SlideShare une entreprise Scribd logo
1  sur  157
Télécharger pour lire hors ligne
VIRUS DE L’HEPATITE C
         L’HEPATITE
          & Marqueurs


        Stéphane Chevaliez
        Stéphane

                    Centre National de Référence
                    Centre National de Référence
                       Des Hépatites B, C et delta
                       Des Hépatites B, C et delta
         Laboratoire de Virologie & INSERM U955
         Laboratoire de Virologie & INSERM U955
                            Hôpital Henri Mondor
                             Hôpital Henri Mondor
                              Université Paris XII
                              Université Paris XII
                                           Créteil
                                            Créteil
Virus de l’Hépatite C
           l’Hépatite
I. Aspects Virologiques
Virus de l’Hépatite C et Marqueurs


Virus de l’Hépatite C
         l’Hépatite

• Famille : Flaviviridae

• Genre : Hepacivirus




                                        Phylogénie de la région codant la protéine NS5B
Adapted from Simmonds et al., 1999; 2001.
Virus de l’Hépatite C et Marqueurs


Virus de l’Hépatite C
         l’Hépatite

• Famille : Flaviviridae

• Genre : Hepacivirus

• Hôte naturel : Homme

• Tropisme : Hépatocyte
Virus de l’Hépatite C et Marqueurs


Organisation Structurale
Virus de l’Hépatite C et Marqueurs


Organisation Génomique
             Génomique




      Protéines structurales                                       Protéines non structurales



Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
Virus de l’Hépatite C et Marqueurs


Fonction des Protéines du VHC
             Protéines
  Protéines VHC                                  Fonction
  Capside                                     Nucléocapside
  F/ARF                                              ?
  E1                                  Enveloppe, domaine de fusion
  E2                                  Enveloppe, liaison au récepteur
  P7/NS1                               Canal ionique Ca-dépendant
  NS2                                      Autoprotéase NS2-3
  NS3                                        Sérine protéase
                                             NTPase/hélicase
  NS4A                                       Cofacteur de NS3
  NS4B                                   Inducteur de la formation
                                          du "membranous web"
  NS5A                                 Indispensable à la réplication,
                                              transactivateur?
  NS5B                               ARN polymérase ARN-dépendante
Virus de l’Hépatite C et Marqueurs


Protéine de Capside
Protéine

– Composant essentiel de la particule virale

    (nucléocapside)

– Formé de deux domaines D1 et D2

– Interaction avec le métabolisme lipidique
     . Inhibition de la MTP et de la sécrétion des VLDL

     . Interaction via le domaine D2 avec les gouttelettes lipidiques


– Rôle dans la pathogenèse
     . Déterminant majeur des lésions hépatiques (stéatose, …)
VHC génotype 1b
Piodi et al., Hepatology 2008, 48(1): 16-27.
y       x
                                                   z




                                                               z   x
                                                           y

Piodi et al., Hepatology 2008, 48(1): 16-27.
Virus de l’Hépatite C et Marqueurs


Protéine NS3
Protéine

– Deux régions
     . Sérine protéase (région N-terminale)

     . NTPase/hélicase (région C-terminale)

– Modulateur de la réponse interféron via les TLR3
Virus de l’Hépatite C et Marqueurs


Inhibition de la Production d’IFN
                            d’IFN
par NS3
Virus de l’Hépatite C et Marqueurs


Protéine NS3
Protéine

– Deux régions
     . Sérine protéase (région N-terminale)

     . NTPase/hélicase (région C-terminale)

– Modulateur de la réponse interféron via les TLR3

– Cibles de molécules antivirales
     . Telaprevir (VX-950, Vertex)

     . Boceprevir (SCH503034, Merck)

     . R7227 (ITMN191, Roche/Intermune)
Site actif
      (His57, Asp81, Ser139)




OPM Database, University of Michigan, College of Pharmacy.
Boceprevir (SCH 503034)




Telaprevir (VX-950)




                         R7227 (ITMN 191)
Virus de l’Hépatite C et Marqueurs

Log HCV RNA reduction from baseline
                                      Activité Antivirale du TVR
                                      Activité

                                          1
                                                                                                          Baseline
                                          0
                                                                                                                     Placebo (n=6)
                                                                                                           -0,21
                                         -1
                                                                                                                     Telaprevir 450mg q8h
                                         -2                                                                -2,21 (n=10)

                                                                                                                 Telaprevir 1250mg
                                         -3                                                                -2,37 q12h (n=10)

                                         -4                                                                -4,41
                                                                                                                     Telaprevir 750mg q8h
                                                                                                                     (n=8)
                                         -5
                                              0   1    2    3     4    5      6   7   8    9   10 11   12 13    14
                                                                           Days on treatment

Reesink et al., Gastroenterology 2006, 131: 997-1002.
Virus de l’Hépatite C et Marqueurs


  Protéine NS5B: RdRp
  Protéine




Lesburg et al., Nat struct Biol 1999, 6: 937-943; Bressanelli et al., Proc Natl Acad Sci USA 1999, 96: 13034-13039; Ago et al., Srructure Fold
Des 1999, 7: 1417-1426.
Virus de l’Hépatite C et Marqueurs


Réplication Virale
Réplication


  – Modèle du poliovirus
     . Virus à ARN monocaténaire
     de polarité positive
                                                             Réplication




De Clercq., Nature Review Drug Discovery, 2007; 6: 1001-18
Virus de l’Hépatite C et Marqueurs


Anti-polymérases
Anti-polymérases

   • Analogues Nucléos(t)idiques
         – R7128 (Pharmasset)
         – IDX184 (Idenix Pharmaceuticals)


   • Analogues non nucléosidiques
         –   Filibuvir (Pfizer)
         –   ANA598 (Anadys Pharmaceuticals)
         –   GS 9190 (Gilead)
         –   ABT-333 (Abbott)
Virus de l’Hépatite C et Marqueurs


Cibles des Molécules Antivirales
           Molécules
                                                                                  Site C (Palm)
    Site A (Thumb/fingertips)                                                      (A-837093)
            (JTK-109)                                                         Mutants: 411, 414, 448
      Mutants: 495, 496, 499



                                            A


                                   B                                      E
                                                              C
                                                         D

   Site B (Thumb)
      HCV-371                                                                     Site E (Finger, hypothetical)
Mutants: 419, 423, 482                                                                       GS-9190
                                                                                      Mutants: 445,448,452

                               Site D (Palm)
                                 (HCV796)                                      Site Actif
                               Mutants: 316                                     (R7128)
                                                                              Mutants: 282
Copyright © 2006 Merck & Co., Inc., Whitehouse Station, New Jersey, USA
Virus de l’Hépatite C et Marqueurs


Activité Antivirale du MK-0608
Activité               MK-0608


                                                           wt S282R/T/I                    wt S282
                                        MK-0608 at 1mg.kg-1 orally
                       7
                       6
 HCV RNA (Log IU/mL)




                       5
                       4
                       3
                       2                                               - 4,6       - 4,1
                                                                                               LOQ
                       1                                                                    (20 IU/mL)
                            TMA + + + +       - - -   -    -     - -     -     +   +
                       0
                       -15 -10 -5   0    5   10 15 20 25 30 35 40 45 50 55 60 65 70
                                                          Days
Virus de l’Hépatite C et Marqueurs


Cycle Viral




Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463
Virus de l’Hépatite C et Marqueurs


Cycle Viral




Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463
Virus de l’Hépatite C et Marqueurs


Modèle d’Entrée Virale
Modèle d’Entrée




Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
Virus de l’Hépatite C et Marqueurs


Cycle Viral




Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
Virus de l’Hépatite C et Marqueurs


Maturation de la Polyprotéine
                 Polyprotéine




Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
Virus de l’Hépatite C et Marqueurs


Structure des Protéines NS
              Protéines




Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
Virus de l’Hépatite C et Marqueurs


Cycle Viral




Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
Virus de l’Hépatite C et Marqueurs


    "Membranous Web"


                               Huh7 naïves




  Huh7 infectées
    (réplicon)


Gosert et al., J Virol 2003, 77(9): 5487-5492.
Virus de l’Hépatite C et Marqueurs


Cycle Viral




Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
Virus de l’Hépatite C
         l’Hépatite
II. Modèles d’Etude
    Modèles d’Etude
Virus de l’Hépatite C et Marqueurs


Modèles Animaux
Modèles




                                     Souris transgéniques
                                     Souris SCID/uPA
Virus de l’Hépatite C et Marqueurs


Modèles Cellulaires
Modèles

   • Pseudoparticules rétrovirales (HCVpp)
   • Réplicons génomiques et subgénomiques
   • Système productif (HCVcc)
Virus de l’Hépatite C et Marqueurs


Modèles Acellulaires
Modèles

   • Modèles enzymatiques
         - Protéase NS3/4A
         - ARN polymérase ARN-dépendante (NS5B)
         - Cyclophyline B
Virus de l’Hépatite C et Marqueurs


   Mesure de l’Activité Enzymatique
             l’Activité
   de RDRp
                                                  Agent intercalant

                                  RdRp
                                                                       PAS DE FLUORESCENCE


                           Matrice ARN simple-brin homopolymérique
                                       simple-     homopolymé




                           Agent intercalant                                 FLUORESCENCE

                                                                      RdRp
                           ARN double-brin
                               double-




                           -     Simple
                           -     Sensible
                           -     Reproductible
A. Ahmed-Belkacen, 2007.
                           -     Miniaturisé en microplaques 96 puits
Virus de l’Hépatite C
            l’Hépatite
III. Variabilité Génétique
     Variabilité Génétique
Virus de l’Hépatite C et Marqueurs


Dynamiques Virales du VIH, VHB et
VHC

                                                                    HIV                             HBV                          HCV

 Daily virion production                                            1010                       1012 - 1013                        1012

 Half-life of free virions (hr)                                        1                           4 (<1)                          2-3

 Half-life of intracellular
                                                                   Days                          Months                         Hours
 virions
 Mutation rate                                                 Very high                            High                    Very high

 Viral reservoir                                        Integrated cDNA                          cccDNA                            No




Soriano et al., J Antimicrob Chemother 2008, 62: 1-4, Murray et al., Hepatology 2006, 44: 1117-1121; Dandri et al., Hepatology 2008, 48(4):1079-86.
Virus de l’Hépatite C et Marqueurs


ARN Polymérase ARN-dépendante
    Polymérase ARN-dépendante

• Erreurs au cours de la réplication
     – Fréquentes
           .   10-4-10-4 mutations par nucléotide copié au cours de la réplication du VHC
     – Spontanées
     – Au hasard

• Absence d’activité exonucléasique 3’⇒5’
                                      ⇒
  ("proofreading")
     – Accumulation de mutations

• A l’origine de :
     – La diversification des types et des sous-types
     – La distribution en quasi-espèces
Virus de l’Hépatite C et Marqueurs


Diversification des Génotypes
                    Génotypes
                                                                           Central
                                                                           Africa
                                                                                7




Simmonds et al. Hepatology 2005; Murphy et al., AASLD, Hepatology, 2007.
Virus de l’Hépatite C et Marqueurs


Répartition Géographique
Répartition Géographique



                                                         1a,




Adapted from Fang J., et al. J. Clin Liver Dis., 1997.
Virus de l’Hépatite C et Marqueurs


Génotypes en France
Génotypes
                     2%

           9,5%

                                                              1a
                                                              1a



  19%                                       60%
                                           60%                 1b
                                                              1b




                                                              11


          9,5%

                                     G1   G2   G3   G4   G5
Virus de l’Hépatite C et Marqueurs


Intérêts de le Détermination des
Intérêts       Détermination
Génotypes
Génotypes

   • Détermination systématique du
     génotype
         – Facteur prédictif de la réponse au
           traitement
         – Conditionne
               . La dose de ribavirine
               . La durée du traitement (24 vs 48-72 semaines)
Virus de l’Hépatite C et Marqueurs


Distribution en Quasi-espèce
                Quasi-espèce




Weiner et al., Virology 1991; 180:842-848; Martell et al., J Virol 1992;66:3225-36.
Virus de l’Hépatite C et Marqueurs

Mécanismes d’Evolution de la
Mécanismes d’Evolution
Quasi-espèce
Quasi-espèce

   • Dérive génétique
         – Accumulation de mutations ponctuelles



   • Glissement génétique
         – Suite à la modification brutale de l’environnement
           réplicatif
Virus de l’Hépatite C et Marqueurs


Distribution en Quasi-espèce
                Quasi-espèce
• Joue un rôle dans le maintien de
  l’infection chronique

• Joue un rôle dans l’échec des
  traitements antiviraux

• Joue un rôle dans la sévérité de la
  maladie

Farci P, 2000; Science, 288: 339-344; Lavillette D, 2005; Journal of Virology, 79(10): 6023-6034; Farci P, 2002; PNAS, 99: 3081-3086;
Chambers TJ et al., 2005; 79: 3071-3083; Sullivan et al., JID 2007, 196: 239-248.
Virus de l’Hépatite C
            l’Hépatite
IV. Exemples d’Application
               d’Application
de la Variabilité Génétique
      Variabilité Génétique
Virus de l’Hépatite C et Marqueurs

Impacts de la Variabilité Génétique
              Variabilité Génétique
du VHC

• Diversification et diffusion du VHC

• Transmission du VHC

• Mécanismes de persistance et d’infection du VHC

• Compartimentation tissulaire du VHC

• Mécanisme d’échec thérapeutique et de
 résistance
Virus de l’Hépatite C et Marqueurs

Impacts de la Variabilité Génétique
              Variabilité Génétique
du VHC

• Diversification et diffusion du VHC

• Transmission du VHC

• Mécanismes de persistance et d’infection du VHC

• Compartimentation tissulaire du VHC

• Mécanisme d’échec thérapeutique et de
 résistance
Virus de l’Hépatite C et Marqueurs


Diversification des Génotypes
                    Génotypes
                                          Central
                                          Africa
                                               7




Murphy et al., AASLD, Hepatology, 2007.
Virus de l’Hépatite C et Marqueurs


Génotype & Mode de Transmission
Génotype

            100%


             80%


             60%                     63%
                                                                                3
                                                            52%                 1b
             40%                                                       54%
                                                                                1a
                                                                                Autres
             20%


               0%
                                    UDVI                 Transfusion   Autres



Pawlotsky et al., J Infect Dis, 1995; 171(6): 1607-10.
Virus de l’Hépatite C et Marqueurs


Génotype & Mode de Transmission
Génotype

           100%


            80%
                                    36%                               4
            60%                                                       3
                                                                      2
                                                  39%                 1b
            40%                                                       1a
                                                                      1nt
            20%                     27%

              0%
                                  UDVI         Transfusion   Autres



Payan et al., J Viral Hepat 2005;12: 405-13.
JK049
                                                HCV-3k                                                           TrKj
Virus de l’Hépatite C et Marqueurs                       HCV-3b                       NE125
                                                         HCV-3f                                       NE048


Génotype 3a
                                                                HCV-3c
                                                                                                                  98
                                                                                              100



                                                                              HCV-3a                   62



Chez les UDVI                                                                                                 98

                                                                                                                 92
                                                                                                                      63




                                                                                                                 99


                                                                                                             81




                                                          Argentine
                                                                                                        60

                                                          Brézil

                                                          Australie

                                                          France

                                                          USA, Côte Est
                                                                                                            56



                                                          USA, Côte Ouest
                                                                                                                      52


                                                                                                              71
                                                                                                                           95

                                                          0.1 substitution per site

                                                                                                                                62


                                                                                                              83


                                                                                                                 75
                                                                                                                  72
                                                                                                             79



Morice et al., J Med Virol 2006;78:1296-1303.
Virus de l’Hépatite C et Marqueurs

Impacts de la Variabilité Génétique
              Variabilité Génétique
du VHC

• Diversification et diffusion du VHC

• Transmission du VHC

• Mécanismes de persistance et d’infection du VHC

• Compartimentation tissulaire du VHC

• Mécanisme d’échec thérapeutique et de
 résistance
Virus de l’Hépatite C et Marqueurs


