SlideShare une entreprise Scribd logo
1  sur  109
Télécharger pour lire hors ligne
HEPATITE C
Virus & Marqueurs


     Stéphane Chevaliez

                 Centre National de Référence
                   Des Hépatites B, C et delta
      Laboratoire de Virologie & INSERM U955
                         Hôpital Henri Mondor
                           Université Paris-Est
                                        Créteil
Hépatite C : virus et marqueurs


  Virus de l’Hépatite C

       • Découvert par Houghton en 1989


       • 1ère cause d’hépatite chronique et de cirrhose

       en Europe et en Amérique du Nord


       • 1ère indication de transplantation hépatique

       dans les pays industrialisés
Afdhal,
NH.
2004;
Sem
Liv
Dis,
24(Supp
2):
3‐8
Hépatite C : virus et marqueurs


Virus de l’Hépatite C

• Famille : Flaviviridae

• Genre : Hepacivirus




                                            Phylogénie de la région codant la protéine NS5B
Adapted
from
Simmonds
et
al.,
1999;
2001.
Hépatite C : virus et marqueurs


Virus de l’Hépatite C

• Famille : Flaviviridae

• Genre : Hepacivirus

• Hôte naturel : Homme

• Tropisme : Hépatocyte
Hépatite C : virus et marqueurs


Organisation Structurale
Hépatite C : virus et marqueurs


Organisation Génomique des
Flaviviridae
          0                 1800              3600       5400              7200          9000          10800


 Hepatitis
C
virus

  5’UTR                                                                                    3’UTR
                 C     E1    E2         NS2      NS3         NS4B NS5A            NS5B
                                   p7




                                                         4A
 Pestivirus

  5’UTR                                                                                                    3’UTR
                 C E0 E1           E2    NS2           NS3               NS4B     NS5A          NS5B
          Npro




                                                                    4A
                                        p7




 Yellow
fever
virus

  5’UTR                                                                                                   3’UTR
                 prM




    Cap C                   E           NS1      2A 2B        NS3          NS4A 4B         NS5
Hépatite C : virus et marqueurs


Organisation Génomique




         Protéines structurales                         Protéines non structurales




Popescu
and
Dubuisson,
Bio.
Cell
2010,
102(1):
63‐74.
Hépatite C : virus et marqueurs


Organisation Génomique




Bartenschlager
et
al,
Trends
Microbiol,
in
press.
Hépatite C : virus et marqueurs


IRES et Traduction




From
Department
of
Structural
Biology,
Stanford
University
Medical
School,
USA.
Hépatite C : virus et marqueurs


Réseaux d’Interactions




Park
et
al,
BMC
Bioinformatics
2010,
11(Suppl
1):
S23.
Hépatite C : virus et marqueurs


Protéine de Capside




Boulant
et
al,
J
Virol
2005,
79(17):
11353‐11365.
VHC G1b

Piodi
et
al.,
Hepatology
2008,
48(1):
16‐27.
Hépatite C : virus et marqueurs


   Capside et Lipides




Bartenschalger
et
al.,
Tends
Microbiol,
in
press.
Hépatite C : virus et marqueurs


   Interaction entre la Capside et
   DGAT-1




                             *Diacylglycérol diacyltransférase-1


Herker
et
al.,
Nat
Med
2010,
16(11):
1295‐1298.
Hépatite C : virus et marqueurs


   Glycoprotéine E2
        • Hétérodimère avec E1
        • Régions hypervariables
                 – HVR1
                 – HVR2
                 – igVR


        • Rôles
                 – HVR2 et igVR
                 indispensables au “folding“
                 E1-E2
                 – Étapes précoces
                 (interaction avec CD81,
                 peptide de fusion)

Krey
et
al.,
PLoS
Pathog.
2010,
6(2):
e1000762;
McCaffrey
et
al.,
J
Gen
Virol
2011,
92:
112‐121.
Hépatite C : virus et marqueurs


Étape Précoce : Entrée du VHC




Popescu
et
al.,
Bio
Cell
2010,
102:
63‐74.
Hépatite C : virus et marqueurs


HVR1




                                     Région HVR1 (27 amino-acides)
                                      80% de divergence nucléotidique entre génotypes
                                      Epitope majeur de neutralisation



Timm
et
al.,
World
J
Gastroenterol
2007;
13(36)4808‐4817.

Hépatite C : virus et marqueurs


Transmission du VHC
Hépatite C : virus et marqueurs


Analyse Phylogénique
                                                                              4a_ED43
                                                                     Patient 7
                                                                           Patient 4
                                                                                            Patient 8
                                                                                     1b_AWV2C33
                                                                                Patient 6
                                                                1a_HCT18X5
  Région HVR1 (81 nt)                                                            3a_CB
  CLUSTALX                                                                                  2a_Q2B
  DNADist (PHYLIP 3.5)                                                     1a_HCT27X5
  Matrice de distance: Kimura 2-parameter (Ts/Tv=2)                          S1 (6/05)
  Neighbor-Joining
                                                                             Patient 3 (01/05)
  Bootstraping : 1000 replicates
  NJPlot
                                                                             S2 (6/05)
                                                                             S3 (6/05)
                                                                             S4 (6/05)
                                                                             Patient 3 (7/04)
                                                                             Patient 2 (9/04)
                                                                             Patient 2 (7/04)
                                                                         100 Patient 3 (9/05)
                                                                             Patient 3 (7/05)
                                                                             S5 (7/05)
                                                                                                        1b_HVR3812
                                                                                   5a_SA13
                                                                                 Patient 1 (7/04)
                                                                                2b_JFH1
        Surfaces inertes                                         6a_33
        Séroconversion VHC                                0.2
        Patients VHC chroniques


Girou
et
al.,
Clin
Infect
Disease
2008,
47(5):
627‐633.
Hépatite C : virus et marqueurs


Protéine p7
• Viroporine dont la
     structure 3D a été
     récemment déterminée
     par ME


• Rôle(s) in vivo ?


• Cible thérapeutique
     potentielle


Luik
et
al.,
Proc
Natl
Acad
Sci
2009,
4;106(31):
12712‐6;
Griffin
S,
Proc
Natl
Acad
Sci
2009,
106(31):
12567‐68.
Hépatite C : virus et marqueurs


Activité Antivirale du BIT225
• IC50 de 314 nM dans le modèle du BVDV
• Activité synergique




Luscombe
et
al.,
Antiviral
Res
2010
May;86(2):144‐53.
Hépatite C : virus et marqueurs


Protéine NS2
• NS2 (région N-ter)
       – Rôle dans l’organisation
            de la formation des
            nucléocapsides




• NS2pro (région C-ter)




Jirasko
et
al.,
PLoS
pathog
2010
Dec
16;6(12):
e1001233;
Ivo
et
al.,
Nature
2006,
442:
831‐835.
Hépatite C : virus et marqueurs


Protéine NS3-4A




Raney
et
al.,
J
Biol
Chem
2010,
285(30):
22725‐731.
Hépatite C : Nouvelles Hepatite C : virus et marqueurs


Inhibition de la Production d’IFN
par NS3
Hépatite C : virus et marqueurs


Protéase NS3




Raney
et
al.,
J
Biol
Chem
2010,
285(30):
22725‐731.
Hépatite C : virus et marqueurs


Etudes de Phase III Présentées à
l’AASLD™ 2010

• SPRINT-2
                                  BOCEPREVIR (BOC)
• RESPOND-2



• ADVANCE
• ILLUMINATE                      TELAPREVIR (TVR)

• REALIZE
Hépatite C : virus et marqueurs


 SPRINT-2—BOC + PegIFN + RBV chez des
 Patients Naïfs de Génotype 1 : Design de l’Etude
                            S4                     S28                   S48               S72



  48 PR          PR
                                             PR + placebo                          Suivi
 n = 363       Lead-in

                                                    ARN-VHC indétectable à S8-24

                                                            Suivi S24
BOC/TGR          PR
                                 PR + boceprevir    ARN-VHC détectable à S8-24
 n = 368       Lead-in
                                                         P/R + placebo             Suivi



BOC/PR48         PR
                                            PR + boceprevir                        Suivi
 n = 366       Lead-in

 *BOC 800 mg q8h; pegIFN alfa-2b 1,5 µg/kg/s; RBV 600-1400 mg/j adaptée au poids.

Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
Hépatite C : virus et marqueurs

SPRINT-2—BOC + PegIFN + RBV chez des
Patients Naïfs de Génotype 1 : Caractéristiques
des Patients
                                                                                Cohorte 1 (caucasiens) [n=938]
                                                                          PR48                  BOC/RGT                  BOC/PR48
                                                                          n=311                  n=316                     n=311
     Sexe masculin [n(%)]                                                171 (55)                 198 (63)                 187 (60)
     Age (années) [moyenne]                                                  48                       49                        49
     IMC (kg/m2) [moyenne (±DS)]                                          27 (±5)                  28 (±5)                  27 (±5)
     ARN du VHC >400,000 UI/mL [n(%)]                                    286 (92)                 287 (91)                 289 (93)
     Type/sous-type du VHC [n(%)]*
                   1a                                                    186 (60)                 196 (62)                 196 (63)
                   1b                                                    112 (36)                 110 (35)                 102 (33)
     Fibrose sévère/Cirrhose
                                                                           22 (7)                   25 (8)                  37 (12)
     (METAVIR F3/F4) [n(%)]
   *La détermination du type et du sous-type a été réalisée par séquençage d’une portion de la région NS5B codant l’ARNpol (méthode de référence)

Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
Hépatite C : virus et marqueurs

SPRINT-2—BOC + PegIFN + RBV chez des
Patients Naïfs de Génotype 1 : RVS et Taux de
Rechute
                                                        p
<0,0001

                                            p
<0,0001
                                                                    Taux de RVS
   Proportion
de
patients
(%)




                                                                    Taux de rechute




Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
Hépatite C : virus et marqueurs

 SPRINT-2—BOC + PegIFN + RBV chez des
 Patients Naïfs de Génotype 1 : RVS et Taux de
 Rechute
                                                         p
<0,0001

                                             p
<0,0001
                                                                     Taux de RVS
    Proportion
de
patients
(%)




                                                                     Taux de rechute




➜ Le BOC améliore significativement les chances de guérison par rapport au SOC
➜ L’adaptation de la durée du traitement à la réponse (TGR) ne semble pas diminuer les
  chances de guérison
 Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
Hépatite C : virus et marqueurs


  ADVANCE—TVR + PegIFN + RBV chez des
  Patients Naïfs de Génotype 1 : Design de l’Etude
                     S8 S12                  S24               S36           S48                                     S72



  PR48        Placebo
                                                    PR                                       Suivi
(n = 361)      + P/R
                                                 eRVR+

                                                             Suivi
 T12PR
(n = 363)    TVR + PR              PR
                                                              PR                              Suivi

                                                 eRVR+

                                                             Suivi
  T8PR                 Pbo
              TVR       +
(n = 364)                          PR
              + PR     PR
                                                              PR                              Suivi
                                                 eRVR-
  *TVR 750 mg q8h; pegIFN alfa-2a 180 µg/s; RBV 1000-1200 mg/j adaptée au poids.
  eRVR : réponse virologique rapide étendue (ARN indétectable à S4 et à S12)
                                                                                   Jacobson
et
al.,
AASLD
2010,
Abstract
211.
Hépatite C : virus et marqueurs

ADVANCE—TVR + PegIFN + RBV chez des
Patients Naïfs de Génotype 1 : Caractéristiques
des Patients
                                                                            T12PR (n = 363)              T8PR (n = 364)              PR (n = 361)
     Sexe masculin [n (%)]                                                        214 (59)                     211 (58)                 211 (58)
     Origine ethnique
          Caucasiens [n (%)]                                                     325 (90)                     315 (87)                 318 (88)
          Afro-Américains                                                         26 (7)                      40 (11)                   28 (8)
          Hispaniques                                                            35 (10)                      44 (12)                   38 (11)
     Âge (années) [médiane (intervalle)]                                        49 (19-69)                   49 (19-68)               49 (18-69)
     IMC (kg/m2) [médiane (intervalle)]                                         26 (18-47)                   26 (17-46)               26 (17-48)
     ARN du VHC > 800 000 UI/ml* [n (%)]                                         281 (77)                     279 (77)                 279 (77)
     Type/sous-type du VHC** [n (%)]
          1a                                                                      213 (59)                     210 (58)                 208 (58)
          1b                                                                      149 (41)                     151 (41)                 151 (42)
          1 non sous-typable                                                       1 (< 1)                      3 (1)                     2 (1)
     Stade de fibrose, n (%)
          Fibrose en ponts                                                         52 (14)                      59 (16)                  52 (14)
          Cirrhose                                                                 21 (6)                       26 (7)                   21 (6)
   *La charge virale (ARN du VHC, UI/ml) a été déterminée par PCR en temps réel (TaqMan® Roche), avec une limite de quantification de 25 UI/mL
   **La détermination du génotype viral a été réalisée par hybridation inverse, INNO-LiPA v1.0


Jacobson
et
al.,
AASLD
2010,
Abstract
211.
Hépatite C : virus et marqueurs


ADVANCE—TVR + PegIFN + RBV chez des
Patients Naïfs de Génotype 1 : RVS
                                             p
<0,0001

                                                         p
<0,0001
  Proportion
de
patients
ayant
     développé
une
RVS
(%)




Jacobson
et
al.,
AASLD
2010,
Abstract
211.
Hépatite C : virus et marqueurs


ADVANCE—TVR + PegIFN + RBV chez des
Patients Naïfs de Génotype 1 : RVS
                                         p
<0,0001

                                                     p
<0,0001
 Proportion
de
patients
ayant
    développé
une
RVS
(%)




   ➜ Le TVR améliore significativement les chances de guérison par rapport à la
     bithérapie standard
   ➜ Le traitement par TVR 8 ou 12 semaines donne des taux de RVS comparables
     (différence NS)
                                                                 Jacobson
et
al.,
AASLD
2010,
Abstract
211.
Hépatite C : virus et marqueurs

  RESPOND-2—BOC + PegIFN + RBV chez des
  Patients en échec Thérapeutique de G1 : Design
  de l’Etude
                             S4                         S28                   S48               S72



  PR48            PR
                                                    PR + placebo                       Suivi
  n = 80        Lead-in

                                                                    ARN-VHC indétectable à S8

                                                                          Suivi S24
 BOC/TGR          PR
                                           PR + boceprevir S32      ARN-VHC détectable à S8
  n = 162       Lead-in
                                                                      PR +
                                                                                       Suivi
                                                                    placebo


BOC/PR48          PR
                                                  PR + boceprevir                      Suivi
 n = 162        Lead-in

  *BOC 800 mg q8h; pegIFN alfa-2b 1,5 µg/kg/s; RBV 600-1400 mg/j adaptée au poids.

 Bacon
et
al.,
AASLD
2010,
Abstract
216.
Hépatite C : virus et marqueurs

RESPOND-2—BOC + PegIFN + RBV chez des
Patients en échec Thérapeutique de G1 : RVS et
Taux de Rechute
                                                      p
<0,0001

                                          p
<0,0001
                                                                                     Taux de RVS
   Proportion
de
patients
(%)




                                                                                     Taux de rechute




                                17/60     8/25        95/162      17/111   107/161   14/121


                                                          Lead‐in
+
                                                      32
BOC/PR
±
PR12


Bacon
et
al.,
AASLD
2010,
Abstract
216.
Hépatite C : virus et marqueurs

RESPOND-2—BOC + PegIFN + RBV chez des
Patients en échec Thérapeutique de G1 : RVS et
Taux de Rechute
                                                      p
<0,0001

                                          p
<0,0001
                                                                                     Taux de RVS
   Proportion
de
patients
(%)




                                                                                     Taux de rechute




                                17/60     8/25        95/162      17/111   107/161   14/121


                                                          Lead‐in
+
                                                      32
BOC/PR
±
PR12
   ➜ Le BOC améliore significativement les chances de guérison par rapport au
     retraitement par SOC
Bacon
et
al.,
AASLD
2010,
Abstract
216.
Hépatite C : virus et marqueurs

RESPOND-2—BOC + PegIFN + RBV chez des
Patients en échec Thérapeutique de G1 : RVS
Selon la Réponse Antérieure

                                                                     Répondeurs partiels
                                                                     RR
   Proportion
de
patients
(%)




                                2/29      15/51   23/57   72/105         30/58     77/103


                                                      Lead‐in
+
                                                  32
BOC/PR
±
PR12


Bacon
et
al.,
AASLD
2010,
Abstract
216.
Hépatite C : virus et marqueurs

RESPOND-2—BOC + PegIFN + RBV chez des
Patients en échec Thérapeutique de G1 : RVS
Selon la Réponse à S4
                                                                p
<0,0001

                                                   p
<0,0001
   Proportion
de
patients
(%)




                                Diminution de l’ARN <1 Log10
                                Diminution de l’ARN ≥1 Log10




                                          17/66         15/46     80/110    15/44   17/66


                                                           Lead‐in
+
                                                       32
BOC/PR
±
PR12
  ➜ Intérêt de la phase de Lead-in comme facteur prédictif de la RVS
Bacon
et
al.,
AASLD
2010,
Abstract
216.
Hépatite C : virus et marqueurs

REALIZE—TVR + PegIFN + RBV chez des
Patients en Echec Thérapeutique de G1 : Design
de l’Etude

                             S4    S8   S12         S16         S48                      S72



 48 PR                      PR + placebo                  PR                     Suivi
n = 130



                                             PR
n = 260                     PR + TVR         (Ll)         PR                     Suivi


                     PR
n = 260
                     (LI)         PR + TVR                PR                     Suivi




*TVR 750 mg q8h; pegIFN alfa-2a 180 µg/s; RBV 1000-1200 mg/j adaptée au poids.

