumina library preparation kits as well as our proprietary RapidSeqTM small RNA library prep kit. Illumina MiSeq NGS: With special expertise in RNAseq and resequencing with Trueseq Custom and Cancer Amplicon panels, we handle a wide variety of sequencing projects. Data analysis and consultation: We can help with experimental design through variant calling and anno- tation.
  • 6. Cancer Driver Gene Panel NGS Testing Service One - Step Shop Cancer Sequencing Test Services from Beginning to End NGS Leading Platform - - Greater than 35 kb of cancer consensus targets including BRAF, KRAS & EGFR - 212 amplicons in one tube; 48 genes Unrivaled Multiplexing - Up to 96 sample pooling on MiSeq - >90% specificity and uniformity - Detect low frequency variants (<5%) Unparalleled Workflow - FFPE-enabled with sample QC Kit - Automated paired end sequencing with MiSeq Industry Standard Delivery - Cost-effective solution - Quick turn-around time ABL1 EGFR GNAS MLH1 RET AKT1 ERBB2 HNF1A MPL SMAD4 ALK ERBB4 HRAS NOTCH1 SMARCB1 APC FBXW7 IDH1 NPM1 SMO ATM FGFR1 JAK2 NRAS SRC BRAF FGFR2 JAK3 PDGFRA STK11 CDH1 FGFR3 KDR PIK3CA TP53 CDKN2A FLT3 KIT PTEN VHL CSF1R GNA11 KRAS PTPN11 CTNNB1 GNAQ MET RB1 48 Cancer Biomarker AATTCCGGCCGATCAGGGG TTTACACCAATGGGACCATTAC CCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGG AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACC CAAAGGCC TTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGAATTCCGGCCGATCAGGGGTTTACACCAAT GGTTTACACCAATGGGACCATTACCAAC
  • 7. Directional mRNA Sample Prep Kit Sample Prep System for mRNA Sequencing Features • Low RNA Input Requires as little as 50 ng of total RNA input • Directional Increased useful number of reads • < 1 Hour Hands-on Time Streamlined workflow Library construction in < 7 hours • All-in-One Kit Includes all necessary enzymes and plastics • FFPE RNA Compatible High Quality Libraries without Artifacts or Contaminations Bioanalyzer Trace of Constructed Library of mRNA from corn Description The RapidSeq Directional mRNA Sample Prep kit provides strand-specific cDNA synthesis with reduced costs and increased sensitivity. Directionality Assessment Comparison with TruSeq in Prokaryotic Cells mRNA Input (ng) Sample Type % Sense 100 (Competitor I Kit) FFPEmRNA (1 year) 97.85% 100 (RapidSeq Kit) FFPEmRNA (1 year) 97.88% 500 (Competitor I Kit) FFPEmRNA (10 years) 97.59% 500 (RapidSeq Kit) FFPEmRNA (10 years) 97.57% Parameter TruSeq RapidSeq Coverage Rate 44.00% 65.00% rRNA Contamination with 23s, 16s, and 5s removal 2.70% 1.50% tRNA contamination 64.00% 57.00% Unknown sequence percentage 5.00% <1% Directional Percentage 74% 77.50% Average Quality Score (range from 0 to 40, with 40 being the highest quality) 26 37 CATALOG # PRODUCT NAME KS073012 RapidSeq High Yield Directional mRNA Sample Prep Kit - Without Aligner KS073012 I-IV RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligners 1-48 K2012008 MagSeq mRNA Purification Kit AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGGTGGCCATGGAACCTTGGAC AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCAGACTTCCAGGCCCCAGGTGGCCATGGAACCTTGGACCCATTTAGAACAG
  • 8. Small RNA Sample Prep Kit Everything you need in one box Applications • Small RNA discovery and quantification • miRNA expression profiling • miRNA related functional assessments Description The RapidSeq Small RNA Sample Prep Kit is a cost effective and reliable solution for small RNA library preparation using Illumina’s sequencing platform. Our reagents are master mixed for optimal performance and simple experiment setup, which minimizes human error. RapidSeq can be used for a variety of studies involving small RNA libraries. Construct Pure Libraries with no Artifacts or Contamination Bioanalyzer Trace of FFPE microRNA Library Highly Consistent and Reproducible Results Normalized R2 Plot of miRNA counts from Two Replicate Libraries CATALOG # PRODUCT NAME KS071012-I RapidSeq Small RNA Sample Prep Kit - With Aligner 1-12 KS071012-II RapidSeq Small RNA Sample Prep Kit - With Aligner 13-24 KS071012-III RapidSeq Small RNA Sample Prep Kit - With Aligner 25-36 KS071012-IV RapidSeq Small RNA Sample Prep Kit - With Aligner 37-48 Save time Less than 1 hour hands-on (7 hours with incubations). Avoid purchasing headaches Includes all necessary enzymes and plastics. Don’t worry about RNA quantity Good results with as little as 1 ng or as much as 10 µg of total RNA. Have FFPE RNA? No problem! FFPE RNA compatible