Transmission Nosocomiale
"Mondorienne"
• Mise en évidence d’une séroconversion VHC lors du
    dépistage et du suivi des patients hémodialysés en
    juillet 2005, à l’hôpital Henri Mondor
• L’ensemble des patients hémodialysés ont été
    testés (anticorps anti-VHC et ARN viral)
     – Mise en évidence d’un 2nd cas au cours de la même période


• Analyses génétique et phylogénique
•    Recherche du VHC dans l’environnement
     – Supports et surfaces inertes
Virus de l’Hépatite C et Marqueurs


Transmission Nosocomiale
"Mondorienne"
     Identification de deux cas de
    séroconversion en 2004 au sein de l’unité
    d’hémodialyse de l’hôpital Henri Mondor :

      – Patient "1" infecté par un génotype 3a


      – Patient "2" infecté par un génotype 1
Virus de l’Hépatite C et Marqueurs                                                Genotype 4
                                                                                                      4a_ED43
                                                                                   Genotype 3       100   3a_NLZ1

Analyse                                                                        Genotype 6
                                                                       Genotype 5
                                                                          Genotype 2 5a_SA13
                                                                                                  6a_EUHK2
                                                                                                            Patient 1


                                                                                                   2a_HCJ6

Phylogénique
Phylogénique                                                                          Patient 2**
                                                                               100 Patient 2*
                                                                                     Patient 3
                                                                                         1k_QC82
                                                                                       1k_QC68
                                                                                    1j_QC89
                                                                                         1j_QC2
                                                                                  1a_HCJ1
                                                                                     1a_HCVH
                                                                                  1a_HCV1
                                                                                       1g_EG024
                                                                                         1g_2152
                                                                                           1g_1382
  Région   NS5B     (329 nt)                                                            1e_QC172
  CLUSTALX                                                                                1e_CAM1078
  DNADist (PHYLIP 3.5)                                                                 1e_M4541N
                                                                                 1l_98CM1457
  Matrice de distance: Kimura 2-parameter (Ts/Tv=2)                              1l_98CM1427
  Neighbor-Joining                                                                1l_M5186N
  Bootstraping : 1000 replicates                                                     1c_Khaja1
  NJPlot                                                                             1c_SR031
                                                                                    1c_HCG9
                                                                                     1b_HCVBK
                                                                                                             G1
                                                                                         1b_HCP01
                                                                                       Patient 4
                                                                                   Patient 5
                                                                           100       Patient 6
                                                                                   Patient 7
                                                                                     1b_HCJ4
                                                                                    Patient 8
                                                                                  1d_FR17
                                                                                     1d_BA107
                                                          Genotype 1                1d_HC1N16
                                                                                    1m_GUI24
                                                                                     1m_GUI11
                                                                                     1m_GUI17
                                                                                   1iQC181
       Séroconversion VHC                                                       1i_QC77
                                                                                     1i_FR16
       Patients VHC chronique                                                      1f_FR2
                                                                              1h_98CM1357
                                                          0.05                     1h_98CM1521
Girou et al., Clin Infect Disease 2008, 47(5): 627-633.                         1h_FrSSD98
Virus de l’Hépatite C et Marqueurs


Analyse Phylogénique
        Phylogénique
                                                                              4a_ED43
                                                                     Patient 7
                                                                           Patient 4
                                                                                            Patient 8
                                                                                     1b_AWV2C33
                                                                                Patient 6
                                                                1a_HCT18X5
  Région   HVR1     (81 nt)                                                       3a_CB
  CLUSTALX                                                                                  2a_Q2B
  DNADist (PHYLIP 3.5)                                                     1a_HCT27X5
  Matrice de distance: Kimura 2-parameter (Ts/Tv=2)
  Neighbor-Joining
                                                                              Patient 3 (01/05)
  Bootstraping : 1000 replicates
  NJPlot


                                                                             Patient 3 (7/04)
                                                                             Patient 2 (9/04)
                                                                             Patient 2 (7/04)
                                                                         100 Patient 3 (9/05)
                                                                             Patient 3 (7/05)

                                                                                                        1b_HVR3812
                                                                                    5a_SA13
                                                                                 Patient 1 (7/04)
                                                                                2b_JFH1
                                                                 6a_33
       Séroconversion VHC                                 0.2
       Patients VHC chronique


Girou et al., Clin Infect Disease 2008, 47(5): 627-633.
Virus de l’Hépatite C et Marqueurs


Analyse Phylogénique
        Phylogénique
                                                                              4a_ED43
                                                                     Patient 7
                                                                           Patient 4
                                                                                            Patient 8
                                                                                     1b_AWV2C33
                                                                                Patient 6
                                                                1a_HCT18X5
  Région   HVR1     (81 nt)                                                      3a_CB
  CLUSTALX                                                                                  2a_Q2B
  DNADist (PHYLIP 3.5)                                                     1a_HCT27X5
  Matrice de distance: Kimura 2-parameter (Ts/Tv=2)                          S1 (6/05)
  Neighbor-Joining
                                                                             Patient 3 (01/05)
  Bootstraping : 1000 replicates
  NJPlot
                                                                             S2 (6/05)
                                                                             S3 (6/05)
                                                                             S4 (6/05)
                                                                             Patient 3 (7/04)
                                                                             Patient 2 (9/04)
                                                                             Patient 2 (7/04)
                                                                         100 Patient 3 (9/05)
                                                                             Patient 3 (7/05)
                                                                             S5 (7/05)
                                                                                                        1b_HVR3812
                                                                                    5a_SA13
                                                                                 Patient 1 (7/04)
                                                                                2b_JFH1
       Surfaces inertes                                          6a_33
       Séroconversion VHC                                 0.2
       Patients VHC chronique


Girou et al., Clin Infect Disease 2008, 47(5): 627-633.
Virus de l’Hépatite C et Marqueurs


Transmission Nosocomiale au
Bénin
Bénin
   • Screening de 64 patients hémodialysés à l’hôpital
     Hubert Kutuku Maga, Cotonou, Bénin (Afrique)
         – Détection anticorps anti-VHC
         – Détection ARN VHC (limite détection <50UI/mL)


   • Etude génétique et phylogénique de deux régions
     distinctes du génome viral
         – NS5B
         – Core-E1
Virus de l’Hépatite C et Marqueurs


Analyse Phylogénique
        Phylogénique                                                        1mGUI24
                                                                           1mGUI11
                                                                          1mGUI17
                                                                        1dBA107
                                                                      1dHC1N16
                                                                          1dFR17
                                                                       99 Patient 26
                                                                                Patient 52
                                                          59                    Patient 60
                                                                           98 Patient 48           Génotype 1, sous-type i
                                                                  96            1iQC181
                                                                              1iQC77
                                                                                   1iFR16
                                                                                 Patient 40
                                                                                        1bHCP01
                                                       34
                                                                    100
                                                                                     1bHCVBK         Génotype 1, sous-type b
                                                                                      1bHCJ4
                                                                                 Patient 7
  Région  NS5B      (286 nt)                                                   Patient 8
                                                                                Patient 17
  CLUSTALX                                                                   Patient 18
  DNADist (PHYLIP 3.5)                                                        Patient 36
  Matrice de distance: Kimura 2-                                   100
                                                                              Patient 16
                                                                              Patient 64
                                                                                                       Génotype 1, sous-type ?
  parameter (Ts/Tv=2)                                                        Patient 28
                                                                           Patient 2
  Neighbor-Joining                                                          Patient 54
                                                         72                Patient 46
  Bootstraping : 1000 replicates                                 Patient 59
  NJPlot                                                                              1fFR2
                                                                                1l98CM1457
                                         43                                      1l98CM1427
                                                                                 1lM5186N
                                                                                               1gEG024
                                                                                                   1g2152
                                                                                                     1g1382
                                                                                                 1eQC172
                                                                                                  1eCAM1078
                                                                                              1eM4541N
                             Génotype 1
                                                                                         1kQC82
                                                                                      1kQC68
                                                                                    1jQC89
                                                                                           1jQC2
                                                                                        1aHCJ1
                                                                                            1aHCVH
                                                                                       1aHCV1
                                                                              1cKhaja1
                                                                              1cSR031
                                                                           1cHCG9
                                                                                         1h98CM1521
                                                                               1h98CM1357
                                                       Génotype 4                1hFrSSD98
                                                                                                               4aED43
                                                                     Génotype 3                                100     Patient 62
              0.05                          Génotype 6                                                                     3aNLZ1 Génotype 3,   sous-type a
                                                                                                            6aEUHK2
                                                         Génotype 2
                                                                                                             2aHCJ6
                                                                                                                      Patient 49  Génotype 2
                                      Génotype 5
                                                                                          5aSA13
Virus de l’Hépatite C et Marqueurs


Transmissions Nosocomiales
                                                                            1bHVR3812
                                                    1bAWV2C33
                                                                   Patient 60
                                                                    Patient 48
                                                                     Patient 52
                                                                                                  Patient 40
                                                                    Patient 26
  Région  HVR1      (81 nt)
  CLUSTALX                                 Patient 59
  DNADist (PHYLIP 3.5)
                                           5aSA13
  Matrice de distance: Kimura 2-
  parameter (Ts/Tv=2)                                      Patient 46
  Neighbor-Joining                                        Patient 54
  NJPlot
                                                              Patient 64
                                                           Patient 28
                                                            Patient 2
                                                              Patient 17
                                                            Patient 18
                                                           Patient 16
                                                          Patient 8
                                                          Patient 7
                                                                1aHCT27X5
                                                                                                               4aED43
                                                                                        6a33
                                                                       1aHCT18X5
                                                                                         2bJFH1
                                     0.2                                                3aCB
                                                                              2aQ2B
Virus de l’Hépatite C et Marqueurs

Assignation Provisoire d’un Nouveau
Sous-type : Etude de la région NS5B
                                            1c_AY051292                          1c_AY051292
                                               1c_D14853                         1c_D14853
                                               1a_M62321                         1a_M62321
                                              1a_M67463                          1a_M67463
                                                     1k_AY434112                 1k_AY434112
                                                    1k_AY434122                  1k_AY434122
                                                1j_AY434128                      1j_AY434128
                                                      1j_AY434158                1j_AY434158
                   1h_AY434131                                                   1g_AF271820
                1i_AY434119                                                      1g_AF271822
                          1b_D90208                                              1e_AY894555
                                1b_M58335                                        1b_D90208
MAXIMUM DE VRAISEMBLANCE      1d_L39299                             PARCIMONIE   1b_M58335
                                  1d_L39302                                      1d_L39299
                                            1g_AF271820                          1d_L39302
                                          1g_AF271822                            1i_AY434119
                                     1e_AY894555                                 1h_AY434131
                                   1f_L38350                                     1f_L38350
                     Patient 46                                                  Patient 46
                     Patient 64                                                  Patient 64
                   Patient 7                                                     Patient 8
                  Patient 8                                                      Patient 7
                  Patient 17                                                     Patient 17
0.05
                 Patient 18                                                      Patient 18
                 Patient 16                                                      Patient 16
Virus de l’Hépatite C et Marqueurs

  Assignation Provisoire d’un Nouveau
  Sous-type : Etude de la région Core-E1
                                                                                  1h_AY257087
                               1a_M62321
                                                                                  1h_AY434132
                                    1a_M67463
                                                                                  1f_L38371
                                                    1j_AY434106
                                                                                  1a_M62321
                                          1j_AY434129
                                                                                  1a_M67463
                                                 1k_AY434113
                                                                                  1j_AY434106
                                                       1k_AY434123
                                                                                  1j_AY434129
                                                 1e_L38361                        1k_AY434113
                                             1e_AY894553
                                                                                  1k_AY434123
                                             1g_AF271798
                                                                                  1e_L38361
                                                 1g_AF271797
                                                                                  1e_AY894553
                                  1c_D14853
                                                                                  1g_AF271798
                                 1c_AY051292
                                                                                  1g_AF271797
                             1l_AY257083
                                                                                  1c_D14853
                       1l_AY257091
                                                                                  1c_AY051292
                   1f_L38371
                                                                                  1l_AY257083
MAXIMUM DE VRAISEMBLANCE               1b_D90208                     PARCIMONIE   1l_AY257091
                                          1b_L38372
                                                                                  1b_M58335
                                         1b_M58335
                                                                                  1b_L38372
                                              1i_L48495
                                                                                  1b_D90208
                                      1i_AY434120
                                                                                  1i_L48495
                                     1d_L38377
                                                                                  1i_AY434120
                                               1h_AY257087
                                                                                  1d_L38377
                                           1h_AY434132
                     Patient 8                                                    Patient 8
                       Patient 17                                                 Patient 7
                         Patient 16                                               Patient 17
                        Patient 18                                                Patient 16
                            Patient 46                                            Patient 18
                          Patient 64                                              Patient 46
0.02                                                                              Patient 64
                    Patient 7
Virus de l’Hépatite C et Marqueurs


Transmission Nosocomiale en Grèce
                            Grèce

 • Epidémie à VHC au sein d’une unité d’hémodialyse en
 Grèce ("Papageorgiou General Hospital", Thessaloniki)
                              Hospital
 • 17 patients hémodialysés contaminés en quelques
 mois



 • Analyses génétique et phylogénique
 • Etude de la réponse neutralisante
          – Système HCVpp


Lavillette et al., J Virol 2005;79:6023-34
Virus de l’Hépatite C et Marqueurs


Analyse Phylogénique
        Phylogénique
                                                        1a             HCV-1
                                                                         HCV-H
                                                        1c           SR052
                                                                       HC-G9
                                                                       SR037

                           HCV-1                                           HC-J4
                                                                          HCV-BK
                                                                         BE90
                                                                             Pt-16
  Région   HVR1     (81 nt)
                                                        1b                 Pt-2
  CLUSTALX                                                                 Pt-4
  DNADist (PHYLIP 3.5)                                                    Pt-3
  Matrice de distance: Kimura 2-
  parameter (Ts/Tv=2)
  Neighbor-Joining
                                                                           Pt-1
                                                                           Pt-17
                                                                                     Souche A
  NJPlot                                                                   Pt-7
                                                                            Pt-6
                                                                            Pt-8
                                                                            Pt-11
                                                                           Pt-10
                                             0,1 substitution per site     Pt-9
                                                                            Pt-5
                                                                            Pt-12
                                                                            Pt-13
                                                                                     Souche B
                                                                            Pt-15


Lavillette et al., J Virol 2005;79:6023-34
Virus de l’Hépatite C et Marqueurs


Réponse Neutralisante - Groupe 1
Réponse

  •       Absence de réponse neutralisante et absence de
         contrôle de l’infection

ARN VHC                                                                                                    % neutralisation
(UI/mL)                                                                                                           infection
          1,E+08                                                                                        100
                                                                                                        200           Huh7
          1,E+07
                                                                                                        90
                                                                                                        180
                                                                                                        80
                                                                                                                                  Patient-10 (souche B)
                                                                                                        70
                                                                                                        160
                                                                                                        60
          1,E+06                                                                                        140
                                                                                                        50
                                                                                                        40
                                                                                                        120
          1,E+05                                                                                        30
                                                                                                        20
                                                                                                        100
          1,E+04                                                                                        10
                                                                                                        80
                                                                                                        0
                                                                                                                              ARN VHC
                                                                                                        -10
                                                                                                        60
          1,E+03
                                                                                                        -20                   Réponse Neutralisante
                                                                                                        40
                                                                                                        -30
          1,E+02                                                                                        -40
                                                                                                        20
                                                                                                        -50
                                                                                                                              Contrôle Neutralisation
          1,E+01                                                                                        -60
                                                                                                        0
                   0   1   2   3   4   5   6   7   8   9   10   11   12   13   14   15   16   17   18                         ALAT
                                               Semaines



Lavillette et al., J Virol 2005;79:6023-34
Virus de l’Hépatite C et Marqueurs


Réponse Neutralisante - Groupe 2
Réponse

  •       Réponse neutralisante forte et spécifique
  •       Réponse neutralisante inversement proportionnelle
         à la cinétique de la charge virale
ARN VHC
(UI/mL)                                                                                                   % neutralisation
                                                                                                                 infection
          1,E+08                                                                                        100
                                                                                                        200          Huh7
                                                                                                        90
                                                                                                        180
                                                                                                                             Patient-1 (souche A)
          1,E+07
                                                                                                        80
                                                                                                        160