Press
release,
Sept
2010.
Hépatite C : virus et marqueurs


REALIZE—TVR + PegIFN + RBV chez des
Patients en Echec Thérapeutique de G1 : RVS
    Proportion
de
patients




                                       PR48 (n=130)
      ayant
une
RVS
(%)




                                       T12/PR48* (n=520)




                                   *Bras
poolés



Press
release,
Sept
2010.
Hépatite C : virus et marqueurs


TMC435 Administré en Monothérapie chez
des Patients de Génotype 2, 3, 4, 5 et 6
    Diminution
moyenne
de
l’ARN

         du
VHC
(Log
UI/mL)




                                         J3
                                         J7




Manns
et
al.,
AASLD
2010,
Abstract
82.
Nouvelles Hépatite C : virus et marqueurs


   Protéine NS5B: RdRp




Lesburg
et
al.,
Nat
struct
Biol
1999,
6:
937‐943;
Bressanelli
et
al.,
Proc
Natl
Acad
Sci
USA
1999,
96:
13034‐13039;
Ago
et
al.,
Srructure
Fold
Des
1999,
7:
1417‐1426.
Hépatite C : virus et marqueurs


Réplication Virale


  – Modèle du poliovirus
     . Virus à ARN monocaténaire
     de polarité positive
                                                              Réplication




De
Clercq.,
Nature
Review
Drug
Discovery,
2007;
6:
1001‐18

Hépatite C : virus et marqueurs


Variabilité Génétique

• Erreurs au cours de la réplication
     – Fréquentes
           • 10-4-10-4 mutations par nucléotide copié au cours de la réplication du VHC
     – Spontanées
     – Au hasard

• Absence d’activité exonucléasique 3’⇒5’
  ("proofreading")
     – Accumulation de mutations

• A l’origine de :
     – La diversification des types et des sous-types
     – La distribution en quasi-espèces
Hépatite C : virus et marqueurs


Diversification des Génotypes




Simmonds
et
al.,
Hepatology
2005,
42(4):962‐73.

Hépatite C : virus et marqueurs


Distribution des Génotypes



                                                         1a,




Adapted
from
Fang
J.,
et
al.
J.
Clin
Liver
Dis.
1997.

Hépatite C : virus et marqueurs


Distribution en Quasi-espèce




Weiner
et
al.,
Virology
1991;
180:842‐848;
Martell
et
al.,
J
Virol
1992;66:3225‐36.
Hépatite C : virus et marqueurs


Cibles des Molécules Antivirales
                                                                                  Site C (Palm)
    Site A (Thumb/fingertips)                                                      (A-837093)
             (JTK-109)                                                        Mutants: 411, 414, 448
      Mutants: 495, 496, 499



                                                A


                                      B                                   E
                                                                    C
                                                              D

   Site B (Thumb)
      HCV-371                                                                     Site E (Finger, hypothetical)
Mutants: 419, 423, 482                                                                       GS-9190
                                                                                      Mutants: 445,448,452

                                  Site D (Palm)
                                    (HCV796)                                   Site Actif
                                  Mutants: 316                                  (R7128)
                                                                              Mutants: 282
Copyright
©
2006
Merck
&
Co.,
Inc.,
Whitehouse
Station,
New
Jersey,
USA
Hépatite C : virus et marqueurs


Activité Antivirale du MK-0608


                                                           wt S282R/T/I                    wt S282
                                        MK-0608 at 1mg.kg-1 orally
                       7
                       6
 HCV RNA (Log IU/mL)




                       5
                       4
                       3
                       2                                               - 4,6       - 4,1
                                                                                               LOQ
                       1                                                                    (20 IU/mL)
                            TMA + + + +       - - -   -    -     - -     -     +   +
                       0
                       -15 -10 -5   0    5   10 15 20 25 30 35 40 45 50 55 60 65 70
                                                          Days
Hépatite C : virus et marqueurs


    Cycle Viral




Adapted
from
Lindenbach
and
Rice,
Nature
(2005),
436:
933‐938.
Hépatite C : virus et marqueurs


Complexes de Réplication




Moradpour
et
al.,
Nature
Reviews
Microbiology,
2007;
5:
453‐463.
HEPATITE C
Stratégie Diagnostique &
        Suivi Virologique
Stratégie diagnostique & suivi virologique


Marqueurs Virologiques


   Marqueurs indirects
             Anticorps anti-VHC totaux

   Marqueurs directs
            Ag de capside (AgC)

             ARN VHC

             Génotype VHC

            Profil de résistance
Stratégie diagnostique & suivi virologique


Tests Sérologiques

• Détection et quantification de l’Ag de
  capside

• Test “Combo”
     – Détection simultanée de l’Ag de capside et des
       anticorps anti-VHC

• Détection des anticorps anti-VHC à l’aide
  d’une trousse de 3ème génération
Stratégie diagnostique & suivi virologique


Antigène de Capside : un
Marqueur de la Réplication




                                                         r = 0.92; p < 0.0001




Bouvier‐Alias
et
al.,
Hepatology
2002,
36(1):
211‐218.
Stratégie diagnostique & suivi virologique


Performances Analytiques de la
Trousse Architect (Abbott)
• Spécificité
         – 99,2% à 100%

• Sensitivité
         – ≤10 fmol/L (i.e 500 to 3 000 UI/mL d’ARN VHC)
         – Tous les génotypes (excepté génotype 2)

• Intervalle de quantification
         – 10 à 20 000 fmol/L (≤ 7,8 Log10 UI/mL d’ARN
           VHC)

• Stable à 37°C pendant 96 heures
Ross
et
al.,
J
Clin
Micribiol
2010,
48(4):
1161‐8;
Mederacke
et
al.,
J
Clin
Virol
2009,
46(3):
210‐5;
Miedouge
et
al.,
J
Clin
Virol
2010,
48(1):18‐21.
Stratégie diagnostique & suivi virologique


Trousse Architect : Monitoring
des Cinétiques Virales
                      RVR (G1b)                       SVR (G1b)




                      Relapser (G1b)                  NR (G1a)




                                                                  Core Ag
                                                                  RNA
Ross
et
al.,
J
Clin
Microbiol

2010,
48(4):
1161‐8.
Stratégie diagnostique & suivi virologique


Intérêts Cliniques de la
Quantification de l’AgC
• Diagnostic de l’infection
      – Trousses commerciales
      – Facile à utiliser, automatisée, peu couteux (20% par
        rapport à une charge virale VHC)


• Décision de traiter et suivi de l’efficacité des
  traitements antiviraux
      – Quantitatif (≤20,000 fmol/L*)
      – Alternative aux techniques de détection quantification
        de l’ARN du VHC
(*Abbott Architect HCV Ag Assay)
Stratégie diagnostique & suivi virologique


 Tests Virologiques Moléculaires

           Tests qualitatifs                         Tests quantitatifs
              Très sensibles                     Seuil de détection ≥ qualitatifs
               (≤ 50 IU/mL)
                                              Quelle quantité est présente ?
Est-ce que le VHC est présent ?




            Détermination                       Détection de la résistance
            du Génotype


Quel est le génotype du virus ?               Quel type de VHC est présent ?
Stratégie diagnostique & suivi virologique


 Tests Virologiques Moléculaires

                                Tests Qualitatifs-Quantitatifs


             Est-ce que le VHC est présent et en quelle quantité ?




