Ce diaporama a bien été signalé.
Nous utilisons votre profil LinkedIn et vos données d’activité pour vous proposer des publicités personnalisées et pertinentes. Vous pouvez changer vos préférences de publicités à tout moment.

Sinteza proteina

  • Identifiez-vous pour voir les commentaires

  • Soyez le premier à aimer ceci

Sinteza proteina

  1. 1. SINTEZA PROTEINA
  2. 2. SINTEZA PROTEINA <ul><li>GRIFFIT-OV POKUS </li></ul><ul><li>Žive nepatogene bakterije transformira neka tvar iz mrtvih bakterija </li></ul><ul><li>Avery –utvrdio da je ta tvar DNA </li></ul>
  3. 3. SINTEZA PROTEINA <ul><li>Odvija se kroz dva procesa </li></ul><ul><li>transkripcija </li></ul><ul><li>translacija </li></ul><ul><li>rezultira nastankom proteina </li></ul>
  4. 5. Transkripcija – prepisivanje DNA u RNA <ul><li>enzim RNA polimeraza </li></ul><ul><li>sinteza teče uvijek u smjeru 5'-3' </li></ul><ul><li>enzim RNA polimeraza prepisuje gene čija se RNA prenosi u citoplazmu i prevodi na ribosomima pri sintezi proteina – </li></ul><ul><li>nastaje (mRNA) </li></ul>
  5. 6. Translacija <ul><li>mehanizam kojim se transkript mRNA prevodi u točnu proteinsku sekvenciju (njezin protein) </li></ul><ul><li>tRNA + aminokiselina = aminoacil tRNA </li></ul>
  6. 8. značenje kodona
  7. 10. <ul><li>Što je to GENETIČKA UPUTA? </li></ul><ul><li>INTRONI? </li></ul><ul><li>UKOSNICA </li></ul><ul><li>BINONIMI </li></ul><ul><li>Značenje kodona? </li></ul><ul><li>Translacija </li></ul><ul><li>Transkripcija? </li></ul><ul><li>3´ -ATGTTTGGAATTGGAG -5´ </li></ul>
  8. 11. <ul><li>5´- GCCGUACGGACCGAUACCAAUCGGUCUAGA - 3´ </li></ul><ul><li>3´- GGGTACAGACCGACCGACTGTTCTGACTGGTCCA - 5´ </li></ul>

×