          1,E+06                                                                                        70
                                                                                                        140

                                                                                                        60
                                                                                                        120
          1,E+05
                                                                                                        50
                                                                                                        100
          1,E+04
                                                                                                        40
                                                                                                        80
                                                                                                                              ARN VHC
          1,E+03                                                                                        30
                                                                                                        60
                                                                                                                              Réponse Neutralisante
                                                                                                        20
                                                                                                        40
          1,E+02
                                                                                                        10
                                                                                                        20
                                                                                                                              Contrôle Neutralisation
          1,E+01
                   0   1   2   3   4   5   6   7   8   9   10   11   12   13   14   15   16   17   18
                                                                                                        0
                                                                                                                              ALAT
                                               Semaines



Lavillette et al., J Virol 2005;79:6023-34
Virus de l’Hépatite C et Marqueurs

Impacts de la Variabilité Génétique
              Variabilité Génétique
du VHC

• Diversification et diffusion du VHC

• Transmission du VHC

• Mécanismes de persistance et d’infection du VHC

• Compartimentation tissulaire du VHC

• Mécanisme d’échec thérapeutique et de
 résistance
Virus de l’Hépatite C et Marqueurs


              Histoire Naturelle
                                                     Hépatite Aiguë

                                                   Hépatite Chronique
                                                       50 - 80%
                                                         Stéatose
20 - 30 ans




                                                         Fibrose


                                                   Cirrhose 20 - 30%


                  Décompensation                                           HCC
                     6 - 10%                                            4-5% par an


                                                       Mortalité
Virus de l’Hépatite C et Marqueurs


              Histoire Naturelle
                                                     Hépatite Aiguë

                                                   Hépatite Chronique
                                                       50 - 80%
                                                         Stéatose
20 - 30 ans




                                                         Fibrose


                                                   Cirrhose 20 - 30%


                  Décompensation                                           HCC
                     6 - 10%                                            4-5% par an


                                                       Mortalité
Virus de l’Hépatite C et Marqueurs


  Histoire Naturelle
                                         Hépatite Aiguë

                                       Hépatite Chronique
                                           50 - 85%
10 - 30 ans




                                       Cirrhose 20 - 30%


              Décompensation                                     HCC
                 6 - 10%                                    4 - 5% par an


                                           Mortalité
Virus de l’Hépatite C et Marqueurs


Persistance Virale

• Persistance virale
     – Echec de la réponse immune, pourtant
       présente et adaptée, à éliminer le virus ou les
       cellules qui l’abritent


• Interface complexe
Virus de l’Hépatite C et Marqueurs


Processus Multi-étape
                                     Hépatite Aiguë

                                Infection Chronique

                                 Hépatite Chronique
                                     50 - 85%


           1. Mise en place de l’infection aiguë

           2. Etablissement de la persistance virale

           3. Maintient de l’infection au cours du temps
Virus de l’Hépatite C et Marqueurs


Processus Multi-étape
                                     Hépatite Aiguë

                                Infection Chronique

                                 Hépatite Chronique
                                     50 - 85%


           1. Mise en place de l’infection aiguë

           2. Etablissement de la persistance virale ?

           3. Maintient de l’infection au cours du temps
Virus de l’Hépatite C et Marqueurs


Persistance du VHC




Adapted from Ferrari C, Gasroenterology 2007; 132(2): 801-805
Virus de l’Hépatite C et Marqueurs

Impacts de la Variabilité Génétique
              Variabilité Génétique
du VHC

• Diversification et diffusion du VHC

• Transmission du VHC

• Mécanismes de persistance et d’infection du VHC

• Compartimentation tissulaire du VHC

• Mécanisme d’échec thérapeutique et de
 résistance
Virus de l’Hépatite C et Marqueurs


Compartimentation Plasma-PBMC
                  Plasma-PBMC

                             Région 5’NC        Région E1-E2
                                (Pt-3)             (Pt-3)




Roque-Afonso et al., J Virol 2005;79:6349-57)
Virus de l’Hépatite C et Marqueurs

Impacts de la Variabilité Génétique
              Variabilité Génétique
du VHC

• Diversification et diffusion du VHC

• Transmission du VHC

• Mécanismes de persistance et d’infection du VHC

• Compartimentation tissulaire du VHC

• Mécanisme d’échec thérapeutique et de
 résistance
Virus de l’Hépatite C et Marqueurs



Résistance du VHC
Résistance

• Résistance naturelle du VHC à
  l’interféron

• Résistance du VHC à la thérapie par
  l’interféron

• Résistance du VHC aux inhibiteurs
  spécifiques (DAA)
HEPATITE C : Stratégie
             Stratégie
  Diagnostique & Suivi
           Virologique
Virus de l’Hépatite C
             l’Hépatite
I. Cinétique des Marqueurs
   Cinétique
        Virologiques
Stratégie diagnostique & suivi virologique


Marqueurs Virologiques


   Marqueurs indirects
              Anticorps anti-VHC totaux
   Marqueurs directs
               Ag de capside
              ARN VHC
              Génotype VHC
Stratégie diagnostique & suivi virologique


Cinétique des Marqueurs
Cinétique
                                        Infection Aiguë

                    Symptômes +/-

                                                                        Anti-VHC

                         ARN VHC
 Titre




                                                 ALAT



                                        Normal

         0   1       2      3       4        5    6     12   24   36   48
                                 Temps après contage (mois)
Stratégie diagnostique & suivi virologique


Cinétique des Marqueurs
Cinétique
                                        Infection Chronique               Anti-VHC


                    Symptômes +/-



                                  ARN VHC
 Titre




                                                 ALAT




                                                 Normal

         0   1       2      3       4        5     6      12   24   36   48
                                 Temps après contage (mois)
Virus de l’Hépatite C
II. Tests Virologiques
Stratégie diagnostique & suivi virologique


 Tests Virologiques Moléculaires
                    Moléculaires

           Tests qualitatifs                              Tests quantitatifs
              Très sensibles                          Seuil de détection ≥ qualitatifs
                ≤
               (≤ 50 IU/mL)
                                                   Quelle quantité est présente ?
Est-ce que le VHC est présent ?




                                          Détermination
                                          du Génotype


                             Quel type de VHC est présent ?
Stratégie diagnostique & suivi virologique


Tests Virologiques Moléculaires
                   Moléculaires


                          Tests Qualitatifs - Quantitatifs

                Est-ce que le VHC est présent et en quelle quantité ?




                                         Détermination
                                         du Génotype


                            Quel type de VHC est présent ?
Stratégie diagnostique & suivi virologique


Intérêts de la Détection -
Intérêts       Détection
Quantification de l’ARN VHC
                  l’ARN

  • Evaluation de la réplication virale chez des
    patients anticorps anti-VHC positifs

  • Evaluation de la réponse virologique au
    cours du traitement standard
         – Interféron pégylé alpha-2a ou -2b
         – Ribavirine
Stratégie diagnostique & suivi virologique


Cinétiques & Réponses au
Traitement
                                             Peg-IFN-RBV
                        8

                        7
ARN VHC (Log10 UI/mL)




                        6

                        5
                                                                Diminution ≥ 2 Log
                        4

                        3

                        2
                                                                Limite de détection
                        1                                             (10-15 UI/mL)

                        0
                            0    4                 8       12
                                        Semaines
Stratégie diagnostique & suivi virologique


 Cinétiques & Réponses au
 Traitement
                                                 Peg-IFN-RBV
                        8

                        7
ARN VHC (Log10 UI/mL)




                        6

                        5
                                                                            Diminution ≥ 2 Log
                        4

                        3                                                 RV lente
                                    RVR
                        2
                                                               RVP          Limite de détection
                        1                                                         (10-15 UI/mL)

                        0
                            0   2         4              8           12
                                              Semaines
Stratégie diagnostique & suivi virologique


Techniques Disponibles


                    b-DNA                              PCR
              Branched DNA                   Polymerase chain reaction

       Amplification du signal                Amplification de la cible

                Quantitative                        Quantitative
Stratégie diagnostique & suivi virologique


Principe des Techniques


                    b-DNA                              PCR
              Branched DNA                   Polymerase chain reaction

       Amplification du signal                Amplification de la cible

                Quantitative                        Quantitative
Stratégie diagnostique & suivi virologique


bDNA : Forces & Faiblesses
• Forces
     –   Quantification indépendante du génotype
     –   Tolérance de polymorphismes nucléotidiques
     –   Faible volume de prise d’essai
     –   Large intervalle de quantification linéaire
           . ≥ 6,90 Log10 UI/mL


• Faiblesses
     – Faible sensibilité
           . LLOD: 2,80 Log10 UI/mL
     – Faux positifs dans les faibles valeurs
     – Méthode semi-automatisée (Siemens system 440 analyzer)
     – 12 contrôles par run
Stratégie diagnostique & suivi virologique


Principe des Techniques


                    b-DNA                              PCR
              Branched DNA                   Polymerase chain reaction

       Amplification du signal                Amplification de la cible

                Quantitative                        Quantitative
Stratégie diagnostique & suivi virologique

Avantages Techniques de la PCR
en Temps Réel
– Diminution du risque de contamination
– Amélioration de la sensibilité
– Augmentation de l’intervalle de quantification
  linéaire
– Précision et reproductibilité
– Augmentation de débit à travers
  l’automatisation
– Diminution des coûts
Stratégie diagnostique & suivi virologique


   Intervalles de Quantification
                   10          102          103   104   105   106   107   108
Cobas Amplicor
HCV Monitor v2.0


SuperQuant


LCx HCV RNA
Assay

Versant HCV RNA
3.0 (bDNA)
Stratégie diagnostique & suivi virologique


    Intervalles de Quantification
                    10          102          103   104   105   106   107   108
Cobas Amplicor
HCV Monitor v2.0


SuperQuant


LCx HCV RNA
Assay

Versant HCV RNA
3.0 (bDNA)

TaqMan 48 HCV
(Roche)

HCV Quant ASR
(Abbott)

Versant HCV RNA
1.0 (kPCR, Siemens)*

*en développement
Stratégie diagnostique & suivi virologique

Avantages Techniques de la PCR
en Temps Réel
– Diminution du risque de contamination
– Amélioration de la sensibilité
– Augmentation de l’intervalle de quantification
  linéaire
– Précision et reproductibilité
– Augmentation du débit à travers
  l’automatisation
– Diminution des coûts
Stratégie diagnostique & suivi virologique

Avantages Cliniques de la PCR
en Temps Réel

   • Remplace les techniques qualitatives de
     détection de l’ARN VHC

   • Quantifie l’ensemble des charges virales
     observées en pratique clinique
         – Faibles charges virales au cours du traitement

   • Surveille efficacement les cinétiques
     virales (évaluation précoce des réponses
     virologiques au traitement)
Stratégie diagnostique & suivi virologique


Quantification de l’ARN VHC
(CTM, Roche)
                                                              8
                   HCV RNA level in CAP/CTM48 (Log10 IU/mL)


                                                              7


                                                                                                                Genotype 1 (n=29)
                                                              6
                                                                                                                Genotype 2 (n=27)
                                                                                                                Genotype 3 (n=29)
                                                              5
                                                                                                                Genotype 4 (n=30)
                                                                                                                Genotype 5 (n=9)
                                                              4                                                 Genotype 6 (n=2)

                                                                                        r = 0.889; p < 0.0001
                                                              3
                                                                   3     4          5        6       7      8
                                                                  HCV RNA level in Versant HCV 3.0 Assay bDNA
                                                                                  (Log10 UI/mL)
Chevaliez et al., 2007; Hepatology, 46(1): 22-31.
Stratégie diagnostique & suivi virologique


Différences de Quantification
  Difference between HCV RNA levels measured in
       CAP/CTM and in bDNA (in Log10 UI/mL)
                                                         CAP-CTM48 (Roche) versus bDNA 3.0 (Siemens)
                                                  1.5


                                                  1.0


                                                  0.5
                                                                                                  Genotype 1 (n=29)
                                                  0.0                                             Genotype 2 (n=27)
                                                                                                  Genotype 3 (n=29)
                                                  -0.5
                                                                                                  Genotype 4 (n=30)

                                                  -1.0                                            Genotype 5 (n=9)
                                                                                                  Genotype 6 (n=2)
                                                  -1.5

                                                            15%
                                                                       30%
Stratégie diagnostique & suivi virologique

Absence de Détection de l’ARN Viral de
Patients Infectés par un VHC de Génotype 4

                            (Log10IU/mL)                CAP/CTM96   m2000SP/m2000RT   Versant 3.0
                            Patient 1 (4h)                <1.08           5.4               5.0
                            Patient 2 (4l)                <1.08           6.0               5.7




                80        90        100       110       120       130       140      150       160       170       180
                |.........|.........|.........|.........|.........|.........|.........|.........|.........|.........|
F_7157    (4a): TAGCCATGGCGTTAGTATGAGTGTTGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATCGCCGG
Patient 1 (4h): ...........................A.....................................A...................T...............
Patient 2 (4l): ...........................A.....................................A...................T...............



                        190       200        210       220        230       240       250       260        270
                .........|.........|......-...|.........| .........|.........|.........|.........| .........|........
F_7157    (4a): GATGACCGGGTCCTTTCTTGGATTAA-CCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCC
Patient 1 (4h): ......................A.T.A..........................................................................
Patient 2 (4l): .......................C..-.......................................................C.......T..........



               280       290       300       310       320      330       340
                |.........|.........|.........|.........|.........|.........|.
F_7157    (4a): TTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACC
Patient 1 (4h): .............................................................
Patient 2 (4l): .............................................................


Chevaliez et al., 2008; Hepatology, 49(4): 1397-1398.
Stratégie diagnostique & suivi virologique

Quantification de Transcrits d’ARN Sauvages
ou Mutés en Position 145 et/ou 165


                                                   Measured HCV RNA levels (Log10 IU/mL)

             HCV 5’NC sequence                     Real-time PCR assays     bDNA assay

                                                     CTM        m2000       Versant 3.0

             Wild-type (G145 and
                                                   5.73±0.13   6.05±0.10     6.43±0.01
             A165)
             Single mutant (G145A and
                                                   4.02±0.13   6.00±0.11     6.69±0.02
             A165)
             Single mutant (G145 and
                                                   4.28±0.35   5.88±0.20     6.30±0.02
             A165T)
             Double mutant (G145A
                                                    <1.08*     5.95±0.25     6.60±0.18
             and A165T)
             *Target not detected


Chevaliez et al., Hepatology, 2009, 50(5): 1681.
Stratégie diagnostique & suivi virologique


Quantification de l’ARN VHC
(m2000, Abbott)
                   HCV RNA level in m2000SP/m2000RT (Log10 IU/mL)
                                                                    8



                                                                    7


                                                                                                                      Genotype 1 (n=55)
                                                                    6
                                                                                                                      Genotype 2 (n=21)
                                                                                                                      Genotype 3 (n=29)
                                                                    5
                                                                                                                      Genotype 4 (n=24)
                                                                                                                      Genotype 5 (n=9)
                                                                    4                                                 Genotype 6 (n=3)

                                                                                              r = 0.972; p < 0.0001
                                                                    3
                                                                        3      4         5        6       7       8
                                                                        HCV RNA level in Versant HCV 3.0 Assay bDNA
                                                                                        (Log10 UI/mL)
Chevaliez et al., J Clin Microbiol, 2009,47(6):1726-32.
Stratégie diagnostique & suivi virologique


Quantification de l’ARN VHC
(kPCR, Siemens)




                                                                    132 clinical samples




David Sherman., Molecular Symposium, September 2007 (source: Siemens Medical Solutions Diagnostics).
Stratégie diagnostique & suivi virologique


Génotypes du VHC
Génotypes
                                                                           Central
                                                                           Africa
                                                                                7




Simmonds et al. Hepatology 2005; Murphy et al., AASLD, Hepatology, 2007.
Stratégie diagnostique & suivi virologique