            Détermination                            Détection de la résistance
            du Génotype


Quel est le génotype du virus ?                   Quel type de VHC est présent ?
Stratégie diagnostique & suivi virologique


    Intervalle de Quantification
                    10          102          103   104   105   106   107   108
Cobas Amplicor
HCV Monitor v2.0


SuperQuant


LCx HCV RNA
Assay

Versant HCV RNA
3.0 (bDNA)
Stratégie diagnostique & suivi virologique

Avantages Techniques de la PCR
en Temps Réel
   - Diminution du risque de contamination

   - Amélioration de la sensibilité

   - Augmentation de l’intervalle de
     quantification linéaire

   - Amélioration précision et reproductibilité

   - Augmentation de débit à travers
     l’automatisation
Stratégie diagnostique & suivi virologique


     Intervalle de Quantification
                       10        102          103   104   105   106   107   108
Cobas Amplicor
HCV Monitor v2.0


SuperQuant


LCx HCV RNA
Assay

Versant HCV RNA
3.0 (bDNA)

TaqMan 48 HCV
(Roche)

HCV Quant ASR
(Abbott)

Versant HCV RNA
1.0 (kPCR, Siemens)*

Artus HCV QS-RGQ
(Qiagen)*
*in development
Stratégie diagnostique & suivi virologique


Plates-formes
                                             CAP-CTM96 (ROCHE)




                                                    kPCR (SIEMENS)


         m2000SP-m2000RT (ABBOTT)
Stratégie diagnostique & suivi virologique

Avantages Cliniques de la PCR
en Temps Réel

   • Remplace les techniques qualitatives de
     détection de l’ARN VHC

   • Quantifie l’ensemble des charges virales
     observées en pratique clinique
         – Charges élevées préthérapeutiques
         – Faibles charges virales au cours du traitement

   • Surveille efficacement les cinétiques
     virales (évaluation précoce des réponses
     virologiques au traitement)
Stratégie diagnostique & suivi virologique


Quantification ARN du VHC
(CTM, Roche)
                                                               8
                    HCV RNA level in CAP/CTM48 (Log10 IU/mL)


                                                               7


                                                                                                                 Genotype 1 (n=29)
                                                               6
                                                                                                                 Genotype 2 (n=27)
                                                                                                                 Genotype 3 (n=29)
                                                               5
                                                                                                                 Genotype 4 (n=30)
                                                                                                                 Genotype 5 (n=9)
                                                               4                                                 Genotype 6 (n=2)

                                                                                         r = 0.889; p < 0.0001
                                                               3
                                                                    3     4          5        6       7      8
                                                                   HCV RNA level in Versant HCV 3.0 Assay bDNA
                                                                                   (Log10 IU/mL)
Chevaliez
et
al.,
2007;
Hepatology,
46(1):
22‐31.
Stratégie diagnostique & suivi virologique

Absence de Détection de l’ARN Viral de
patients Fortement Virémiques Infectés par
un Génotype 4
                               (Log10 IU/mL)            CAP/CTM96   m2000SP/m2000RT   Versant 3.0
                               Patient 1 (4h)             <1.08           5.4               5.0
                               Patient 2 (4l)             <1.08           6.0               5.7




                80        90        100       110       120       130       140      150       160       170       180
                |.........|.........|.........|.........|.........|.........|.........|.........|.........|.........|
F_7157    (4a): TAGCCATGGCGTTAGTATGAGTGTTGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATCGCCGG
Patient 1 (4h): ...........................A.....................................A...................T...............
Patient 2 (4l): ...........................A.....................................A...................T...............



                        190       200        210       220        230       240       250       260        270
                .........|.........|......-...|.........| .........|.........|.........|.........| .........|........
F_7157    (4a): GATGACCGGGTCCTTTCTTGGATTAA-CCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCC
Patient 1 (4h): ......................A.T.A..........................................................................
Patient 2 (4l): .......................C..-.......................................................C.......T..........



               280       290       300       310       320      330       340
                |.........|.........|.........|.........|.........|.........|.
F_7157    (4a): TTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACC
Patient 1 (4h): .............................................................
Patient 2 (4l): .............................................................


Chevaliez
et
al.,
2008;
Hepatology,
49(4):
1397‐1398.
Stratégie diagnostique & suivi virologique

Quantification de Transcrits d’ARN Sauvages ou
Mutés en Position 145 et/ou 165


                                                   Measured HCV RNA levels (Log10 IU/mL)

               HCV 5’NC sequence                   Real-time PCR assays     bDNA assay

                                                     CTM        m2000       Versant 3.0

               Wild-type (G145 and
                                                   5.73±0.13   6.05±0.10     6.43±0.01
               A165)
               Single mutant (G145A and
                                                   4.02±0.13   6.00±0.11     6.69±0.02
               A165)
               Single mutant (G145 and
                                                   4.28±0.35   5.88±0.20     6.30±0.02
               A165T)
               Double mutant (G145A
                                                    <1.08*     5.95±0.25     6.60±0.18
               and A165T)
               *Target not detected


Chevaliez
et
al.,
Hepatology,
2009,
50(5):
1681.
Stratégie diagnostique & suivi virologique


Quantification ARN du VHC
(m2000, Abbott)
                    HCV RNA level in m2000SP/m2000RT (Log10 IU/mL)
                                                                     8



                                                                     7


                                                                                                                       Genotype 1 (n=55)
                                                                     6
                                                                                                                       Genotype 2 (n=21)
                                                                                                                       Genotype 3 (n=29)
                                                                     5
                                                                                                                       Genotype 4 (n=24)
                                                                                                                       Genotype 5 (n=9)
                                                                     4                                                 Genotype 6 (n=3)

                                                                                               r = 0.972; p < 0.0001
                                                                     3
                                                                         3      4          5        6      7       8
                                                                         HCV RNA level in Versant HCV 3.0 Assay bDNA
                                                                                         (Log10 IU/mL)
Chevaliez
et
al.,
J
Clin
Microbiol,
2009,47(6):1726‐32.
Stratégie diagnostique & suivi virologique


Quantification ARN du VHC
(kPCR, Siemens)




                                                                           132 clinical samples




David
Sherman.,
Molecular
Symposium,
September
2007
(source:
Siemens
Medical
Solutions
Diagnostics).
Stratégie diagnostique & suivi virologique


Résumé

   • En pratique clinique, la quantification
     de l’ARN du VHC doit être réalisée à
     l’aide d’une technique de PCR en
     temps réel
         – Avec une limite de détection de l’ordre de
           10 à 15 UI/mL
Stratégie diagnostique & suivi virologique


Génotypes du VHC




Simmonds
et
al.
Hepatology
2005.

Stratégie diagnostique & suivi virologique


Répartition des Génotypes



                                                          1a,




Adapted
from
Fang
J.,
et
al.
J.
Clin
Liver
Dis.,
1997.

Stratégie diagnostique & suivi virologique


Détermination du Génotype
    • Méthodes moléculaires (genotyping)
            – Analyse de la séquence après séquençage direct
            – Hybridation inverse des produits d’amplification sur
              des supports solides comportant des sondes
              génotype sépcifique : Line Probe Assay (INNO-LiPA
              HCV, Innogenetics)
            – PCR en temps réel à l’aide d’amorces et de sondes
              génotype spécifique


    • Méthodes sérologiques (“serotyping”)
            – ELISA compétitif

Arens et al., J Clin Virol, 2001; 22:11-29; Davidson et al., J Gen Virol 1995; 76: 1197-204; Lareu et al., 1997; Le Pogam et al., 1998; J Clin
Microbiol; 36: 1461-3; Ilina et al., J Clin Miocrobiol, 2005; 43(6): 2810-15.
Stratégie diagnostique & suivi virologique


Détermination du Génotype
    • Méthodes moléculaires (genotyping)
             – Analyse de la séquence après séquençage direct
             – Hybridation inverse des produits d’amplification sur
               des supports solides comportant des sondes
               génotype sépcifique : Line Probe Assay (INNO-LiPA
               HCV, Innogenetics)
             – PCR en temps réel à l’aide d’amorces et de sondes
               génotype spécifique


    • Méthodes sérologiques (“serotyping”)
             – ELISA compétitif

Arens
et
al.,
J
Clin
Virol,
2001;
22:11‐29;
Davidson
et
al.,
J
Gen
Virol
1995;
76:
1197‐204;
Lareu
et
al.,
1997;
Le
Pogam
et
al.,
1998;
J
Clin
Microbiol;
36:
1461‐3;
Ilina
et
al.,
J
Clin
Miocrobiol,
2005;
43(6):
2810‐15.
Stratégie diagnostique & suivi virologique


Versant® HCV Genotype 2.0
Assay (INNO-LiPA)
Stratégie diagnostique & suivi virologique


