Ce diaporama a bien été signalé.
Nous utilisons votre profil LinkedIn et vos données d’activité pour vous proposer des publicités personnalisées et pertinentes. Vous pouvez changer vos préférences de publicités à tout moment.
Next Generation Sequencing 
File Formats. 
Pierre Lindenbaum 
You don't need to have a deep knowledge of those formats. 
(Unless you're doing NGS) 
Pierre Lindenbaum@yokofakun pierre.l...
Understand how people have solved their BIG data problems. 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr h...
Why sequencing ? 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegn...
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFh...
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFh...
Well, that's a little more complicated ... 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGlein...
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.i...
FASTQ: text-based format for storing both a DNA sequence and 
its corresponding quality scores 
Pierre Lindenbaum@y...
FASTQ for single end 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanum...
FASTQ for paired end 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanum...
FASTQ Example 
FASTQ name 
@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG 
Col Brief description 
EAS139 the unique instrument nam...
lter (read is bad), N otherwise 
18 0 when none of the control bits are on, otherwise it is an even number 
ATCACG index s...
FASTQ Quality 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscp...
FASTQ Quality 
A quality value Q is an integer mapping of p (i.e., the probability 
that the corresponding base call is in...
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
Prochain SlideShare
Chargement dans…5

File formats for Next Generation Sequencing

18 405 vues

Publié le

Course File formats for Next Generation Analysis . September 2013; Univ-Nantes.

Publié dans : Santé & Médecine, Technologie
  • DOWNLOAD THIS BOOKS INTO AVAILABLE FORMAT (2019 Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { https://soo.gd/irt2 } ......................................................................................................................... Download Full EPUB Ebook here { https://soo.gd/irt2 } ......................................................................................................................... Download Full doc Ebook here { https://soo.gd/irt2 } ......................................................................................................................... Download PDF EBOOK here { https://soo.gd/irt2 } ......................................................................................................................... Download EPUB Ebook here { https://soo.gd/irt2 } ......................................................................................................................... Download doc Ebook here { https://soo.gd/irt2 } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book THIS can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer THIS is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBooks .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story THIS Helped Ignite a Movement,-- Atomic Habits: An Easy &amp; Proven Way to Build Good Habits &amp; Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money THIS the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths THIS Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
    Voulez-vous vraiment ?  Oui  Non
    Votre message apparaîtra ici
  • DOWNLOAD THAT BOOKS INTO AVAILABLE FORMAT (2019 Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { http://shorturl.at/mzUV6 } ......................................................................................................................... Download Full EPUB Ebook here { http://shorturl.at/mzUV6 } ......................................................................................................................... Download Full doc Ebook here { http://shorturl.at/mzUV6 } ......................................................................................................................... Download PDF EBOOK here { http://shorturl.at/mzUV6 } ......................................................................................................................... Download EPUB Ebook here { http://shorturl.at/mzUV6 } ......................................................................................................................... Download doc Ebook here { http://shorturl.at/mzUV6 } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book that can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer that is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBooks .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story That Helped Ignite a Movement,-- Atomic Habits: An Easy &amp; Proven Way to Build Good Habits &amp; Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money That the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths that Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
    Voulez-vous vraiment ?  Oui  Non
    Votre message apparaîtra ici
  • DOWNLOAD THAT BOOKS INTO AVAILABLE FORMAT (2019 Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download Full EPUB Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download Full doc Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download PDF EBOOK here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download EPUB Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download doc Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book that can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer that is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBooks .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story That Helped Ignite a Movement,-- Atomic Habits: An Easy &amp; Proven Way to Build Good Habits &amp; Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money That the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths that Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
    Voulez-vous vraiment ?  Oui  Non
    Votre message apparaîtra ici
  • DOWNLOAD THAT BOOKS INTO AVAILABLE FORMAT (2019 Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download Full EPUB Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download Full doc Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download PDF EBOOK here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download EPUB Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download doc Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book that can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer that is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBooks .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story That Helped Ignite a Movement,-- Atomic Habits: An Easy &amp; Proven Way to Build Good Habits &amp; Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money That the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths that Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
    Voulez-vous vraiment ?  Oui  Non
    Votre message apparaîtra ici
  • DOWNLOAD THAT BOOKS INTO AVAILABLE FORMAT (2019 Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download Full EPUB Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download Full doc Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download PDF EBOOK here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download EPUB Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... Download doc Ebook here { http://bit.ly/2m6jJ5M } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book that can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer that is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBooks .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story That Helped Ignite a Movement,-- Atomic Habits: An Easy &amp; Proven Way to Build Good Habits &amp; Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money That the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths that Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
    Voulez-vous vraiment ?  Oui  Non
    Votre message apparaîtra ici

File formats for Next Generation Sequencing

  1. 1. Next Generation Sequencing File Formats. Pierre Lindenbaum @yokofakun pierre.lindenbaum@univ-nantes.fr http://plindenbaum.blogspot.com https://github.com/lindenb/courses Institut du Thorax. Nantes. France September 19, 2014 Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  2. 2. You don't need to have a deep knowledge of those formats. (Unless you're doing NGS) Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  3. 3. Understand how people have solved their BIG data problems. Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  4. 4. Why sequencing ? Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  5. 5. Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  6. 6. Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  7. 7. Well, that's a little more complicated ... Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  8. 8. FASTQ Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  9. 9. FASTQ FASTQ: text-based format for storing both a DNA sequence and its corresponding quality scores Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  10. 10. FASTQ FASTQ for single end Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  11. 11. FASTQ FASTQ for paired end Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  12. 12. FASTQ Example @IL31_4368:1:1:996:8507/1 NTGATAAAGTAATGACAAAATAATGACATTATTGTTACTATGGTTACTGTGGGA + (94**0-)*7=06>>><<<<<<22@>6;;;5;6:;63:4?-622647..-.5.% @IL31_4368:1:1:996:21421/1 NAAGTTAATTCTTCATTGTCCATTCCTCTGAAATGATTCAGAAATACTGGTAGT + (**+*2396,@<+<:@@@;;5)<0)69606>4;5>;>6&<102)0*+8:&137; @IL31_4368:1:1:997:10572/1 NAATGTATGTAGACCCTTCACATTCAAAGGCAAATACAATATCATCATGTCTTC + (/9**-0032>:>>9>4@@=>??@@:-66,;>;<;6+;255,1;7>>>>3676' @IL31_4368:1:1:997:15684/1 NGCAATCAATGCTATGATTGATCCTGATGGAACTTTGGAGGCTCTGAACAACAT + ()1,*37766>@@@>?@<?@@:>@0>>><-888>8;>*;966>;;;@8@4,.2. @IL31_4368:1:1:997:15249/1 NCGTTATAATGGAATTATTTTTCTTCCTTTATTTAATGTGTTGACAAAGAGAAC Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  13. 13. FASTQ name @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG Col Brief description EAS139 the unique instrument name 136 the run id FC706VJ the owcell id 2 owcell lane 2104 tile number within the owcell lane 15343 'x'-coordinate of the cluster within the tile 197393 'y'-coordinate of the cluster within the tile 1 the member of a pair, 1 or 2 (paired-end or mate-pair reads only) Y Y if the read fails
  14. 14. lter (read is bad), N otherwise 18 0 when none of the control bits are on, otherwise it is an even number ATCACG index sequence Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  15. 15. FASTQ Quality Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  16. 16. FASTQ Quality A quality value Q is an integer mapping of p (i.e., the probability that the corresponding base call is incorrect). Qsanger =