Intérêts de la Détermination du
Intérêts       Détermination
Génotype
Génotype
   • Détermination systématique du
     génotype
         – Facteur prédictif de la réponse au
           traitement
         – Conditionne
               . La dose de ribavirine
               . La durée du traitement (24 vs 48 semaines)
Stratégie diagnostique & suivi virologique


Détermination du Génotype
Détermination    Génotype

  • Détermination moléculaire du génotype
    VHC (génotypage)



  • Détermination sérologique du génotype
    VHC (“sérotypage”)
Stratégie diagnostique & suivi virologique


Détermination du Génotype
Détermination    Génotype

  • Détermination moléculaire du génotype
    VHC (génotypage)



  • Détermination sérologique du génotype
    VHC (“sérotypage”)
Stratégie diagnostique & suivi virologique


Régions Virales Ciblées
Régions         Ciblées

   – Complete genome (new subtype
     identification)

   – NS5B coding region (the reference region)

   – Envelope E1 coding region (the second
     reference region)

   – 5’-untranslated region, 5’UTR (the most
     frequently used in practice)
Stratégie diagnostique & suivi virologique


Méthodes Moléculaires de Génotypage
Méthodes Moléculaires    Génotypage

• Séquençage direct des produits d’amplification1

• Hybridation inverse des produits d’amplification sur
  support solide : Line Probe Assay (INNO-LiPA HCV,
  Innogenetics)

• PCR en temps réel à l’aide de primers et/ou sondes
  génotype spécifiques

• Autres méthodes :
        – Restriction fragment length polymorphism analysis (RFLP)
        – Single-strand conformation polymorphism analysis (SSCP)
        – Spectrométrie de masse MALDI-TOF après miniséquençage

Arens et al., J Clin Virol, 2001; 22:11-29; Davidson et al., J Gen Virol 1995; 76: 1197-204; Lareu et al., 1997; Le Pogam et al., 1998; J Clin
Microbiol; 36: 1461-3; Ilina et al., J Clin Miocrobiol, 2005; 43(6): 2810-15.
Stratégie diagnostique & suivi virologique


Analyse Après Séquençage Direct


• The reference method

• Direct sequence analysis of NS5B or,
  eventually , E1 is used for accurate
  genotype and subtype determination

• Direct sequence analysis of the 5’UTR can
  be used in clinical practice.
Stratégie diagnostique & suivi virologique


 TRUGENE® HCV 5’NC Genotyping
 (Siemens)

     • One-step RT-PCR generating a 244-bp fragment

     • PCR products are sequenced in both senses

     • Forward and reverse sequences are aligned
       with prototype reference strain sequences from
       the GeneLibrarian database

     • The HCV genotype is determined by sequence
       homology

Young et al., J Clin Microbil, 1993; 31: 882-86; Roos et al., J Cli Microbiol, 2000; 38(10): 3581-84; Germer et al., J Clin Microbiol, 2003; 41(10): 4855-577
Stratégie diagnostique & suivi virologique


Analyse Après Séquençage Direct

• Pros
     –   Reference method for HCV genotype and subtype
         determination
     –   Can be used, with the appropriate target region, for
                 . Identification of new subtypes
                 . Molecular epidemiology studies
     –   Assays are available for use in clinical practice


• Cons
     –   Mixed genotype infections are not detected
     –   Labor intensive and time-consuming
     –   Costly
Stratégie diagnostique & suivi virologique


Hybridation Inverse

 • Line probe assay

 • Based on reverse hybridization of PCR
   products onto genotype-specific probes

 • Two generations of assays
       –   1st-generation assay: probes in the 5’UTR
       –   2nd-generation assay: probes in the 5’UTR and
           core region
Stratégie diagnostique & suivi virologique


Versant® HCV Genotype 2.0 Assay
       ®

(INNO-LiPA)
(INNO-LiPA)
Stratégie diagnostique & suivi virologique


Hybridation Inverse

• Pros
      –   Easy to use and potential semi-automation (Auto-
          LiPA)
      –   Cheaper
      –   Mixed genotype infections can be detected


• Cons
      –   Should not be used for identification of new
          subtypes or molecular epidemiology studies
          because of possible mis-subtyping
Stratégie diagnostique & suivi virologique


Intérêts de la Détermination du
Intérêts       Détermination
Sous-Type ?
Sous-Type
   • DAA drugs may have different antiviral
     efficacies on different HCV genotype 1
     subtypes in vitro and in vivo

   • DAA drugs administration may be associated
     with different resistance profiles with different
     HCV genotype 1 subtypes in vitro and in vivo
Stratégie diagnostique & suivi virologique


Activité Antivirale Sous-Type
Dépendant


     • BILB 1941, an NNI inhibitor of HCV RNA-
       dependent RNA polymerase, showed better
       antiviral efficacy in HCV subtype 1b than in
       subtype 1a
                      – In vitro, EC50s: 84 nM in subtype 1a vs 153 nM in
                        subtype 1b
                      – In vivo, over 5 days of administration in HCV-infected
                        patients




Erhardt et al., Antivir Ther 2009, 14: 23-32.
Stratégie diagnostique & suivi virologique


 Profil de Résistance Sous-Type
 Dépendant
      • HCV genotype 1 subtype-specific resistance to
        telaprevir
               – In vitro, R155K substitutions are selected only in genotype
                 1a replicons
               – In vivo, amino acid substitutions at positions 36 and 155 are
                 selected only in patients infected with subtype 1a

      • HCV genotype 1 subtype-specific fitness of
        variants resistant to HCV-796
               – In patients infected with subtype 1b, the C316Y substitution
                 is found alone in fit resistant variants
               – In patients infected with subtype 1a, the C316Y substitution
                 requires additional substitutions to gain full fitness

Kieffer et al., hepatology 2007, 46: 631-639; Sarrazin et al., Gastroenterology 2007, 132: 1767-1777;; Delano et al., 1st International Workshop on
HepC Resistance and New Compounds 2006; McCown et al., Antimicrob Agents Chemother 2009.
Stratégie diagnostique & suivi virologique

  Importance de la Région Virale
                   Région
  pour la Détermination du Sous-type
          Détermination    Sous-type

                                                  1st Generation of   2nd Generation of
                Sequence Analysis                                                         RealTime HCV
                                                  Line Probe Assay    Line Probe Assay
                   of the 5’NCR                                                            Genotype II
                                                      (LiPA 1.0)          (LiPA 2.0)



 GT 1a                     77.6%                       70.5%               97.5%             93.2%
(n=237)                   (n=184)                     (n=167)             (n=231)           (n=220)

 GT 1b                     90.5%                       91.3%               96.2%             88.6%
(n=263)                   (n=238)                     (n=240)             (n=253)           (n=233)




  Chevaliez et al., PLoS One 2009, 4(12): e820.
Stratégie diagnostique & suivi virologique


Intérêts des "Nouveaux" Tests
Intérêts
Sérologiques ?
Sérologiques

   • Détection - quantification de l’antigène de
     capside (AgC)



   • Test de détection des antigènes et des
     anticorps (combo)
Stratégie diagnostique & suivi virologique


Antigène de Capside : Marqueur
Indirect de la Réplication Virale




                                                         r = 0.92; p < 0.0001




Bouvier-Alias et al., Hepatology 2002, 36(1): 211-218.
Stratégie diagnostique & suivi virologique


Intérêts de la Détection-
Quantification de l’Ag de Capside
• Diagnostic de l’infection virale C
      – Marqueur sérologique précoce
              . Réduction de la fenêtre sérologique à environ 20 jours
              . Génotype-indépendant
      – Facile à mettre en œuvre, rapide, bon marché (ELISA
        automatisée)
      – Trousse commerciale

• Décision de traiter et Monitoring de l’efficacité du
  traitement
      – Marqueur indirect de la réplication virale
              . 1 pg d’Ag C ≈ 8 000 UI/mL ARN
      – Alternative aux méthodes moléculaires de quantification de l’ARN
      – Seuil de quantification équivalent à 20 000 UI/mL d’ARN

Bouvier-Alias et al., Hepatology 2002, 36(1): 211-218; Mehdi et al., Clin Biochem. 2008, 41(18):1493.
Stratégie diagnostique & suivi virologique


Détection Simultanée Ag/Ac
(Test Combo)
  • Diagnostic de l’infection virale C
           – Réduction de la fenêtre sérologique (~20 jours)
                   . ~60 jours avec les dernières générations de trousses anticorps
                   . ~40 jours ave les trousses Combo
           – Alternative aux méthodes de DGV
           – Facile à mettre en œuvre, rapide (ELISA automatisé)
           – Trousses commerciales

           – Pas aussi sensible que les méthodes qualitative de détection
             de l’ARN et de détection de l’Ag de capside




Laperche et al. J Clin Micribiol 2005, 43(8): 3877-3883; Alzahrani AJ., J Med Virol 2008, 80(4): 603-6.
Virus de l’Hépatite C
III. Diagnostic Virologique
Stratégie diagnostique & suivi virologique


Diagnostic de l’Infection Aiguë
              l’Infection Aiguë

       Ac anti-VHC             ARN VHC*                         Diagnostic


                -                     -              Absence d’infection aiguë


                -                     +                      Infection aiguë C


               +                      -           Probablement pas d’infection
                                                             aiguë

               +                      +                     Difficile de conclure


    * Technique sensible seuil de détection ≤ 10-15 UI/mL
Stratégie diagnostique & suivi virologique


 Diagnostic de l’Infection Aiguë
               l’Infection Aiguë

   • Facteurs supplémentaires à prendre en
     compte chez des populations à risque

           – Niveaux de charges virales

           – Variation de la charge virale 4 et 10 semaines
             après la suspicion de l’hépatite aiguë

           – Activité sérique des transaminases



McGovern et al., CID 2009, 49: 1051-1060.
Stratégie diagnostique & suivi virologique


  Algorithme pour le Diagnostic de
  l’Hépatite Aiguë*
                                             Suspicion d’hépatite aiguë


                                   ARN VHC              Fluctuations ARN      Fluctuations ARN
Séroconversion
                                 < 5Log10 UI/mL          >1 Log10 UI/mL        <1 Log10 UI/mL
                                                                                     ou
                                                                                  ARN VHC
                                                                               > 5 Log10 UI/mL


                                                                           ALAT> 7xLSN   ALAT> 7xLSN



                                                 Probabilité               Probabilité   Probabilité
Hépatite aiguë
                                                   élevée                   modérée        faible
  *population à risque (IDVU)
 McGovern et al., CID 2009, 49: 1051-1060.
Stratégie diagnostique & suivi virologique


Diagnostic de l’Infection Chronique
              l’Infection

– Détection des anticorps anti-VHC totaux par
  ELISA

– Recherche d’ARN du VHC par un test
  sensible*

– Détection d’ARN du VHC* si le test ELISA
  est négatif chez des patients hémodialysés
  ou immunodéprimés

 * Technique sensible seuil de détection ≤ 10-15 UI/mL
Virus de l’Hépatite C
III. Prise en Charge Thérapeutique
Stratégie diagnostique & suivi virologique


Intérêts des Tests Virologiques en
Intérêts
Thérapeutique
Thérapeutique
  – Décision de traiter


  – Optimisation du schéma
    thérapeutique


  – Etude de la réponse virologique au
    traitement

Consensus conference: treatment of hepatitis C; 2002, Gastroenterol Clin Biol, 26(2): B303-20.
Stratégie diagnostique & suivi virologique


Classification des Patients


                                           Génotypes VHC


               Type                                          Types                              Types
                1                                             2, 3                              4, 5, 6




Consensus conference: treatment of hepatitis C; 2002, Gastroenterol Clin Biol, 26(2): B303-20
Stratégie diagnostique & suivi virologique


Indications Actuelles du Traitement

• Patients infectés par un VHC de génotype 1
        – Interferon pégylé plus ribavirine (1000 - 1400 mg/j)
        – Durée : 48 semaines


• Patients infectés par un VHC de génotype 2/3
        – Interferon pégylé plus ribavirine (800 mg/j)
        – Durée : 24 semaines


• Patients infectés par une VHC de génotype 4, 5 et 6
        – Interferon pégylé plus ribavirine (1000 - 1400 mg/j)
        – Durée : 48 semaines



Consensus conference: treatment of hepatitis C; 2002, Gastroenterol Clin Biol, 26(2): B303-20
Génotype VHC
                           VHC-1 (4,5,6)                                 VHC-2,3
                         Quantification ARN

                             Bithérapie                                 Bithérapie
                           48 semaines                                 24 semaines
                     Ribavirine 1000-1400 mg                         Ribavirine 800 mg

                     Quantification ARN à S12


Diminution < 2 Log     Diminution ≥ 2 Log       diminution ≥ 2 Log
                          ARN VHC +                ARN VHC -


 Arrêt traitement
  poursuite avec        Poursuite jusqu’à
 IFN pégylé pour              S24
    ralentir la
progression de la        Si ARN VHC -
     maladie            Poursuite jusqu’à       Poursuite jusqu’à
    hépatique                 S48                     S48
Stratégie diagnostique & suivi virologique

Optimisation du Traitement en
Fonction de la Réponse Virologique
               Réponse

• Outils virologiques sensibles
      – Sensibilité : 10-15 UI/mL
      – Evaluation de la réponse au traitement



• Répondeurs virologiques rapides
      – Raccourcissement de la durée de traitement


• Répondeurs virologiques précoces partiels
      – Allongement de la durée de traitement
Raccourcissement de la
 Durée de Traitement
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs
Chevaliez Hcv  Virus Et Marqueurs

Contenu connexe

Tendances

Genetique et heredite correction travail en classe + allèles... suite
Genetique et heredite correction travail en classe + allèles... suiteGenetique et heredite correction travail en classe + allèles... suite
Genetique et heredite correction travail en classe + allèles... suite
sciencesalannoy
 
Réaction antigène-anticorps appliquée en techniques immunologiques
Réaction antigène-anticorps appliquée en techniques immunologiquesRéaction antigène-anticorps appliquée en techniques immunologiques
Réaction antigène-anticorps appliquée en techniques immunologiques
Asmae LGUENSAT
 

Tendances (20)

DIAGNOSTIC VIROLOGIQUE D'UNE INFECTION
DIAGNOSTIC VIROLOGIQUE D'UNE INFECTIONDIAGNOSTIC VIROLOGIQUE D'UNE INFECTION
DIAGNOSTIC VIROLOGIQUE D'UNE INFECTION
 
Cours 3 les cellules phagocytaires
Cours 3 les cellules phagocytairesCours 3 les cellules phagocytaires
Cours 3 les cellules phagocytaires
 
Les tests-de-coagulation
Les tests-de-coagulationLes tests-de-coagulation
Les tests-de-coagulation
 
Sérodiagnostic de la toxoplasmose
Sérodiagnostic de la toxoplasmoseSérodiagnostic de la toxoplasmose
Sérodiagnostic de la toxoplasmose
 
Sérodiagnostic de la polyarthrite rhumatoide
Sérodiagnostic de la polyarthrite  rhumatoide Sérodiagnostic de la polyarthrite  rhumatoide
Sérodiagnostic de la polyarthrite rhumatoide
 
Sérodiagnostic de la syphilis
Sérodiagnostic de la syphilisSérodiagnostic de la syphilis
Sérodiagnostic de la syphilis
 
Les méthodes de diagnostic biologique du paludisme
Les méthodes de diagnostic biologique du paludismeLes méthodes de diagnostic biologique du paludisme
Les méthodes de diagnostic biologique du paludisme
 
laboratoire equipements for your powerpoint.ppt
laboratoire equipements for your powerpoint.ppt laboratoire equipements for your powerpoint.ppt
laboratoire equipements for your powerpoint.ppt
 
Toxoplasmose
ToxoplasmoseToxoplasmose
Toxoplasmose
 
Techniques de concentration en parasitologie
Techniques de concentration en parasitologieTechniques de concentration en parasitologie
Techniques de concentration en parasitologie
 
Biologie moleculaire en parasitologie et mycologie
Biologie moleculaire en parasitologie et mycologieBiologie moleculaire en parasitologie et mycologie
Biologie moleculaire en parasitologie et mycologie
 
Genetique et heredite correction travail en classe + allèles... suite
Genetique et heredite correction travail en classe + allèles... suiteGenetique et heredite correction travail en classe + allèles... suite
Genetique et heredite correction travail en classe + allèles... suite
 
Cours Hypersensibilité de Type III harmacie 2017
Cours Hypersensibilité de Type III harmacie 2017Cours Hypersensibilité de Type III harmacie 2017
Cours Hypersensibilité de Type III harmacie 2017
 
Les réactions de neutralisation
Les réactions de neutralisationLes réactions de neutralisation
Les réactions de neutralisation
 
Les Réactions Antigènes- Anticorps
Les Réactions  Antigènes- AnticorpsLes Réactions  Antigènes- Anticorps
Les Réactions Antigènes- Anticorps
 
Sérologie de la rubéole
Sérologie de la rubéole Sérologie de la rubéole
Sérologie de la rubéole
 
Les hemopathies
Les hemopathiesLes hemopathies
Les hemopathies
 
Réponses immunes de l'hôte contre les ligands parasitaires dans le paludisme ...
Réponses immunes de l'hôte contre les ligands parasitaires dans le paludisme ...Réponses immunes de l'hôte contre les ligands parasitaires dans le paludisme ...
Réponses immunes de l'hôte contre les ligands parasitaires dans le paludisme ...
 