Intérêt de la Détermination du
Sous-Type ?
   • Direct Acting Antivirals (DAAs) pourraient
     avoir des efficacités antivirales différentes
     selon les sous-types de VHC de génotype 1
     in vitro et in vivo

   • Le traitement par DAAs pourrait être associé
     à des profiles de résistance différents selon
     les sous-types de VHV de génotype 1 in vitro
     et in vivo
Stratégie diagnostique & suivi virologique


Profils de Résistance du BMS-
70052, in vitro
Substitution amino                                                                  Niveau de
                                                         EC50 fold-change
acidique                                                                          Replication (%)
Génotype 1b
L31F/V                                                                5-23            146±44
P32L                                                                   17              18±6
Y93H/N                                                                19-28           20 ±7
Génotype 1a
M28T                                                                   683            31±23
Q30E/H/R                                                           1 450-24 933       130±56
L31M/V                                                              350-3 350         117±29
P32L                                                                   233             18±5
Y93C/H/N                                                           1 850-47 017       18±11
Fridell
et
al.
Antimicrob
Agents
Chemother.
2010;
54(9):
3641‐50
Stratégie diagnostique & suivi virologique


Profils de Résistance du Telaprevir
(PROVE-2 trial), in vivo
                                                      Génotype 1a                                            Génotype 1b

              Pt-1                   Pt-2                   Pt-3                    Pt-4                    Pt-5     Pt-6
                                   R26K
                                 V36L/M                                            V36A                     V36A
                                                          T42S
             A40T                  A40T
                                   T54S                                                                     T54S     T54A
                                                                                                                     Y56F
             T91A
           R155K                  R155K               R155K/E                  R155T/A
           G174S
Chevaliez
et
al.
International
HIV&HEPATITIS
VIRUS
Drug
Resistance
Workshop
and
Curative
Strategies
2010.
Stratégie diagnostique & suivi virologique


Détermination du Sous-Type par
une Méthode de Référence*




        *HCV genotype determination by means of phylogenetic analysis of a
        portion of the gene encoding the NS5B region was used as the reference
        method


Chevaliez
et
al.,
PLoS
One
2009,
4(12):
e820.
Stratégie diagnostique & suivi virologique


 Détermination du Sous-Type


                                                 1st Generation of Line   2nd Generation of Line
                  Sequence Analysis of                                                             RealTime HCV
                                                      Probe Assay              Probe Assay
                       the 5’NCR                                                                    Genotype II
                                                       (LiPA 1.0)               (LiPA 2.0)




 GT 1a                        77.6%                      70.5%                    97.5%               93.2%
(n=237)                      (n=184)                    (n=167)                  (n=231)             (n=220)


 GT 1b                        90.5%                      91.3%                    96.2%               88.6%
(n=263)                      (n=238)                    (n=240)                  (n=253)             (n=233)




 Chevaliez
et
al.,
PLoS
One
2009,
4(12):
e820.
Stratégie diagnostique & suivi virologique


Résumé

- Dans les essais cliniques évaluant les DAAs et
  probablement en pratique clinique, le détermination du
  sous-type des souches de génotype 1 est nécessaire
  pour la stratification et l’interprétation des profils de
  résistance
- La détermination du génotype sur la seule région 5’NC
  doit être proscrite
- La 2nd génération de Line Probe Assay qui utilise des
  sondes dirigées contre la région core en plus de la
  région 5’NC est la meilleure méthode permettant de
  distinguer les sous-types 1a et 1b
Stratégie diagnostique & suivi virologique


IL28B “Single Nucleotide
Polymorphism” (SNP)
                                  En amont du géne de l’IL28B, codant l’IFN-λ3




                                                  rs12979860




  Ge
et
al.,
Nature
2009;
461:
399‐401.
Stratégie diagnostique & suivi virologique


RVS à la Bithérapie Standard en
Fonction du Génotype IL28B
  Réponse virologique soutenue (%)




                                     Caucasians    African-Americans   Hispanics   Combined
                                      (n=1171)           (n=300)        (n=116)     (n=1587)

                                        12                    14
                                             37%        37%              22% 29%

                                       51%                    49%         48%


  Thompson
et
al.,
Gastroenterology
2010;
139(1):
120‐129.
Stratégie diagnostique & suivi virologique


Résumé
- En pratique clinique, SNPs en amont du gène de
  l’IL28B (rs12979860 et rs8099917) sont les facteurs
  prédictifs les plus robustes de la RVS à la bithérapie

- Cependant, leur valeur prédictive à l’échelon
  individuel n’est pas suffisante pour la prise en compte
  dans les décisions thérapeutiques

- La détermination du génotype IL28B en association à
  d’autre paramètres, comme la réponse virologique à
  S4, pourrait être utile pour adapter le traitement,
  éventuellement des patients sous triple combinaison


  Ge
et
al.,
Nature
2009;
461:
399‐401;
Tanaka
et
al.,
Nat
Genet
2009;
41(10):
1105‐9;
Afdhal
et
al,
Hepatology
in
press.
Stratégie diagnostique & suivi virologique


Intérêts des Tests Virologiques
en Thérapeutique
  • Décision de traiter


  • Optimisation du schéma
    thérapeutique


  • Etude de la réponse virologique au
    traitement

Consensus
conference:
treatment
of
hepatitis
C;
2002,
Gastroenterol
Clin
Biol,
26(2):
B303‐20
Stratégie diagnostique & suivi virologique


Traitement de l’Hépatite
Chronique C
• Traitement standard
     – Interféron pégylé alpha-2a or alpha-2b et
       ribavirine à doses fixe ou adaptée au poids

• Durée de traitement
     – 16 à 72 semaines en fonction du génotype et
       de la réponse virologique
Stratégie diagnostique & suivi virologique


Intérêts de la Détermination du
Génotype

   • Détermination systématique du
     génotype
         – Facteur prédictif de la réponse au
           traitement
         – Conditionne
               . La dose de ribavirine
               . La durée du traitement
Stratégie diagnostique & suivi virologique


    Dose de Ribavirine
             Proportion
de
patients
avec
RVS
(%)

                                                        Ribavirine
0,8
g/j
                                                        Ribavirin
1,0
–
1,2
g/j




Hadziyannis et al., Ann Intern Med 2004;140: 346-355.
Stratégie diagnostique & suivi virologique


    Durée de Traitement
              Proportion
de
patients
avec
RVS
(%)

                                                        24
semaines
                                                        48
semaines




Hadziyannis
et
al.,
Ann
Intern
Med
2004;140:
346‐355.
Stratégie diagnostique & suivi virologique


Intérêts de la Détection -
Quantification de l’ARN VHC

  • Evaluation de la réplication virale chez des
    patients anticorps anti-VHC positifs

  • Evaluation de la réponse virologique au
    cours du traitement pegIFN - RBV
         –   Réponse virologique rapide (semaine 4)
         –   Réponse virologique précoce (semaine 12)
         –   Réponse fin de traitement (EoT)
         –   Réponse virologique soutenue (semaine 24 post-Rx)
Stratégie diagnostique & suivi virologique


    Réponses au Traitement en
    Fonction des Cinétiques Virales

                                                   SOC
                          +1

                          0
HCV RNA reduction from
 baseline (Log10 IU/mL)




                          -1

                          -2
                                                                Diminution ≥ 2 Log
                          -3

                          -4

                          -5
                                                                Detection cut-off
                          -6                                     (10-15 IU/mL)


                               0     4                 8   12
                                            Semaines
Stratégie diagnostique & suivi virologique


Réponse Virologique Précoce :
Facteur Prédictif de la RVS


     EoT
     RVS
     Rechute




                                          Diminution >2 Log ou    Diminution <2 Log à S12
                                         ARN indétectable à S12



Adapted
from
Ferenci
et
al.,
J
Hepatol
2005,
43:
425‐433.
Stratégie diagnostique & suivi virologique


    Réponses au Traitement en
    Fonction des Cinétiques Virales

                                                        SOC
                          +1

                          0
HCV RNA reduction from
 baseline (Log10 IU/mL)




                          -1

                          -2                                                 Diminution ≥ 2 Log

                          -3

                          -4
                                                                           Slow VR
                          -5           RVR
                                                                RVP          Detection cut-off
                          -6                                                  (10-15 IU/mL)


                               0   2         4              8         12
                                                 Semaines
Stratégie diagnostique & suivi virologique