  • 9. NGS Related Products T2235086-SB CancerSeq Parafin Tissue Tumor Block: Breast 1 Block T2235090-SB CancerSeq Parafin Tissue Tumor Block: Colon 1 Block T2235152-SB CancerSeq Parafin Tissue Tumor Block: Lung 1 Block T2235218A-SB CancerSeq Parafin Tissue Tumor Block: Skin Melanoma 1 Block KS073012-I RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 1-12 1 Kit KS073012-II RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 13-24 1 Kit KS073012-III RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 25-36 1 Kit KS073012-IV RapidSeq High Yield Directional mRNA Sample Prep Kit - With Aligner 37-48 1 Kit KS073012 RapidSeq High Yield Directional mRNA Sample Prep Kit - Without Aligner 1 Kit KS073012-T RapidSeq High Yield Directional mRNA Sample Prep Kit, Trial version enough for 2 rxn. Customer select aligners 1 Kit KS074012-I RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 1-12 1 Kit KS074012-II RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 13-24 1 Kit KS074012-III RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 25-36 1 Kit KS074012-IV RapidSeq High Yield Small RNA Sample Prep Kit - With Aligner 37-48 1 Kit KS074012 RapidSeq High Yield Small RNA Sample Prep Kit - Without Aligners 1 Kit KS074012-T RapidSeq High Yield Small RNA Sample Prep Kit, Trial version enough for 2 rxn. Customer select aligners 1 Kit KS075012-I RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 1-12 1 Kit KS075012-II RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 13-24 1 Kit KS075012-III RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 25-36 1 Kit KS075012-IV RapidSeq MasterMix Directional mRNA Sample Prep Kit - With Aligner 37-48 1 Kit KS075012 RapidSeq Mastermix Directional mRNA Sample Prep Kit - Without Aligners 1 kit KS071012-I RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 1-12 1 Kit KS071012-II RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 13-24 1 Kit KS071012-III RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 25-36 1 Kit KS071012-IV RapidSeq MasterMix Small RNA Sample Prep Kit - With Aligner 37-48 1 Kit KS071012 RapidSeq MasterMix Small RNA Sample Prep Kit - Without Aligner 1 Kit CATALOG # DESCRIPTION UNITS
  • 10. Other Related Products D1B34999-G02 Control Genomic DNA - Bovine Female 100 µg D1B34999-G01 Control Genomic DNA - Bovine Male 100 µg D1C34999-G02 Control Genomic DNA - Chicken Female 100 µg D1C34999-G01 Control Genomic DNA - Chicken Male 100 µg D1534999-Cy-G02 Control Genomic DNA - Cynomolgus Monkey Female 100 µg D1534999-Cy-G01 Control Genomic DNA - Cynomolgus Monkey Male 100 µg D1734999-G02 Control Genomic DNA - Dog Female 100 µg D1734999-G01 Control Genomic DNA - Dog Male 100 µg D1G34999-G02 Control Genomic DNA - Guinea Pig Female 100 µg D1G34999-G01 Control Genomic DNA - Guinea Pig Male 100 µg D1H34999-G02 Control Genomic DNA - Hamster Female 100 µg D1H34999-G01 Control Genomic DNA - Hamster Male 100 µg D1234999-G02 Control Genomic DNA - Human Female 100 µg D1234999-G01 Control Genomic DNA - Human Male 100 µg D1334999-G02 Control Genomic DNA - Mouse Female 100 µg D1334999-G01 Control Genomic DNA - Mouse Male 100 µg D1934999-G02 Control Genomic DNA - Porcine Female 100 µg D1934999-G01 Control Genomic DNA - Porcine Male 100 µg D1834999-G02 Control Genomic DNA - Rabbit Female 100 µg D1834999-G01 Control Genomic DNA - Rabbit Male 100 µg D1434999-G02 Control Genomic DNA - Rat Female 100 µg D1434999-G01 Control Genomic DNA - Rat Male 100 µg D1534999-G02 Control Genomic DNA - Rhesus Monkey Female 100 µg D1534999-G01 Control Genomic DNA - Rhesus Monkey Male 100 µg R1234010-50 Total RNA - Human Adult Normal Tissue: Bladder 50 µg R1234035-50 Total RNA - Human Adult Normal Tissue: Brain 50 µg R1234086-50 Total RNA - Human Adult Normal Tissue: Breast 50 µg R1234090-50 Total RNA - Human Adult Normal Tissue: Colon 50 µg R1234090-P Total RNA - Human Adult Normal Tissue 5 Donor Pool: Colon 50 µg R1234122-50 Total RNA - Human Adult Normal Tissue: Heart 50 µg R1234142-50 Total RNA - Human Adult Normal Tissue: Kidney 50 µg R1235010-10 Total RNA - Human Tumor Tissue: Bladder 10 µg R1235023-10 Total RNA - Human Tumor Tissue: Bone 10 µg R1235086-50 Total RNA - Human Tumor Tissue: Breast 50 µg R1235090-50 Total RNA - Human Tumor Tissue: Colon 50 µg R1235142-50 Total RNA - Human Tumor Tissue: Kidney 50 µg R1235149-50 Total RNA - Human Tumor Tissue: Liver 50 µg Control Genomic DNA Total RNA
  • 11.
  • 12. Sample Preparation for Diagnostics & Life Science www.biochain.com 1-888-762-2568 (Main) order@biochain.com (Order)