Réaction antigène-anticorps appliquée en techniques immunologiques
Réaction antigène-anticorps appliquée en techniques immunologiquesRéaction antigène-anticorps appliquée en techniques immunologiques
Réaction antigène-anticorps appliquée en techniques immunologiques
 
Transfusion
TransfusionTransfusion
Transfusion
 

En vedette

Pawlotsky cycle
Pawlotsky  cyclePawlotsky  cycle
Pawlotsky cycle
odeckmyn
 
Hépatite c agen nador-- 30 juin 2012
Hépatite c  agen nador--  30 juin 2012Hépatite c  agen nador--  30 juin 2012
Hépatite c agen nador-- 30 juin 2012
Fatimazohra Elamrani
 
Hépatite C_ stratégie diagnostique et suivi virologique.ppt
Hépatite C_ stratégie diagnostique et suivi virologique.pptHépatite C_ stratégie diagnostique et suivi virologique.ppt
Hépatite C_ stratégie diagnostique et suivi virologique.ppt
odeckmyn
 
Unidad i financiera
Unidad i financieraUnidad i financiera
Unidad i financiera
Prof. Prof.
 
Samsung - Câmera Digital - PL120 - 14.2 Megapixels - Duplo LCD - LCD Frontal ...
Samsung - Câmera Digital - PL120 - 14.2 Megapixels - Duplo LCD - LCD Frontal ...Samsung - Câmera Digital - PL120 - 14.2 Megapixels - Duplo LCD - LCD Frontal ...
Samsung - Câmera Digital - PL120 - 14.2 Megapixels - Duplo LCD - LCD Frontal ...
moriainformatica
 
Rapport de l'UEFA sur les finances des clubs de football européens
Rapport de l'UEFA sur les finances des clubs de football européensRapport de l'UEFA sur les finances des clubs de football européens
Rapport de l'UEFA sur les finances des clubs de football européens
jeremylepaulbinet
 

En vedette (20)

Pawlotsky cycle
Pawlotsky  cyclePawlotsky  cycle
Pawlotsky cycle
 
Hépatite c agen nador-- 30 juin 2012
Hépatite c  agen nador--  30 juin 2012Hépatite c  agen nador--  30 juin 2012
Hépatite c agen nador-- 30 juin 2012
 
Hépatite C_ stratégie diagnostique et suivi virologique.ppt
Hépatite C_ stratégie diagnostique et suivi virologique.pptHépatite C_ stratégie diagnostique et suivi virologique.ppt
Hépatite C_ stratégie diagnostique et suivi virologique.ppt
 
interferon
interferoninterferon
interferon
 
GOVERNANCA ESSENCIAL 1
GOVERNANCA ESSENCIAL 1GOVERNANCA ESSENCIAL 1
GOVERNANCA ESSENCIAL 1
 
Produkte und services für das corporate treasury
Produkte und services für das corporate treasuryProdukte und services für das corporate treasury
Produkte und services für das corporate treasury
 
Enhancing livelihoods of poor livestock keepers through increasing use of fod...
Enhancing livelihoods of poor livestock keepers through increasing use of fod...Enhancing livelihoods of poor livestock keepers through increasing use of fod...
Enhancing livelihoods of poor livestock keepers through increasing use of fod...
 
Tudo começou no clube das insónias
Tudo começou no clube das insóniasTudo começou no clube das insónias
Tudo começou no clube das insónias
 
[Estácio] Trabalho de Comunicação Institucional
[Estácio] Trabalho de Comunicação Institucional[Estácio] Trabalho de Comunicação Institucional
[Estácio] Trabalho de Comunicação Institucional
 
Automatizando Nmap com NSE
Automatizando Nmap com NSEAutomatizando Nmap com NSE
Automatizando Nmap com NSE
 
josue
josuejosue
josue
 
Unidad i financiera
Unidad i financieraUnidad i financiera
Unidad i financiera
 
Tracking.js: um framework open source de visão computacional
Tracking.js: um framework open source de visão computacional Tracking.js: um framework open source de visão computacional
Tracking.js: um framework open source de visão computacional
 
Rebuilding together
Rebuilding togetherRebuilding together
Rebuilding together
 
Breve contenido de la nias.
Breve contenido de la nias.Breve contenido de la nias.
Breve contenido de la nias.
 
Samsung - Câmera Digital - PL120 - 14.2 Megapixels - Duplo LCD - LCD Frontal ...
Samsung - Câmera Digital - PL120 - 14.2 Megapixels - Duplo LCD - LCD Frontal ...Samsung - Câmera Digital - PL120 - 14.2 Megapixels - Duplo LCD - LCD Frontal ...
Samsung - Câmera Digital - PL120 - 14.2 Megapixels - Duplo LCD - LCD Frontal ...
 
Rapport de l'UEFA sur les finances des clubs de football européens
Rapport de l'UEFA sur les finances des clubs de football européensRapport de l'UEFA sur les finances des clubs de football européens
Rapport de l'UEFA sur les finances des clubs de football européens
 
Analisando pacotes for fun and packet - Conceito de Network Security Monitori...
Analisando pacotes for fun and packet - Conceito de Network Security Monitori...Analisando pacotes for fun and packet - Conceito de Network Security Monitori...
Analisando pacotes for fun and packet - Conceito de Network Security Monitori...
 
Ruidos
RuidosRuidos
Ruidos
 
Sesion informativa actualizacion sgcc14 control de calidad
Sesion informativa actualizacion sgcc14 control de calidadSesion informativa actualizacion sgcc14 control de calidad
Sesion informativa actualizacion sgcc14 control de calidad
 

Similaire à Chevaliez Hcv Virus Et Marqueurs

Chevalier du 2012.ppt
Chevalier  du 2012.pptChevalier  du 2012.ppt
Chevalier du 2012.ppt
odeckmyn
 
Zarski Du 2009
Zarski Du 2009Zarski Du 2009
Zarski Du 2009
odeckmyn
 
Lerat Du Hepatites Virales
Lerat Du Hepatites ViralesLerat Du Hepatites Virales
Lerat Du Hepatites Virales
odeckmyn
 
Lerat PathogéNèSe
Lerat PathogéNèSeLerat PathogéNèSe
Lerat PathogéNèSe
odeckmyn
 
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
odeckmyn
 
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
odeckmyn
 
Anti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.pptAnti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.ppt
odeckmyn
 
Zarski jp cyto,av,im 2014
Zarski jp  cyto,av,im 2014Zarski jp  cyto,av,im 2014
Zarski jp cyto,av,im 2014
odeckmyn
 
Hépatite C Virus et marqueurs.pdf
Hépatite C  Virus et marqueurs.pdfHépatite C  Virus et marqueurs.pdf
Hépatite C Virus et marqueurs.pdf
odeckmyn
 
Chevaliez s virus hcv+marqueurs2014
Chevaliez s  virus hcv+marqueurs2014Chevaliez s  virus hcv+marqueurs2014
Chevaliez s virus hcv+marqueurs2014
odeckmyn
 
Lerat du2012
Lerat du2012Lerat du2012
Lerat du2012
odeckmyn
 
Zarski cytokines 2013
Zarski   cytokines 2013Zarski   cytokines 2013
Zarski cytokines 2013
odeckmyn
 
Traitement Hépatite chronique virale C Pr Arbaoui fac med Tlemcen avril 2012
Traitement  Hépatite chronique virale C  Pr Arbaoui fac med Tlemcen avril 2012Traitement  Hépatite chronique virale C  Pr Arbaoui fac med Tlemcen avril 2012
Traitement Hépatite chronique virale C Pr Arbaoui fac med Tlemcen avril 2012
Arbaoui Bouzid
 
Virus de l'hépatite a et e virus et marqueurs diagnostiques
Virus de l'hépatite a et e  virus et marqueurs diagnostiquesVirus de l'hépatite a et e  virus et marqueurs diagnostiques
Virus de l'hépatite a et e virus et marqueurs diagnostiques
odeckmyn
 
Thibault Virus A Et E
Thibault Virus A Et EThibault Virus A Et E
Thibault Virus A Et E
odeckmyn
 

Similaire à Chevaliez Hcv Virus Et Marqueurs (20)

Chevalier du 2012.ppt
Chevalier  du 2012.pptChevalier  du 2012.ppt
Chevalier du 2012.ppt
 
Zarski Du 2009
Zarski Du 2009Zarski Du 2009
Zarski Du 2009
 
Zarski diu hépatites virales janvier 2015 jpz
Zarski  diu hépatites virales janvier 2015 jpzZarski  diu hépatites virales janvier 2015 jpz
Zarski diu hépatites virales janvier 2015 jpz
 
Lerat Du Hepatites Virales
Lerat Du Hepatites ViralesLerat Du Hepatites Virales
Lerat Du Hepatites Virales
 
Lerat PathogéNèSe
Lerat PathogéNèSeLerat PathogéNèSe
Lerat PathogéNèSe
 
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
 
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
 
Anti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.pptAnti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.ppt
 
Zarski jp cyto,av,im 2014
Zarski jp  cyto,av,im 2014Zarski jp  cyto,av,im 2014
Zarski jp cyto,av,im 2014
 
Hépatite C Virus et marqueurs.pdf
Hépatite C  Virus et marqueurs.pdfHépatite C  Virus et marqueurs.pdf
Hépatite C Virus et marqueurs.pdf
 
Outils moléculaires disponibles pour surveiller la résistance aux antipaludiques
Outils moléculaires disponibles pour surveiller la résistance aux antipaludiquesOutils moléculaires disponibles pour surveiller la résistance aux antipaludiques
Outils moléculaires disponibles pour surveiller la résistance aux antipaludiques
 
Zarski hépatites virales du16 jpz
Zarski hépatites virales du16 jpzZarski hépatites virales du16 jpz
Zarski hépatites virales du16 jpz
 
Chevaliez s virus hcv+marqueurs2014
Chevaliez s  virus hcv+marqueurs2014Chevaliez s  virus hcv+marqueurs2014
Chevaliez s virus hcv+marqueurs2014
 
Lerat du2012
Lerat du2012Lerat du2012
Lerat du2012
 
Zarski cytokines 2013
Zarski   cytokines 2013Zarski   cytokines 2013
Zarski cytokines 2013
 
Lerat du hépatites virales 2015
Lerat  du hépatites virales 2015Lerat  du hépatites virales 2015
Lerat du hépatites virales 2015
 
Lerat bis hép virologie du16
Lerat bis hép virologie du16  Lerat bis hép virologie du16
Lerat bis hép virologie du16
 
Traitement Hépatite chronique virale C Pr Arbaoui fac med Tlemcen avril 2012
Traitement  Hépatite chronique virale C  Pr Arbaoui fac med Tlemcen avril 2012Traitement  Hépatite chronique virale C  Pr Arbaoui fac med Tlemcen avril 2012
Traitement Hépatite chronique virale C Pr Arbaoui fac med Tlemcen avril 2012
 
Virus de l'hépatite a et e virus et marqueurs diagnostiques
Virus de l'hépatite a et e  virus et marqueurs diagnostiquesVirus de l'hépatite a et e  virus et marqueurs diagnostiques
Virus de l'hépatite a et e virus et marqueurs diagnostiques
 
Thibault Virus A Et E
Thibault Virus A Et EThibault Virus A Et E
Thibault Virus A Et E
 

Plus de odeckmyn

Plus de odeckmyn (20)

VHC,VHB : femme enceinte et transmission mère-enfant
VHC,VHB : femme enceinte et transmission mère-enfantVHC,VHB : femme enceinte et transmission mère-enfant
VHC,VHB : femme enceinte et transmission mère-enfant
 
Sujets examen DU - 2015
Sujets examen DU - 2015Sujets examen DU - 2015
Sujets examen DU - 2015
 
Examen DU - 2014
Examen DU - 2014 Examen DU - 2014
Examen DU - 2014
 
Thabut beneferadic16
Thabut beneferadic16Thabut beneferadic16
Thabut beneferadic16
 
Thabut vhc2016duhv
Thabut vhc2016duhvThabut vhc2016duhv
Thabut vhc2016duhv
 
Du 2016 programme v2 a4
Du 2016 programme v2 a4Du 2016 programme v2 a4
Du 2016 programme v2 a4
 
Histoire hcv du 2016
Histoire hcv du 2016Histoire hcv du 2016
Histoire hcv du 2016
 
Du 2016 tp biomarkers
Du 2016 tp biomarkersDu 2016 tp biomarkers
Du 2016 tp biomarkers
 
Zoulim fz traitement vhb du16
Zoulim fz traitement vhb du16 Zoulim fz traitement vhb du16
Zoulim fz traitement vhb du16
 
Thabut1 vhc tt du16
Thabut1 vhc tt du16Thabut1 vhc tt du16
Thabut1 vhc tt du16
 
Zoulim2 traitement hépatite b 2016 d uv2
Zoulim2  traitement hépatite b 2016 d uv2Zoulim2  traitement hépatite b 2016 d uv2
Zoulim2 traitement hépatite b 2016 d uv2
 
Zoulim vhb du16
Zoulim vhb du16Zoulim vhb du16
Zoulim vhb du16
 
Thabut2 vhc vhb du16
Thabut2 vhc  vhb du16Thabut2 vhc  vhb du16
Thabut2 vhc vhb du16
 
Sos hepatites du16
Sos hepatites du16Sos hepatites du16
Sos hepatites du16
 
Thibault vha vhe- du16
Thibault vha vhe- du16Thibault vha vhe- du16
Thibault vha vhe- du16
 
Rosmorduc carninogenese du16
Rosmorduc  carninogenese du16Rosmorduc  carninogenese du16
Rosmorduc carninogenese du16
 
Roulo tbis vhd-du16
Roulo tbis vhd-du16Roulo tbis vhd-du16
Roulo tbis vhd-du16
 
Samuel2 hcv lt du16
Samuel2 hcv  lt du16Samuel2 hcv  lt du16
Samuel2 hcv lt du16
 
Samuel1 hbv lt du16
Samuel1 hbv lt du16Samuel1 hbv lt du16
Samuel1 hbv lt du16
 
Rudler hépatites ir du16
Rudler hépatites ir du16Rudler hépatites ir du16
Rudler hépatites ir du16
 