 Taux de RVS
                                                                                  ViraferonPeg 1.5µg/kg/w + RBV 1000-1400 mg/d
                                                                                  ViraferonPeg 1.0µg/kg/w + RBV 1000-1400 mg/d
                                                                                  PegIFN alpha-2a 180µg/w + RBV 1000-1200 mg/d
SVR




                                                                                                                        542/1019




                                                                                                                                              667/1035


                                                                                                                                                         406/1019

                                                                                                                                                                    386/1016
                                                                                                                                   500/1016




                                                                                                                                                                               423/1035
                                                              227/300

                                                                        234/292

                                                                                   250/355


                                                                                             68/156




                                                                                                               72/203
                                                                                                      77/157
                   38/42




                                            33/41

                                                    62/83
           43/45




                           37/44


                                    64/72




                                            Week to first undetectable HCV RNA
                           Semaines avec un ARN du VHC indétectable
 McHutchinson
et
al.,
New
Engl
J
Med
2009,
361(6):
580‐593.
Stratégie diagnostique & suivi virologique


 Longer Treatment Duration
                                 Genotype 1, Slow virological responders
                             >2 Log drop at week 12, but detectable HCV RNA

                                                                                                               48 weeks
                                                                                                               72 weeks
       Rate of SVR (%)




                                                                                     p=0.040




                                34/51     27/35     104/130 90/119   78/179 94/190   17/100 31/106   121/230121/225




                              HCV RNA <50 IU/mL                         HCV RNA >50 IU/mL
Berg
et
al.,
Gastroenterology
2006,
130:
1086‐97.
Stratégie diagnostique & suivi virologique


 Longer Treatment Duration
                                Genotype 1 and 4, Slow virological responders
                               >2 Log drop at week 12, but detectable HCV RNA

                                                                                  48 weeks
                                                                                  72 weeks
         Rate of relapse (%)




                                                                         p<0.01

                                              p<0.05




                                        16/72          11/81     20/35    9/29




                                     HCV RNA <50 IU/mL         HCV RNA >50 IU/mL


Ferenci
et
al.,
Gastroenterology
2010,
138:
503‐512.
Stratégie diagnostique & suivi virologique


Shorter Treatment Duration

• A recent meta-analysis suggested that
         – In patients infected with HCV genotype 1 with
           an RVR, 24 weeks of therapy with SOC
           should be considered only in subjects with
           low baseline viral loads

         – The optimal cut-off defining low baseline HCV
           RNA level (400,000-800,000 IU/mL) is not
           clearly defined


Moreno
et
al.,
J
Hepatol
2010;
52:
25‐31.



Stratégie diagnostique & suivi virologique


Shorter Treatment Duration
                               Genotype 2 and 3, Rapid virological responders
                                          (<50 IU/mL at week 4)
                                                                                    16
weeks
                                         p<0.001         p<0.001                    24
weeks
       Rate of SVR (%)




                                   375/458 368/405   197/243 115/212   181/215 174/193




Diago
et
al.,
Hepatology.
2010;
51(6):
1897‐903.
Stratégie diagnostique & suivi virologique


Shorter Treatment Duration
                               Genotype 2 and 3, Rapid virological responders
                               with a low baseline viral load (<400,000 IU/mL)
                                                            16
weeks
                                              p=0.20        24
weeks
       Rate of SVR (%)




                                      111/122      95/100




Diago
et
al.,
Hepatology.
2010;
51(6):
1897‐903.
HCV genotype
                               HCV-1 (4,5,6)                                                                                        HCV-2,3
                              RNA quantification


                                   SOC                                                                                              SOC
                                 48 weeks                                                                                       24 weeks
                       Ribavirin (1000-1400 mg.d-1)                                                                        Ribavirin (800 mg.d-1)

                          RNA quantification at W4

                      HCV RNA                     HCV RNA                                                                RNA quantification at W4
                      undetectable                detectable

 Consider                                                                                                           HCV RNA                   HCV RNA
 24 weeks                                   RNA quantification at                                                  undetectable               detectable
of therapy1                                       W12

                                            Decrease ≥ 2 Log                      Decrease ≥ 2 Log
        Decrease < 2 Log
                                           HCV RNA detectable                        HCV RNA
                                                                                    undetectable

                                             Continue Rx until
                                                   W24

                                               If HCV RNA
                                                                                                                      Consider
          Stop antiviral                      undetetectable                                                                                Continue Rx
                                                                                   Continue Rx until                  16 weeks
           treatment                         Continue Rx Until                                                                               until W24
                                                                                         W48                         of therapy2
                                                   W72
1In   patients with a low viral load at baseline (<400,000 IU/mL); 2In patients with a low viral load at baseline (400,000-600,000 IU/mL)
Stratégie diagnostique & suivi virologique


Future HCV Therapy

• Future standard treatment
     – Pegylated interferon alpha-2a or alpha-2b
     – Ribavirin
     – Specific inhibitor of the NS3/4A protease
           . Telaprevir
           . Boceprevir
Stratégie diagnostique & suivi virologique


  ADVANCE Trial
                                              Telaprevir, Naïve, Genotype 1


T12PR                                                                        Follow‐up
                      TVR+PR                   PR




                                                      no
eRVR
N
=
363                                                              PR                  Follow‐up


 T8PR                TVR                                                     Follow‐up
                                              PR

                                                      no
eRVR
N
=
364              +PR                                             PR                  Follow‐up


 PR48                                                PR                                  Follow‐up
N
=
350
                  *eRVR
=
undetectable
HCV
RNA
at
week
4
and
week
12

                0                8 12                24              36        48           60       72
 Jacobson
et
al.,
AASLD
2010,
Abstract
211.                     Weeks
on
therapy
Stratégie diagnostique & suivi virologique


SVR Rates
                                             p
<0.0001
                                                         p
<0.0001
   Proportion
of
Patients
       
with
SVR
(%)




Jacobson
et
al.,
AASLD
2010,
Abstract
211.
Stratégie diagnostique & suivi virologique


   SPRINT-2 Trial
                                               Boceprevir, Naïve, Genotype 1


BOC/RGT                                                            Follow‐up




                                                           VR
                     LI                    BOC+
PR
 N
=
368                                                                 PR         Follow‐up




                                                           no
VR
BOC/PR48             LI                              BOC
+
PR                       Follow‐up
 N
=
366


  PR48                                                PR                            Follow‐up
 N
=
363

                   *VR
=
HCV
RNA
undetectable
between
weeks
8
and
24

                 0         4             12            24 28        36         48      60       72
  Poordad
et
al.,
AASLD
2010,
Abstract
LB‐4.                  Weeks
on
therapy
How to use molecular techniques to optimize management of chronic heptitis C


Taux de RVS
                                             p
<0.0001
                                                             p
<0.0001
  Proportion
of
Patients
      
with
SVR
(%)




Poordad et al., AASLD 2010, Abstract LB-4.
Stratégie diagnostique & suivi virologique


Résumé
- Duration of triple therapy with pegylated IFN,
  ribavirin and a protease inhibitor will be tailored
  to the virological response at week 4 or earlier

- Response-guided therapy is associated with
  high rates of SVR in genotype-1 treatment naïve
  patients

- The ideal time points, frequency, and the
  feasibility in real-life practice need to be further
  evaluated

Contenu connexe

Tendances

Roulot vhd du16
Roulot vhd du16Roulot vhd du16
Roulot vhd du16odeckmyn
 
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...pmasson02
 
Roulo tbis vhd-du16
Roulo tbis vhd-du16Roulo tbis vhd-du16
Roulo tbis vhd-du16odeckmyn
 
L’hépatite virale c chronique 2012
L’hépatite virale c chronique 2012L’hépatite virale c chronique 2012
L’hépatite virale c chronique 2012Fatimazohra Elamrani
 
Polymorphisme des gènes hrpII et pldh chez Plasmodium
Polymorphisme des gènes hrpII et pldh chez PlasmodiumPolymorphisme des gènes hrpII et pldh chez Plasmodium
Polymorphisme des gènes hrpII et pldh chez PlasmodiumInstitut Pasteur de Madagascar
 
Rosmorduc cours diu pitie chc 2012 court
Rosmorduc cours diu pitie chc 2012 courtRosmorduc cours diu pitie chc 2012 court
Rosmorduc cours diu pitie chc 2012 courtodeckmyn
 
Hépatite virale delta Pr arbaoui fac med Tlemcen
Hépatite virale delta Pr arbaoui fac med TlemcenHépatite virale delta Pr arbaoui fac med Tlemcen
Hépatite virale delta Pr arbaoui fac med TlemcenArbaoui Bouzid
 