Chevaliez Hcv Virus Et Marqueurs

  • 1. VIRUS DE L’HEPATITE C L’HEPATITE & Marqueurs Stéphane Chevaliez Stéphane Centre National de Référence Centre National de Référence Des Hépatites B, C et delta Des Hépatites B, C et delta Laboratoire de Virologie & INSERM U955 Laboratoire de Virologie & INSERM U955 Hôpital Henri Mondor Hôpital Henri Mondor Université Paris XII Université Paris XII Créteil Créteil
  • 2. Virus de l’Hépatite C l’Hépatite I. Aspects Virologiques
  • 3. Virus de l’Hépatite C et Marqueurs Virus de l’Hépatite C l’Hépatite • Famille : Flaviviridae • Genre : Hepacivirus Phylogénie de la région codant la protéine NS5B Adapted from Simmonds et al., 1999; 2001.
  • 4. Virus de l’Hépatite C et Marqueurs Virus de l’Hépatite C l’Hépatite • Famille : Flaviviridae • Genre : Hepacivirus • Hôte naturel : Homme • Tropisme : Hépatocyte
  • 5. Virus de l’Hépatite C et Marqueurs Organisation Structurale
  • 6. Virus de l’Hépatite C et Marqueurs Organisation Génomique Génomique Protéines structurales Protéines non structurales Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 7. Virus de l’Hépatite C et Marqueurs Fonction des Protéines du VHC Protéines Protéines VHC Fonction Capside Nucléocapside F/ARF ? E1 Enveloppe, domaine de fusion E2 Enveloppe, liaison au récepteur P7/NS1 Canal ionique Ca-dépendant NS2 Autoprotéase NS2-3 NS3 Sérine protéase NTPase/hélicase NS4A Cofacteur de NS3 NS4B Inducteur de la formation du "membranous web" NS5A Indispensable à la réplication, transactivateur? NS5B ARN polymérase ARN-dépendante
  • 8. Virus de l’Hépatite C et Marqueurs Protéine de Capside Protéine – Composant essentiel de la particule virale (nucléocapside) – Formé de deux domaines D1 et D2 – Interaction avec le métabolisme lipidique . Inhibition de la MTP et de la sécrétion des VLDL . Interaction via le domaine D2 avec les gouttelettes lipidiques – Rôle dans la pathogenèse . Déterminant majeur des lésions hépatiques (stéatose, …)
  • 9. VHC génotype 1b Piodi et al., Hepatology 2008, 48(1): 16-27.
  • 10. y x z z x y Piodi et al., Hepatology 2008, 48(1): 16-27.
  • 11. Virus de l’Hépatite C et Marqueurs Protéine NS3 Protéine – Deux régions . Sérine protéase (région N-terminale) . NTPase/hélicase (région C-terminale) – Modulateur de la réponse interféron via les TLR3
  • 12. Virus de l’Hépatite C et Marqueurs Inhibition de la Production d’IFN d’IFN par NS3
  • 13. Virus de l’Hépatite C et Marqueurs Protéine NS3 Protéine – Deux régions . Sérine protéase (région N-terminale) . NTPase/hélicase (région C-terminale) – Modulateur de la réponse interféron via les TLR3 – Cibles de molécules antivirales . Telaprevir (VX-950, Vertex) . Boceprevir (SCH503034, Merck) . R7227 (ITMN191, Roche/Intermune)
  • 14. Site actif (His57, Asp81, Ser139) OPM Database, University of Michigan, College of Pharmacy.
  • 15. Boceprevir (SCH 503034) Telaprevir (VX-950) R7227 (ITMN 191)
  • 16. Virus de l’Hépatite C et Marqueurs Log HCV RNA reduction from baseline Activité Antivirale du TVR Activité 1 Baseline 0 Placebo (n=6) -0,21 -1 Telaprevir 450mg q8h -2 -2,21 (n=10) Telaprevir 1250mg -3 -2,37 q12h (n=10) -4 -4,41 Telaprevir 750mg q8h (n=8) -5 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Days on treatment Reesink et al., Gastroenterology 2006, 131: 997-1002.
  • 17. Virus de l’Hépatite C et Marqueurs Protéine NS5B: RdRp Protéine Lesburg et al., Nat struct Biol 1999, 6: 937-943; Bressanelli et al., Proc Natl Acad Sci USA 1999, 96: 13034-13039; Ago et al., Srructure Fold Des 1999, 7: 1417-1426.
  • 18. Virus de l’Hépatite C et Marqueurs Réplication Virale Réplication – Modèle du poliovirus . Virus à ARN monocaténaire de polarité positive Réplication De Clercq., Nature Review Drug Discovery, 2007; 6: 1001-18
  • 19. Virus de l’Hépatite C et Marqueurs Anti-polymérases Anti-polymérases • Analogues Nucléos(t)idiques – R7128 (Pharmasset) – IDX184 (Idenix Pharmaceuticals) • Analogues non nucléosidiques – Filibuvir (Pfizer) – ANA598 (Anadys Pharmaceuticals) – GS 9190 (Gilead) – ABT-333 (Abbott)
  • 20. Virus de l’Hépatite C et Marqueurs Cibles des Molécules Antivirales Molécules Site C (Palm) Site A (Thumb/fingertips) (A-837093) (JTK-109) Mutants: 411, 414, 448 Mutants: 495, 496, 499 A B E C D Site B (Thumb) HCV-371 Site E (Finger, hypothetical) Mutants: 419, 423, 482 GS-9190 Mutants: 445,448,452 Site D (Palm) (HCV796) Site Actif Mutants: 316 (R7128) Mutants: 282 Copyright © 2006 Merck & Co., Inc., Whitehouse Station, New Jersey, USA
  • 21. Virus de l’Hépatite C et Marqueurs Activité Antivirale du MK-0608 Activité MK-0608 wt S282R/T/I wt S282 MK-0608 at 1mg.kg-1 orally 7 6 HCV RNA (Log IU/mL) 5 4 3 2 - 4,6 - 4,1 LOQ 1 (20 IU/mL) TMA + + + + - - - - - - - - + + 0 -15 -10 -5 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 Days
  • 22. Virus de l’Hépatite C et Marqueurs Cycle Viral Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463
  • 23. Virus de l’Hépatite C et Marqueurs Cycle Viral Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463
  • 24. Virus de l’Hépatite C et Marqueurs Modèle d’Entrée Virale Modèle d’Entrée Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 25. Virus de l’Hépatite C et Marqueurs Cycle Viral Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 26. Virus de l’Hépatite C et Marqueurs Maturation de la Polyprotéine Polyprotéine Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 27. Virus de l’Hépatite C et Marqueurs Structure des Protéines NS Protéines Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 28. Virus de l’Hépatite C et Marqueurs Cycle Viral Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 29. Virus de l’Hépatite C et Marqueurs "Membranous Web" Huh7 naïves Huh7 infectées (réplicon) Gosert et al., J Virol 2003, 77(9): 5487-5492.
  • 30. Virus de l’Hépatite C et Marqueurs Cycle Viral Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 31. Virus de l’Hépatite C l’Hépatite II. Modèles d’Etude Modèles d’Etude
  • 32. Virus de l’Hépatite C et Marqueurs Modèles Animaux Modèles Souris transgéniques Souris SCID/uPA
  • 33. Virus de l’Hépatite C et Marqueurs Modèles Cellulaires Modèles • Pseudoparticules rétrovirales (HCVpp) • Réplicons génomiques et subgénomiques • Système productif (HCVcc)
  • 34. Virus de l’Hépatite C et Marqueurs Modèles Acellulaires Modèles • Modèles enzymatiques - Protéase NS3/4A - ARN polymérase ARN-dépendante (NS5B) - Cyclophyline B
  • 35. Virus de l’Hépatite C et Marqueurs Mesure de l’Activité Enzymatique l’Activité de RDRp Agent intercalant RdRp PAS DE FLUORESCENCE Matrice ARN simple-brin homopolymérique simple- homopolymé Agent intercalant FLUORESCENCE RdRp ARN double-brin double- - Simple - Sensible - Reproductible A. Ahmed-Belkacen, 2007. - Miniaturisé en microplaques 96 puits
  • 36. Virus de l’Hépatite C l’Hépatite III. Variabilité Génétique Variabilité Génétique
  • 37. Virus de l’Hépatite C et Marqueurs Dynamiques Virales du VIH, VHB et VHC HIV HBV HCV Daily virion production 1010 1012 - 1013 1012 Half-life of free virions (hr) 1 4 (<1) 2-3 Half-life of intracellular Days Months Hours virions Mutation rate Very high High Very high Viral reservoir Integrated cDNA cccDNA No Soriano et al., J Antimicrob Chemother 2008, 62: 1-4, Murray et al., Hepatology 2006, 44: 1117-1121; Dandri et al., Hepatology 2008, 48(4):1079-86.
  • 38. Virus de l’Hépatite C et Marqueurs ARN Polymérase ARN-dépendante Polymérase ARN-dépendante • Erreurs au cours de la réplication – Fréquentes . 10-4-10-4 mutations par nucléotide copié au cours de la réplication du VHC – Spontanées – Au hasard • Absence d’activité exonucléasique 3’⇒5’ ⇒ ("proofreading") – Accumulation de mutations • A l’origine de : – La diversification des types et des sous-types – La distribution en quasi-espèces
  • 39. Virus de l’Hépatite C et Marqueurs Diversification des Génotypes Génotypes Central Africa 7 Simmonds et al. Hepatology 2005; Murphy et al., AASLD, Hepatology, 2007.
  • 40. Virus de l’Hépatite C et Marqueurs Répartition Géographique Répartition Géographique 1a, Adapted from Fang J., et al. J. Clin Liver Dis., 1997.
  • 41. Virus de l’Hépatite C et Marqueurs Génotypes en France Génotypes 2% 9,5% 1a 1a 19% 60% 60% 1b 1b 11 9,5% G1 G2 G3 G4 G5
  • 42. Virus de l’Hépatite C et Marqueurs Intérêts de le Détermination des Intérêts Détermination Génotypes Génotypes • Détermination systématique du génotype – Facteur prédictif de la réponse au traitement – Conditionne . La dose de ribavirine . La durée du traitement (24 vs 48-72 semaines)
  • 43. Virus de l’Hépatite C et Marqueurs Distribution en Quasi-espèce Quasi-espèce Weiner et al., Virology 1991; 180:842-848; Martell et al., J Virol 1992;66:3225-36.
  • 44. Virus de l’Hépatite C et Marqueurs Mécanismes d’Evolution de la Mécanismes d’Evolution Quasi-espèce Quasi-espèce • Dérive génétique – Accumulation de mutations ponctuelles • Glissement génétique – Suite à la modification brutale de l’environnement réplicatif
  • 45. Virus de l’Hépatite C et Marqueurs Distribution en Quasi-espèce Quasi-espèce • Joue un rôle dans le maintien de l’infection chronique • Joue un rôle dans l’échec des traitements antiviraux • Joue un rôle dans la sévérité de la maladie Farci P, 2000; Science, 288: 339-344; Lavillette D, 2005; Journal of Virology, 79(10): 6023-6034; Farci P, 2002; PNAS, 99: 3081-3086; Chambers TJ et al., 2005; 79: 3071-3083; Sullivan et al., JID 2007, 196: 239-248.
  • 46. Virus de l’Hépatite C l’Hépatite IV. Exemples d’Application d’Application de la Variabilité Génétique Variabilité Génétique
  • 47. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 48. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 49. Virus de l’Hépatite C et Marqueurs Diversification des Génotypes Génotypes Central Africa 7 Murphy et al., AASLD, Hepatology, 2007.
  • 50. Virus de l’Hépatite C et Marqueurs Génotype & Mode de Transmission Génotype 100% 80% 60% 63% 3 52% 1b 40% 54% 1a Autres 20% 0% UDVI Transfusion Autres Pawlotsky et al., J Infect Dis, 1995; 171(6): 1607-10.
  • 51. Virus de l’Hépatite C et Marqueurs Génotype & Mode de Transmission Génotype 100% 80% 36% 4 60% 3 2 39% 1b 40% 1a 1nt 20% 27% 0% UDVI Transfusion Autres Payan et al., J Viral Hepat 2005;12: 405-13.
  • 52. JK049 HCV-3k TrKj Virus de l’Hépatite C et Marqueurs HCV-3b NE125 HCV-3f NE048 Génotype 3a HCV-3c 98 100 HCV-3a 62 Chez les UDVI 98 92 63 99 81 Argentine 60 Brézil Australie France USA, Côte Est 56 USA, Côte Ouest 52 71 95 0.1 substitution per site 62 83 75 72 79 Morice et al., J Med Virol 2006;78:1296-1303.
  • 53. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 54. Virus de l’Hépatite C et Marqueurs Transmission Nosocomiale "Mondorienne" • Mise en évidence d’une séroconversion VHC lors du dépistage et du suivi des patients hémodialysés en juillet 2005, à l’hôpital Henri Mondor • L’ensemble des patients hémodialysés ont été testés (anticorps anti-VHC et ARN viral) – Mise en évidence d’un 2nd cas au cours de la même période • Analyses génétique et phylogénique • Recherche du VHC dans l’environnement – Supports et surfaces inertes
  • 55. Virus de l’Hépatite C et Marqueurs Transmission Nosocomiale "Mondorienne" Identification de deux cas de séroconversion en 2004 au sein de l’unité d’hémodialyse de l’hôpital Henri Mondor : – Patient "1" infecté par un génotype 3a – Patient "2" infecté par un génotype 1
  • 56. Virus de l’Hépatite C et Marqueurs Genotype 4 4a_ED43 Genotype 3 100 3a_NLZ1 Analyse Genotype 6 Genotype 5 Genotype 2 5a_SA13 6a_EUHK2 Patient 1 2a_HCJ6 Phylogénique Phylogénique Patient 2** 100 Patient 2* Patient 3 1k_QC82 1k_QC68 1j_QC89 1j_QC2 1a_HCJ1 1a_HCVH 1a_HCV1 1g_EG024 1g_2152 1g_1382 Région NS5B (329 nt) 1e_QC172 CLUSTALX 1e_CAM1078 DNADist (PHYLIP 3.5) 1e_M4541N 1l_98CM1457 Matrice de distance: Kimura 2-parameter (Ts/Tv=2) 1l_98CM1427 Neighbor-Joining 1l_M5186N Bootstraping : 1000 replicates 1c_Khaja1 NJPlot 1c_SR031 1c_HCG9 1b_HCVBK G1 1b_HCP01 Patient 4 Patient 5 100 Patient 6 Patient 7 1b_HCJ4 Patient 8 1d_FR17 1d_BA107 Genotype 1 1d_HC1N16 1m_GUI24 1m_GUI11 1m_GUI17 1iQC181 Séroconversion VHC 1i_QC77 1i_FR16 Patients VHC chronique 1f_FR2 1h_98CM1357 0.05 1h_98CM1521 Girou et al., Clin Infect Disease 2008, 47(5): 627-633. 1h_FrSSD98
  • 57. Virus de l’Hépatite C et Marqueurs Analyse Phylogénique Phylogénique 4a_ED43 Patient 7 Patient 4 Patient 8 1b_AWV2C33 Patient 6 1a_HCT18X5 Région HVR1 (81 nt) 3a_CB CLUSTALX 2a_Q2B DNADist (PHYLIP 3.5) 1a_HCT27X5 Matrice de distance: Kimura 2-parameter (Ts/Tv=2) Neighbor-Joining Patient 3 (01/05) Bootstraping : 1000 replicates NJPlot Patient 3 (7/04) Patient 2 (9/04) Patient 2 (7/04) 100 Patient 3 (9/05) Patient 3 (7/05) 1b_HVR3812 5a_SA13 Patient 1 (7/04) 2b_JFH1 6a_33 Séroconversion VHC 0.2 Patients VHC chronique Girou et al., Clin Infect Disease 2008, 47(5): 627-633.
  • 58. Virus de l’Hépatite C et Marqueurs Analyse Phylogénique Phylogénique 4a_ED43 Patient 7 Patient 4 Patient 8 1b_AWV2C33 Patient 6 1a_HCT18X5 Région HVR1 (81 nt) 3a_CB CLUSTALX 2a_Q2B DNADist (PHYLIP 3.5) 1a_HCT27X5 Matrice de distance: Kimura 2-parameter (Ts/Tv=2) S1 (6/05) Neighbor-Joining Patient 3 (01/05) Bootstraping : 1000 replicates NJPlot S2 (6/05) S3 (6/05) S4 (6/05) Patient 3 (7/04) Patient 2 (9/04) Patient 2 (7/04) 100 Patient 3 (9/05) Patient 3 (7/05) S5 (7/05) 1b_HVR3812 5a_SA13 Patient 1 (7/04) 2b_JFH1 Surfaces inertes 6a_33 Séroconversion VHC 0.2 Patients VHC chronique Girou et al., Clin Infect Disease 2008, 47(5): 627-633.
  • 59. Virus de l’Hépatite C et Marqueurs Transmission Nosocomiale au Bénin Bénin • Screening de 64 patients hémodialysés à l’hôpital Hubert Kutuku Maga, Cotonou, Bénin (Afrique) – Détection anticorps anti-VHC – Détection ARN VHC (limite détection <50UI/mL) • Etude génétique et phylogénique de deux régions distinctes du génome viral – NS5B – Core-E1
  • 60. Virus de l’Hépatite C et Marqueurs Analyse Phylogénique Phylogénique 1mGUI24 1mGUI11 1mGUI17 1dBA107 1dHC1N16 1dFR17 99 Patient 26 Patient 52 59 Patient 60 98 Patient 48 Génotype 1, sous-type i 96 1iQC181 1iQC77 1iFR16 Patient 40 1bHCP01 34 100 1bHCVBK Génotype 1, sous-type b 1bHCJ4 Patient 7 Région NS5B (286 nt) Patient 8 Patient 17 CLUSTALX Patient 18 DNADist (PHYLIP 3.5) Patient 36 Matrice de distance: Kimura 2- 100 Patient 16 Patient 64 Génotype 1, sous-type ? parameter (Ts/Tv=2) Patient 28 Patient 2 Neighbor-Joining Patient 54 72 Patient 46 Bootstraping : 1000 replicates Patient 59 NJPlot 1fFR2 1l98CM1457 43 1l98CM1427 1lM5186N 1gEG024 1g2152 1g1382 1eQC172 1eCAM1078 1eM4541N Génotype 1 1kQC82 1kQC68 1jQC89 1jQC2 1aHCJ1 1aHCVH 1aHCV1 1cKhaja1 1cSR031 1cHCG9 1h98CM1521 1h98CM1357 Génotype 4 1hFrSSD98 4aED43 Génotype 3 100 Patient 62 0.05 Génotype 6 3aNLZ1 Génotype 3, sous-type a 6aEUHK2 Génotype 2 2aHCJ6 Patient 49 Génotype 2 Génotype 5 5aSA13
  • 61. Virus de l’Hépatite C et Marqueurs Transmissions Nosocomiales 1bHVR3812 1bAWV2C33 Patient 60 Patient 48 Patient 52 Patient 40 Patient 26 Région HVR1 (81 nt) CLUSTALX Patient 59 DNADist (PHYLIP 3.5) 5aSA13 Matrice de distance: Kimura 2- parameter (Ts/Tv=2) Patient 46 Neighbor-Joining Patient 54 NJPlot Patient 64 Patient 28 Patient 2 Patient 17 Patient 18 Patient 16 Patient 8 Patient 7 1aHCT27X5 4aED43 6a33 1aHCT18X5 2bJFH1 0.2 3aCB 2aQ2B
  • 62. Virus de l’Hépatite C et Marqueurs Assignation Provisoire d’un Nouveau Sous-type : Etude de la région NS5B 1c_AY051292 1c_AY051292 1c_D14853 1c_D14853 1a_M62321 1a_M62321 1a_M67463 1a_M67463 1k_AY434112 1k_AY434112 1k_AY434122 1k_AY434122 1j_AY434128 1j_AY434128 1j_AY434158 1j_AY434158 1h_AY434131 1g_AF271820 1i_AY434119 1g_AF271822 1b_D90208 1e_AY894555 1b_M58335 1b_D90208 MAXIMUM DE VRAISEMBLANCE 1d_L39299 PARCIMONIE 1b_M58335 1d_L39302 1d_L39299 1g_AF271820 1d_L39302 1g_AF271822 1i_AY434119 1e_AY894555 1h_AY434131 1f_L38350 1f_L38350 Patient 46 Patient 46 Patient 64 Patient 64 Patient 7 Patient 8 Patient 8 Patient 7 Patient 17 Patient 17 0.05 Patient 18 Patient 18 Patient 16 Patient 16
  • 63. Virus de l’Hépatite C et Marqueurs Assignation Provisoire d’un Nouveau Sous-type : Etude de la région Core-E1 1h_AY257087 1a_M62321 1h_AY434132 1a_M67463 1f_L38371 1j_AY434106 1a_M62321 1j_AY434129 1a_M67463 1k_AY434113 1j_AY434106 1k_AY434123 1j_AY434129 1e_L38361 1k_AY434113 1e_AY894553 1k_AY434123 1g_AF271798 1e_L38361 1g_AF271797 1e_AY894553 1c_D14853 1g_AF271798 1c_AY051292 1g_AF271797 1l_AY257083 1c_D14853 1l_AY257091 1c_AY051292 1f_L38371 1l_AY257083 MAXIMUM DE VRAISEMBLANCE 1b_D90208 PARCIMONIE 1l_AY257091 1b_L38372 1b_M58335 1b_M58335 1b_L38372 1i_L48495 1b_D90208 1i_AY434120 1i_L48495 1d_L38377 1i_AY434120 1h_AY257087 1d_L38377 1h_AY434132 Patient 8 Patient 8 Patient 17 Patient 7 Patient 16 Patient 17 Patient 18 Patient 16 Patient 46 Patient 18 Patient 64 Patient 46 0.02 Patient 64 Patient 7
  • 64. Virus de l’Hépatite C et Marqueurs Transmission Nosocomiale en Grèce Grèce • Epidémie à VHC au sein d’une unité d’hémodialyse en Grèce ("Papageorgiou General Hospital", Thessaloniki) Hospital • 17 patients hémodialysés contaminés en quelques mois • Analyses génétique et phylogénique • Etude de la réponse neutralisante – Système HCVpp Lavillette et al., J Virol 2005;79:6023-34
  • 65. Virus de l’Hépatite C et Marqueurs Analyse Phylogénique Phylogénique 1a HCV-1 HCV-H 1c SR052 HC-G9 SR037 HCV-1 HC-J4 HCV-BK BE90 Pt-16 Région HVR1 (81 nt) 1b Pt-2 CLUSTALX Pt-4 DNADist (PHYLIP 3.5) Pt-3 Matrice de distance: Kimura 2- parameter (Ts/Tv=2) Neighbor-Joining Pt-1 Pt-17 Souche A NJPlot Pt-7 Pt-6 Pt-8 Pt-11 Pt-10 0,1 substitution per site Pt-9 Pt-5 Pt-12 Pt-13 Souche B Pt-15 Lavillette et al., J Virol 2005;79:6023-34
  • 66. Virus de l’Hépatite C et Marqueurs Réponse Neutralisante - Groupe 1 Réponse • Absence de réponse neutralisante et absence de contrôle de l’infection ARN VHC % neutralisation (UI/mL) infection 1,E+08 100 200 Huh7 1,E+07 90 180 80 Patient-10 (souche B) 70 160 60 1,E+06 140 50 40 120 1,E+05 30 20 100 1,E+04 10 80 0 ARN VHC -10 60 1,E+03 -20 Réponse Neutralisante 40 -30 1,E+02 -40 20 -50 Contrôle Neutralisation 1,E+01 -60 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 ALAT Semaines Lavillette et al., J Virol 2005;79:6023-34
  • 67. Virus de l’Hépatite C et Marqueurs Réponse Neutralisante - Groupe 2 Réponse • Réponse neutralisante forte et spécifique • Réponse neutralisante inversement proportionnelle à la cinétique de la charge virale ARN VHC (UI/mL) % neutralisation infection 1,E+08 100 200 Huh7 90 180 Patient-1 (souche A) 1,E+07 80 160 1,E+06 70 140 60 120 1,E+05 50 100 1,E+04 40 80 ARN VHC 1,E+03 30 60 Réponse Neutralisante 20 40 1,E+02 10 20 Contrôle Neutralisation 1,E+01 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 0 ALAT Semaines Lavillette et al., J Virol 2005;79:6023-34
  • 68. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 69. Virus de l’Hépatite C et Marqueurs Histoire Naturelle Hépatite Aiguë Hépatite Chronique 50 - 80% Stéatose 20 - 30 ans Fibrose Cirrhose 20 - 30% Décompensation HCC 6 - 10% 4-5% par an Mortalité
  • 70. Virus de l’Hépatite C et Marqueurs Histoire Naturelle Hépatite Aiguë Hépatite Chronique 50 - 80% Stéatose 20 - 30 ans Fibrose Cirrhose 20 - 30% Décompensation HCC 6 - 10% 4-5% par an Mortalité
  • 71. Virus de l’Hépatite C et Marqueurs Histoire Naturelle Hépatite Aiguë Hépatite Chronique 50 - 85% 10 - 30 ans Cirrhose 20 - 30% Décompensation HCC 6 - 10% 4 - 5% par an Mortalité
  • 72. Virus de l’Hépatite C et Marqueurs Persistance Virale • Persistance virale – Echec de la réponse immune, pourtant présente et adaptée, à éliminer le virus ou les cellules qui l’abritent • Interface complexe
  • 73. Virus de l’Hépatite C et Marqueurs Processus Multi-étape Hépatite Aiguë Infection Chronique Hépatite Chronique 50 - 85% 1. Mise en place de l’infection aiguë 2. Etablissement de la persistance virale 3. Maintient de l’infection au cours du temps
  • 74. Virus de l’Hépatite C et Marqueurs Processus Multi-étape Hépatite Aiguë Infection Chronique Hépatite Chronique 50 - 85% 1. Mise en place de l’infection aiguë 2. Etablissement de la persistance virale ? 3. Maintient de l’infection au cours du temps
  • 75. Virus de l’Hépatite C et Marqueurs Persistance du VHC Adapted from Ferrari C, Gasroenterology 2007; 132(2): 801-805
  • 76. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 77. Virus de l’Hépatite C et Marqueurs Compartimentation Plasma-PBMC Plasma-PBMC Région 5’NC Région E1-E2 (Pt-3) (Pt-3) Roque-Afonso et al., J Virol 2005;79:6349-57)
  • 78. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 79.
  • 80. Virus de l’Hépatite C et Marqueurs Résistance du VHC Résistance • Résistance naturelle du VHC à l’interféron • Résistance du VHC à la thérapie par l’interféron • Résistance du VHC aux inhibiteurs spécifiques (DAA)
  • 81. HEPATITE C : Stratégie Stratégie Diagnostique & Suivi Virologique
  • 82. Virus de l’Hépatite C l’Hépatite I. Cinétique des Marqueurs Cinétique Virologiques
  • 83. Stratégie diagnostique & suivi virologique Marqueurs Virologiques Marqueurs indirects Anticorps anti-VHC totaux Marqueurs directs Ag de capside ARN VHC Génotype VHC
  • 84. Stratégie diagnostique & suivi virologique Cinétique des Marqueurs Cinétique Infection Aiguë Symptômes +/- Anti-VHC ARN VHC Titre ALAT Normal 0 1 2 3 4 5 6 12 24 36 48 Temps après contage (mois)
  • 85. Stratégie diagnostique & suivi virologique Cinétique des Marqueurs Cinétique Infection Chronique Anti-VHC Symptômes +/- ARN VHC Titre ALAT Normal 0 1 2 3 4 5 6 12 24 36 48 Temps après contage (mois)
  • 86. Virus de l’Hépatite C II. Tests Virologiques
  • 87. Stratégie diagnostique & suivi virologique Tests Virologiques Moléculaires Moléculaires Tests qualitatifs Tests quantitatifs Très sensibles Seuil de détection ≥ qualitatifs ≤ (≤ 50 IU/mL) Quelle quantité est présente ? Est-ce que le VHC est présent ? Détermination du Génotype Quel type de VHC est présent ?
  • 88. Stratégie diagnostique & suivi virologique Tests Virologiques Moléculaires Moléculaires Tests Qualitatifs - Quantitatifs Est-ce que le VHC est présent et en quelle quantité ? Détermination du Génotype Quel type de VHC est présent ?
  • 89.
  • 90. Stratégie diagnostique & suivi virologique Intérêts de la Détection - Intérêts Détection Quantification de l’ARN VHC l’ARN • Evaluation de la réplication virale chez des patients anticorps anti-VHC positifs • Evaluation de la réponse virologique au cours du traitement standard – Interféron pégylé alpha-2a ou -2b – Ribavirine
  • 91. Stratégie diagnostique & suivi virologique Cinétiques & Réponses au Traitement Peg-IFN-RBV 8 7 ARN VHC (Log10 UI/mL) 6 5 Diminution ≥ 2 Log 4 3 2 Limite de détection 1 (10-15 UI/mL) 0 0 4 8 12 Semaines
  • 92. Stratégie diagnostique & suivi virologique Cinétiques & Réponses au Traitement Peg-IFN-RBV 8 7 ARN VHC (Log10 UI/mL) 6 5 Diminution ≥ 2 Log 4 3 RV lente RVR 2 RVP Limite de détection 1 (10-15 UI/mL) 0 0 2 4 8 12 Semaines
  • 93. Stratégie diagnostique & suivi virologique Techniques Disponibles b-DNA PCR Branched DNA Polymerase chain reaction Amplification du signal Amplification de la cible Quantitative Quantitative
  • 94. Stratégie diagnostique & suivi virologique Principe des Techniques b-DNA PCR Branched DNA Polymerase chain reaction Amplification du signal Amplification de la cible Quantitative Quantitative
  • 95. Stratégie diagnostique & suivi virologique bDNA : Forces & Faiblesses • Forces – Quantification indépendante du génotype – Tolérance de polymorphismes nucléotidiques – Faible volume de prise d’essai – Large intervalle de quantification linéaire . ≥ 6,90 Log10 UI/mL • Faiblesses – Faible sensibilité . LLOD: 2,80 Log10 UI/mL – Faux positifs dans les faibles valeurs – Méthode semi-automatisée (Siemens system 440 analyzer) – 12 contrôles par run
  • 96. Stratégie diagnostique & suivi virologique Principe des Techniques b-DNA PCR Branched DNA Polymerase chain reaction Amplification du signal Amplification de la cible Quantitative Quantitative
  • 97. Stratégie diagnostique & suivi virologique Avantages Techniques de la PCR en Temps Réel – Diminution du risque de contamination – Amélioration de la sensibilité – Augmentation de l’intervalle de quantification linéaire – Précision et reproductibilité – Augmentation de débit à travers l’automatisation – Diminution des coûts
  • 98. Stratégie diagnostique & suivi virologique Intervalles de Quantification 10 102 103 104 105 106 107 108 Cobas Amplicor HCV Monitor v2.0 SuperQuant LCx HCV RNA Assay Versant HCV RNA 3.0 (bDNA)
  • 99. Stratégie diagnostique & suivi virologique Intervalles de Quantification 10 102 103 104 105 106 107 108 Cobas Amplicor HCV Monitor v2.0 SuperQuant LCx HCV RNA Assay Versant HCV RNA 3.0 (bDNA) TaqMan 48 HCV (Roche) HCV Quant ASR (Abbott) Versant HCV RNA 1.0 (kPCR, Siemens)* *en développement
  • 100. Stratégie diagnostique & suivi virologique Avantages Techniques de la PCR en Temps Réel – Diminution du risque de contamination – Amélioration de la sensibilité – Augmentation de l’intervalle de quantification linéaire – Précision et reproductibilité – Augmentation du débit à travers l’automatisation – Diminution des coûts
  • 101. Stratégie diagnostique & suivi virologique Avantages Cliniques de la PCR en Temps Réel • Remplace les techniques qualitatives de détection de l’ARN VHC • Quantifie l’ensemble des charges virales observées en pratique clinique – Faibles charges virales au cours du traitement • Surveille efficacement les cinétiques virales (évaluation précoce des réponses virologiques au traitement)
  • 102. Stratégie diagnostique & suivi virologique Quantification de l’ARN VHC (CTM, Roche) 8 HCV RNA level in CAP/CTM48 (Log10 IU/mL) 7 Genotype 1 (n=29) 6 Genotype 2 (n=27) Genotype 3 (n=29) 5 Genotype 4 (n=30) Genotype 5 (n=9) 4 Genotype 6 (n=2) r = 0.889; p < 0.0001 3 3 4 5 6 7 8 HCV RNA level in Versant HCV 3.0 Assay bDNA (Log10 UI/mL) Chevaliez et al., 2007; Hepatology, 46(1): 22-31.
  • 103. Stratégie diagnostique & suivi virologique Différences de Quantification Difference between HCV RNA levels measured in CAP/CTM and in bDNA (in Log10 UI/mL) CAP-CTM48 (Roche) versus bDNA 3.0 (Siemens) 1.5 1.0 0.5 Genotype 1 (n=29) 0.0 Genotype 2 (n=27) Genotype 3 (n=29) -0.5 Genotype 4 (n=30) -1.0 Genotype 5 (n=9) Genotype 6 (n=2) -1.5 15% 30%