Lerat bis hép virologie du16
Lerat bis hép virologie du16  Lerat bis hép virologie du16
Lerat bis hép virologie du16 odeckmyn
 
Lerat hép virologie du16
Lerat  hép virologie du16Lerat  hép virologie du16
Lerat hép virologie du16odeckmyn
 
Applications dans l'évaluation de l'impact des interventions dans lutte contr...
Applications dans l'évaluation de l'impact des interventions dans lutte contr...Applications dans l'évaluation de l'impact des interventions dans lutte contr...
Applications dans l'évaluation de l'impact des interventions dans lutte contr...Institut Pasteur de Madagascar
 
Hépatite Delta_Virus et Marqueurs.ppt
Hépatite Delta_Virus et Marqueurs.pptHépatite Delta_Virus et Marqueurs.ppt
Hépatite Delta_Virus et Marqueurs.pptodeckmyn
 
Traitement Hépatite chronique virale C Pr Arbaoui fac med Tlemcen avril 2012
Traitement  Hépatite chronique virale C  Pr Arbaoui fac med Tlemcen avril 2012Traitement  Hépatite chronique virale C  Pr Arbaoui fac med Tlemcen avril 2012
Traitement Hépatite chronique virale C Pr Arbaoui fac med Tlemcen avril 2012Arbaoui Bouzid
 
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCR
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCRDétection des allèles polymorphiques ou des allèles d'antigène variant par PCR
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCRInstitut Pasteur de Madagascar
 
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...Vih.org
 
Anti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.pptAnti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.pptodeckmyn
 
Chevaliez s hcv strat diag+suiv virol2014
Chevaliez s  hcv strat diag+suiv virol2014Chevaliez s  hcv strat diag+suiv virol2014
Chevaliez s hcv strat diag+suiv virol2014odeckmyn
 
Thibault vha vhe- du16
Thibault vha vhe- du16Thibault vha vhe- du16
Thibault vha vhe- du16odeckmyn
 
Zarski jp cyto,av,im 2014
Zarski jp  cyto,av,im 2014Zarski jp  cyto,av,im 2014
Zarski jp cyto,av,im 2014odeckmyn
 
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptodeckmyn
 
Ponction Biopsie Hépatique.ppt
Ponction Biopsie Hépatique.pptPonction Biopsie Hépatique.ppt
Ponction Biopsie Hépatique.pptodeckmyn
 

Tendances (20)

Roulot vhd du16
Roulot vhd du16Roulot vhd du16
Roulot vhd du16
 
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...
Appréciation moléculaire du risque lié à la présence d’E. coli O26:H11 dans l...
 
Roulo tbis vhd-du16
Roulo tbis vhd-du16Roulo tbis vhd-du16
Roulo tbis vhd-du16
 
L’hépatite virale c chronique 2012
L’hépatite virale c chronique 2012L’hépatite virale c chronique 2012
L’hépatite virale c chronique 2012
 
Polymorphisme des gènes hrpII et pldh chez Plasmodium
Polymorphisme des gènes hrpII et pldh chez PlasmodiumPolymorphisme des gènes hrpII et pldh chez Plasmodium
Polymorphisme des gènes hrpII et pldh chez Plasmodium
 
Rosmorduc cours diu pitie chc 2012 court
Rosmorduc cours diu pitie chc 2012 courtRosmorduc cours diu pitie chc 2012 court
Rosmorduc cours diu pitie chc 2012 court
 
Hépatite virale delta Pr arbaoui fac med Tlemcen
Hépatite virale delta Pr arbaoui fac med TlemcenHépatite virale delta Pr arbaoui fac med Tlemcen
Hépatite virale delta Pr arbaoui fac med Tlemcen
 
Lerat bis hép virologie du16
Lerat bis hép virologie du16  Lerat bis hép virologie du16
Lerat bis hép virologie du16
 
Lerat hép virologie du16
Lerat  hép virologie du16Lerat  hép virologie du16
Lerat hép virologie du16
 
Applications dans l'évaluation de l'impact des interventions dans lutte contr...
Applications dans l'évaluation de l'impact des interventions dans lutte contr...Applications dans l'évaluation de l'impact des interventions dans lutte contr...
Applications dans l'évaluation de l'impact des interventions dans lutte contr...
 
Hépatite Delta_Virus et Marqueurs.ppt
Hépatite Delta_Virus et Marqueurs.pptHépatite Delta_Virus et Marqueurs.ppt
Hépatite Delta_Virus et Marqueurs.ppt
 
Traitement Hépatite chronique virale C Pr Arbaoui fac med Tlemcen avril 2012
Traitement  Hépatite chronique virale C  Pr Arbaoui fac med Tlemcen avril 2012Traitement  Hépatite chronique virale C  Pr Arbaoui fac med Tlemcen avril 2012
Traitement Hépatite chronique virale C Pr Arbaoui fac med Tlemcen avril 2012
 
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCR
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCRDétection des allèles polymorphiques ou des allèles d'antigène variant par PCR
Détection des allèles polymorphiques ou des allèles d'antigène variant par PCR
 
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
Le traitement en primo-infection à VIH - Christine Rouzioux - Rencontre du Cr...
 
Anti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.pptAnti viraux et immunomodulateurs.ppt
Anti viraux et immunomodulateurs.ppt
 
Chevaliez s hcv strat diag+suiv virol2014
Chevaliez s  hcv strat diag+suiv virol2014Chevaliez s  hcv strat diag+suiv virol2014
Chevaliez s hcv strat diag+suiv virol2014
 
Thibault vha vhe- du16
Thibault vha vhe- du16Thibault vha vhe- du16
Thibault vha vhe- du16
 
Zarski jp cyto,av,im 2014
Zarski jp  cyto,av,im 2014Zarski jp  cyto,av,im 2014
Zarski jp cyto,av,im 2014
 
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
 
Ponction Biopsie Hépatique.ppt
Ponction Biopsie Hépatique.pptPonction Biopsie Hépatique.ppt
Ponction Biopsie Hépatique.ppt
 

En vedette

Hépatite C Les recommandations de l'EASL
Hépatite C Les recommandations de l'EASLHépatite C Les recommandations de l'EASL
Hépatite C Les recommandations de l'EASLClaude EUGENE
 
Guerir de l'hepatite c 2016
Guerir de l'hepatite c 2016Guerir de l'hepatite c 2016
Guerir de l'hepatite c 2016soshepatites
 
Cacoub p hcv meh 2014 - partie ii
Cacoub p  hcv meh 2014 - partie iiCacoub p  hcv meh 2014 - partie ii
Cacoub p hcv meh 2014 - partie iiodeckmyn
 
Risk Analysis on West Nile Virus in Bangladesh
Risk Analysis on West Nile Virus in BangladeshRisk Analysis on West Nile Virus in Bangladesh
Risk Analysis on West Nile Virus in BangladeshAbu Sayeed
 
L hepatite c sophie-métivier
L hepatite c sophie-métivierL hepatite c sophie-métivier
L hepatite c sophie-métiviersoshepatites
 
Hepatite Conseil 01
Hepatite Conseil 01Hepatite Conseil 01
Hepatite Conseil 01soshepatites
 
March 192015talkforresidents final03232015 (1)
March 192015talkforresidents final03232015 (1)March 192015talkforresidents final03232015 (1)
March 192015talkforresidents final03232015 (1)katejohnpunag
 
Maladies vasculaires du foie
Maladies vasculaires du foieMaladies vasculaires du foie
Maladies vasculaires du foieClaude EUGENE
 
Bilan hépatique (Anomalies biologiques en rapport avec une maladie du foie)
Bilan hépatique (Anomalies biologiques en rapport avec une maladie du foie)Bilan hépatique (Anomalies biologiques en rapport avec une maladie du foie)
Bilan hépatique (Anomalies biologiques en rapport avec une maladie du foie)Claude EUGENE
 
Chronic Hepatitis C WHO Guideline 2016
Chronic Hepatitis C WHO Guideline 2016Chronic Hepatitis C WHO Guideline 2016
Chronic Hepatitis C WHO Guideline 2016Syed Mogni
 
Hepatitis C and its Treatment
Hepatitis C and its TreatmentHepatitis C and its Treatment
Hepatitis C and its TreatmentMoheer07
 

En vedette (14)

Hépatite C Les recommandations de l'EASL
Hépatite C Les recommandations de l'EASLHépatite C Les recommandations de l'EASL
Hépatite C Les recommandations de l'EASL
 
Guerir de l'hepatite c 2016
Guerir de l'hepatite c 2016Guerir de l'hepatite c 2016
Guerir de l'hepatite c 2016
 