  • 104. Stratégie diagnostique & suivi virologique Absence de Détection de l’ARN Viral de Patients Infectés par un VHC de Génotype 4 (Log10IU/mL) CAP/CTM96 m2000SP/m2000RT Versant 3.0 Patient 1 (4h) <1.08 5.4 5.0 Patient 2 (4l) <1.08 6.0 5.7 80 90 100 110 120 130 140 150 160 170 180 |.........|.........|.........|.........|.........|.........|.........|.........|.........|.........| F_7157 (4a): TAGCCATGGCGTTAGTATGAGTGTTGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATCGCCGG Patient 1 (4h): ...........................A.....................................A...................T............... Patient 2 (4l): ...........................A.....................................A...................T............... 190 200 210 220 230 240 250 260 270 .........|.........|......-...|.........| .........|.........|.........|.........| .........|........ F_7157 (4a): GATGACCGGGTCCTTTCTTGGATTAA-CCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCC Patient 1 (4h): ......................A.T.A.......................................................................... Patient 2 (4l): .......................C..-.......................................................C.......T.......... 280 290 300 310 320 330 340 |.........|.........|.........|.........|.........|.........|. F_7157 (4a): TTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACC Patient 1 (4h): ............................................................. Patient 2 (4l): ............................................................. Chevaliez et al., 2008; Hepatology, 49(4): 1397-1398.
  • 105. Stratégie diagnostique & suivi virologique Quantification de Transcrits d’ARN Sauvages ou Mutés en Position 145 et/ou 165 Measured HCV RNA levels (Log10 IU/mL) HCV 5’NC sequence Real-time PCR assays bDNA assay CTM m2000 Versant 3.0 Wild-type (G145 and 5.73±0.13 6.05±0.10 6.43±0.01 A165) Single mutant (G145A and 4.02±0.13 6.00±0.11 6.69±0.02 A165) Single mutant (G145 and 4.28±0.35 5.88±0.20 6.30±0.02 A165T) Double mutant (G145A <1.08* 5.95±0.25 6.60±0.18 and A165T) *Target not detected Chevaliez et al., Hepatology, 2009, 50(5): 1681.
  • 106. Stratégie diagnostique & suivi virologique Quantification de l’ARN VHC (m2000, Abbott) HCV RNA level in m2000SP/m2000RT (Log10 IU/mL) 8 7 Genotype 1 (n=55) 6 Genotype 2 (n=21) Genotype 3 (n=29) 5 Genotype 4 (n=24) Genotype 5 (n=9) 4 Genotype 6 (n=3) r = 0.972; p < 0.0001 3 3 4 5 6 7 8 HCV RNA level in Versant HCV 3.0 Assay bDNA (Log10 UI/mL) Chevaliez et al., J Clin Microbiol, 2009,47(6):1726-32.
  • 107. Stratégie diagnostique & suivi virologique Quantification de l’ARN VHC (kPCR, Siemens) 132 clinical samples David Sherman., Molecular Symposium, September 2007 (source: Siemens Medical Solutions Diagnostics).
  • 108.
  • 109. Stratégie diagnostique & suivi virologique Génotypes du VHC Génotypes Central Africa 7 Simmonds et al. Hepatology 2005; Murphy et al., AASLD, Hepatology, 2007.
  • 110. Stratégie diagnostique & suivi virologique Intérêts de la Détermination du Intérêts Détermination Génotype Génotype • Détermination systématique du génotype – Facteur prédictif de la réponse au traitement – Conditionne . La dose de ribavirine . La durée du traitement (24 vs 48 semaines)
  • 111. Stratégie diagnostique & suivi virologique Détermination du Génotype Détermination Génotype • Détermination moléculaire du génotype VHC (génotypage) • Détermination sérologique du génotype VHC (“sérotypage”)
  • 112. Stratégie diagnostique & suivi virologique Détermination du Génotype Détermination Génotype • Détermination moléculaire du génotype VHC (génotypage) • Détermination sérologique du génotype VHC (“sérotypage”)
  • 113. Stratégie diagnostique & suivi virologique Régions Virales Ciblées Régions Ciblées – Complete genome (new subtype identification) – NS5B coding region (the reference region) – Envelope E1 coding region (the second reference region) – 5’-untranslated region, 5’UTR (the most frequently used in practice)
  • 114. Stratégie diagnostique & suivi virologique Méthodes Moléculaires de Génotypage Méthodes Moléculaires Génotypage • Séquençage direct des produits d’amplification1 • Hybridation inverse des produits d’amplification sur support solide : Line Probe Assay (INNO-LiPA HCV, Innogenetics) • PCR en temps réel à l’aide de primers et/ou sondes génotype spécifiques • Autres méthodes : – Restriction fragment length polymorphism analysis (RFLP) – Single-strand conformation polymorphism analysis (SSCP) – Spectrométrie de masse MALDI-TOF après miniséquençage Arens et al., J Clin Virol, 2001; 22:11-29; Davidson et al., J Gen Virol 1995; 76: 1197-204; Lareu et al., 1997; Le Pogam et al., 1998; J Clin Microbiol; 36: 1461-3; Ilina et al., J Clin Miocrobiol, 2005; 43(6): 2810-15.
  • 115. Stratégie diagnostique & suivi virologique Analyse Après Séquençage Direct • The reference method • Direct sequence analysis of NS5B or, eventually , E1 is used for accurate genotype and subtype determination • Direct sequence analysis of the 5’UTR can be used in clinical practice.
  • 116. Stratégie diagnostique & suivi virologique TRUGENE® HCV 5’NC Genotyping (Siemens) • One-step RT-PCR generating a 244-bp fragment • PCR products are sequenced in both senses • Forward and reverse sequences are aligned with prototype reference strain sequences from the GeneLibrarian database • The HCV genotype is determined by sequence homology Young et al., J Clin Microbil, 1993; 31: 882-86; Roos et al., J Cli Microbiol, 2000; 38(10): 3581-84; Germer et al., J Clin Microbiol, 2003; 41(10): 4855-577
  • 117. Stratégie diagnostique & suivi virologique Analyse Après Séquençage Direct • Pros – Reference method for HCV genotype and subtype determination – Can be used, with the appropriate target region, for . Identification of new subtypes . Molecular epidemiology studies – Assays are available for use in clinical practice • Cons – Mixed genotype infections are not detected – Labor intensive and time-consuming – Costly
  • 118. Stratégie diagnostique & suivi virologique Hybridation Inverse • Line probe assay • Based on reverse hybridization of PCR products onto genotype-specific probes • Two generations of assays – 1st-generation assay: probes in the 5’UTR – 2nd-generation assay: probes in the 5’UTR and core region
  • 119. Stratégie diagnostique & suivi virologique Versant® HCV Genotype 2.0 Assay ® (INNO-LiPA) (INNO-LiPA)
  • 120. Stratégie diagnostique & suivi virologique Hybridation Inverse • Pros – Easy to use and potential semi-automation (Auto- LiPA) – Cheaper – Mixed genotype infections can be detected • Cons – Should not be used for identification of new subtypes or molecular epidemiology studies because of possible mis-subtyping
  • 121. Stratégie diagnostique & suivi virologique Intérêts de la Détermination du Intérêts Détermination Sous-Type ? Sous-Type • DAA drugs may have different antiviral efficacies on different HCV genotype 1 subtypes in vitro and in vivo • DAA drugs administration may be associated with different resistance profiles with different HCV genotype 1 subtypes in vitro and in vivo
  • 122. Stratégie diagnostique & suivi virologique Activité Antivirale Sous-Type Dépendant • BILB 1941, an NNI inhibitor of HCV RNA- dependent RNA polymerase, showed better antiviral efficacy in HCV subtype 1b than in subtype 1a – In vitro, EC50s: 84 nM in subtype 1a vs 153 nM in subtype 1b – In vivo, over 5 days of administration in HCV-infected patients Erhardt et al., Antivir Ther 2009, 14: 23-32.
  • 123. Stratégie diagnostique & suivi virologique Profil de Résistance Sous-Type Dépendant • HCV genotype 1 subtype-specific resistance to telaprevir – In vitro, R155K substitutions are selected only in genotype 1a replicons – In vivo, amino acid substitutions at positions 36 and 155 are selected only in patients infected with subtype 1a • HCV genotype 1 subtype-specific fitness of variants resistant to HCV-796 – In patients infected with subtype 1b, the C316Y substitution is found alone in fit resistant variants – In patients infected with subtype 1a, the C316Y substitution requires additional substitutions to gain full fitness Kieffer et al., hepatology 2007, 46: 631-639; Sarrazin et al., Gastroenterology 2007, 132: 1767-1777;; Delano et al., 1st International Workshop on HepC Resistance and New Compounds 2006; McCown et al., Antimicrob Agents Chemother 2009.
  • 124. Stratégie diagnostique & suivi virologique Importance de la Région Virale Région pour la Détermination du Sous-type Détermination Sous-type 1st Generation of 2nd Generation of Sequence Analysis RealTime HCV Line Probe Assay Line Probe Assay of the 5’NCR Genotype II (LiPA 1.0) (LiPA 2.0) GT 1a 77.6% 70.5% 97.5% 93.2% (n=237) (n=184) (n=167) (n=231) (n=220) GT 1b 90.5% 91.3% 96.2% 88.6% (n=263) (n=238) (n=240) (n=253) (n=233) Chevaliez et al., PLoS One 2009, 4(12): e820.
  • 125. Stratégie diagnostique & suivi virologique Intérêts des "Nouveaux" Tests Intérêts Sérologiques ? Sérologiques • Détection - quantification de l’antigène de capside (AgC) • Test de détection des antigènes et des anticorps (combo)
  • 126. Stratégie diagnostique & suivi virologique Antigène de Capside : Marqueur Indirect de la Réplication Virale r = 0.92; p < 0.0001 Bouvier-Alias et al., Hepatology 2002, 36(1): 211-218.
  • 127. Stratégie diagnostique & suivi virologique Intérêts de la Détection- Quantification de l’Ag de Capside • Diagnostic de l’infection virale C – Marqueur sérologique précoce . Réduction de la fenêtre sérologique à environ 20 jours . Génotype-indépendant – Facile à mettre en œuvre, rapide, bon marché (ELISA automatisée) – Trousse commerciale • Décision de traiter et Monitoring de l’efficacité du traitement – Marqueur indirect de la réplication virale . 1 pg d’Ag C ≈ 8 000 UI/mL ARN – Alternative aux méthodes moléculaires de quantification de l’ARN – Seuil de quantification équivalent à 20 000 UI/mL d’ARN Bouvier-Alias et al., Hepatology 2002, 36(1): 211-218; Mehdi et al., Clin Biochem. 2008, 41(18):1493.
  • 128. Stratégie diagnostique & suivi virologique Détection Simultanée Ag/Ac (Test Combo) • Diagnostic de l’infection virale C – Réduction de la fenêtre sérologique (~20 jours) . ~60 jours avec les dernières générations de trousses anticorps . ~40 jours ave les trousses Combo – Alternative aux méthodes de DGV – Facile à mettre en œuvre, rapide (ELISA automatisé) – Trousses commerciales – Pas aussi sensible que les méthodes qualitative de détection de l’ARN et de détection de l’Ag de capside Laperche et al. J Clin Micribiol 2005, 43(8): 3877-3883; Alzahrani AJ., J Med Virol 2008, 80(4): 603-6.
  • 129. Virus de l’Hépatite C III. Diagnostic Virologique
  • 130. Stratégie diagnostique & suivi virologique Diagnostic de l’Infection Aiguë l’Infection Aiguë Ac anti-VHC ARN VHC* Diagnostic - - Absence d’infection aiguë - + Infection aiguë C + - Probablement pas d’infection aiguë + + Difficile de conclure * Technique sensible seuil de détection ≤ 10-15 UI/mL
  • 131. Stratégie diagnostique & suivi virologique Diagnostic de l’Infection Aiguë l’Infection Aiguë • Facteurs supplémentaires à prendre en compte chez des populations à risque – Niveaux de charges virales – Variation de la charge virale 4 et 10 semaines après la suspicion de l’hépatite aiguë – Activité sérique des transaminases McGovern et al., CID 2009, 49: 1051-1060.
  • 132. Stratégie diagnostique & suivi virologique Algorithme pour le Diagnostic de l’Hépatite Aiguë* Suspicion d’hépatite aiguë ARN VHC Fluctuations ARN Fluctuations ARN Séroconversion < 5Log10 UI/mL >1 Log10 UI/mL <1 Log10 UI/mL ou ARN VHC > 5 Log10 UI/mL ALAT> 7xLSN ALAT> 7xLSN Probabilité Probabilité Probabilité Hépatite aiguë élevée modérée faible *population à risque (IDVU) McGovern et al., CID 2009, 49: 1051-1060.
  • 133. Stratégie diagnostique & suivi virologique Diagnostic de l’Infection Chronique l’Infection – Détection des anticorps anti-VHC totaux par ELISA – Recherche d’ARN du VHC par un test sensible* – Détection d’ARN du VHC* si le test ELISA est négatif chez des patients hémodialysés ou immunodéprimés * Technique sensible seuil de détection ≤ 10-15 UI/mL
  • 134. Virus de l’Hépatite C III. Prise en Charge Thérapeutique
  • 135. Stratégie diagnostique & suivi virologique Intérêts des Tests Virologiques en Intérêts Thérapeutique Thérapeutique – Décision de traiter – Optimisation du schéma thérapeutique – Etude de la réponse virologique au traitement Consensus conference: treatment of hepatitis C; 2002, Gastroenterol Clin Biol, 26(2): B303-20.
  • 136. Stratégie diagnostique & suivi virologique Classification des Patients Génotypes VHC Type Types Types 1 2, 3 4, 5, 6 Consensus conference: treatment of hepatitis C; 2002, Gastroenterol Clin Biol, 26(2): B303-20
  • 137. Stratégie diagnostique & suivi virologique Indications Actuelles du Traitement • Patients infectés par un VHC de génotype 1 – Interferon pégylé plus ribavirine (1000 - 1400 mg/j) – Durée : 48 semaines • Patients infectés par un VHC de génotype 2/3 – Interferon pégylé plus ribavirine (800 mg/j) – Durée : 24 semaines • Patients infectés par une VHC de génotype 4, 5 et 6 – Interferon pégylé plus ribavirine (1000 - 1400 mg/j) – Durée : 48 semaines Consensus conference: treatment of hepatitis C; 2002, Gastroenterol Clin Biol, 26(2): B303-20
  • 138. Génotype VHC VHC-1 (4,5,6) VHC-2,3 Quantification ARN Bithérapie Bithérapie 48 semaines 24 semaines Ribavirine 1000-1400 mg Ribavirine 800 mg Quantification ARN à S12 Diminution < 2 Log Diminution ≥ 2 Log diminution ≥ 2 Log ARN VHC + ARN VHC - Arrêt traitement poursuite avec Poursuite jusqu’à IFN pégylé pour S24 ralentir la progression de la Si ARN VHC - maladie Poursuite jusqu’à Poursuite jusqu’à hépatique S48 S48
  • 139. Stratégie diagnostique & suivi virologique Optimisation du Traitement en Fonction de la Réponse Virologique Réponse • Outils virologiques sensibles – Sensibilité : 10-15 UI/mL – Evaluation de la réponse au traitement • Répondeurs virologiques rapides – Raccourcissement de la durée de traitement • Répondeurs virologiques précoces partiels – Allongement de la durée de traitement
  • 140. Raccourcissement de la Durée de Traitement