Cacoub p hcv meh 2014 - partie ii
Cacoub p  hcv meh 2014 - partie iiCacoub p  hcv meh 2014 - partie ii
Cacoub p hcv meh 2014 - partie ii
 
Hcv
HcvHcv
Hcv
 
Risk Analysis on West Nile Virus in Bangladesh
Risk Analysis on West Nile Virus in BangladeshRisk Analysis on West Nile Virus in Bangladesh
Risk Analysis on West Nile Virus in Bangladesh
 
L hepatite c sophie-métivier
L hepatite c sophie-métivierL hepatite c sophie-métivier
L hepatite c sophie-métivier
 
Hepatite Conseil 01
Hepatite Conseil 01Hepatite Conseil 01
Hepatite Conseil 01
 
March 192015talkforresidents final03232015 (1)
March 192015talkforresidents final03232015 (1)March 192015talkforresidents final03232015 (1)
March 192015talkforresidents final03232015 (1)
 
Treatment of HCV Genotype 4
Treatment of HCV Genotype 4Treatment of HCV Genotype 4
Treatment of HCV Genotype 4
 
Quandrechercherresistancevirologiquetantoninishaim
QuandrechercherresistancevirologiquetantoninishaimQuandrechercherresistancevirologiquetantoninishaim
Quandrechercherresistancevirologiquetantoninishaim
 
Maladies vasculaires du foie
Maladies vasculaires du foieMaladies vasculaires du foie
Maladies vasculaires du foie
 
Bilan hépatique (Anomalies biologiques en rapport avec une maladie du foie)
Bilan hépatique (Anomalies biologiques en rapport avec une maladie du foie)Bilan hépatique (Anomalies biologiques en rapport avec une maladie du foie)
Bilan hépatique (Anomalies biologiques en rapport avec une maladie du foie)
 
Chronic Hepatitis C WHO Guideline 2016
Chronic Hepatitis C WHO Guideline 2016Chronic Hepatitis C WHO Guideline 2016
Chronic Hepatitis C WHO Guideline 2016
 
Hepatitis C and its Treatment
Hepatitis C and its TreatmentHepatitis C and its Treatment
Hepatitis C and its Treatment
 

Similaire à Hépatite C Virus et marqueurs.pdf

Casablanca 2010 - La place des 3e ligne dans les pays du Sud - Serge Eholié
Casablanca 2010 - La place des 3e ligne dans les pays du Sud - Serge EholiéCasablanca 2010 - La place des 3e ligne dans les pays du Sud - Serge Eholié
Casablanca 2010 - La place des 3e ligne dans les pays du Sud - Serge EholiéVih.org
 
Interet de de la charge virale et du génotypage dans la trithérapie copie
Interet de de la charge virale et du génotypage dans la trithérapie   copieInteret de de la charge virale et du génotypage dans la trithérapie   copie
Interet de de la charge virale et du génotypage dans la trithérapie copieFatimazohra Elamrani
 
Impact de la charge virale et du génotype sur la rvs chez les malades traités...
Impact de la charge virale et du génotype sur la rvs chez les malades traités...Impact de la charge virale et du génotype sur la rvs chez les malades traités...
Impact de la charge virale et du génotype sur la rvs chez les malades traités...Fatimazohra Elamrani
 
Casablanca 2010 - VIH: Nouvelles stratégies thérapeutiques - Christine Katlama
Casablanca 2010 - VIH: Nouvelles stratégies thérapeutiques - Christine KatlamaCasablanca 2010 - VIH: Nouvelles stratégies thérapeutiques - Christine Katlama
Casablanca 2010 - VIH: Nouvelles stratégies thérapeutiques - Christine KatlamaVih.org
 
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptodeckmyn
 
Lerat PathogéNèSe
Lerat PathogéNèSeLerat PathogéNèSe
Lerat PathogéNèSeodeckmyn
 
Lerat du2012
Lerat du2012Lerat du2012
Lerat du2012odeckmyn
 
Lerat du hépatites virales 2015
Lerat  du hépatites virales 2015Lerat  du hépatites virales 2015
Lerat du hépatites virales 2015odeckmyn
 
Zarski hépatites virales du16 jpz
Zarski hépatites virales du16 jpzZarski hépatites virales du16 jpz
Zarski hépatites virales du16 jpzodeckmyn
 
Lerat Du Hepatites Virales
Lerat Du Hepatites ViralesLerat Du Hepatites Virales
Lerat Du Hepatites Viralesodeckmyn
 

Similaire à Hépatite C Virus et marqueurs.pdf (11)

Casablanca 2010 - La place des 3e ligne dans les pays du Sud - Serge Eholié
Casablanca 2010 - La place des 3e ligne dans les pays du Sud - Serge EholiéCasablanca 2010 - La place des 3e ligne dans les pays du Sud - Serge Eholié
Casablanca 2010 - La place des 3e ligne dans les pays du Sud - Serge Eholié
 
Interet de de la charge virale et du génotypage dans la trithérapie copie
Interet de de la charge virale et du génotypage dans la trithérapie   copieInteret de de la charge virale et du génotypage dans la trithérapie   copie
Interet de de la charge virale et du génotypage dans la trithérapie copie
 
Impact de la charge virale et du génotype sur la rvs chez les malades traités...
Impact de la charge virale et du génotype sur la rvs chez les malades traités...Impact de la charge virale et du génotype sur la rvs chez les malades traités...
Impact de la charge virale et du génotype sur la rvs chez les malades traités...
 
Casablanca 2010 - VIH: Nouvelles stratégies thérapeutiques - Christine Katlama
Casablanca 2010 - VIH: Nouvelles stratégies thérapeutiques - Christine KatlamaCasablanca 2010 - VIH: Nouvelles stratégies thérapeutiques - Christine Katlama
Casablanca 2010 - VIH: Nouvelles stratégies thérapeutiques - Christine Katlama
 
Pathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.pptPathogenèse des lésions hépatiques du VHC.ppt
Pathogenèse des lésions hépatiques du VHC.ppt
 
Lerat PathogéNèSe
Lerat PathogéNèSeLerat PathogéNèSe
Lerat PathogéNèSe
 
Lerat du2012
Lerat du2012Lerat du2012
Lerat du2012
 
Lerat du hépatites virales 2015
Lerat  du hépatites virales 2015Lerat  du hépatites virales 2015
Lerat du hépatites virales 2015
 
Zarski hépatites virales du16 jpz
Zarski hépatites virales du16 jpzZarski hépatites virales du16 jpz
Zarski hépatites virales du16 jpz
 
Focal segmental glomerulosclerosis and transplantation
Focal segmental glomerulosclerosis and transplantationFocal segmental glomerulosclerosis and transplantation
Focal segmental glomerulosclerosis and transplantation
 
Lerat Du Hepatites Virales
Lerat Du Hepatites ViralesLerat Du Hepatites Virales
Lerat Du Hepatites Virales
 

Plus de odeckmyn

VHC,VHB : femme enceinte et transmission mère-enfant
VHC,VHB : femme enceinte et transmission mère-enfantVHC,VHB : femme enceinte et transmission mère-enfant
VHC,VHB : femme enceinte et transmission mère-enfantodeckmyn
 
Sujets examen DU - 2015
Sujets examen DU - 2015Sujets examen DU - 2015
Sujets examen DU - 2015odeckmyn
 
Examen DU - 2014
Examen DU - 2014 Examen DU - 2014
Examen DU - 2014 odeckmyn
 
Thabut beneferadic16
Thabut beneferadic16Thabut beneferadic16
Thabut beneferadic16odeckmyn
 
Thabut vhc2016duhv
Thabut vhc2016duhvThabut vhc2016duhv
Thabut vhc2016duhvodeckmyn
 
Du 2016 programme v2 a4
Du 2016 programme v2 a4Du 2016 programme v2 a4
Du 2016 programme v2 a4odeckmyn
 
Histoire hcv du 2016
Histoire hcv du 2016Histoire hcv du 2016
Histoire hcv du 2016odeckmyn
 
Du 2016 tp biomarkers
Du 2016 tp biomarkersDu 2016 tp biomarkers
Du 2016 tp biomarkersodeckmyn
 
Zoulim fz traitement vhb du16
Zoulim fz traitement vhb du16 Zoulim fz traitement vhb du16
Zoulim fz traitement vhb du16 odeckmyn
 
Thabut1 vhc tt du16
Thabut1 vhc tt du16Thabut1 vhc tt du16
Thabut1 vhc tt du16odeckmyn
 
Zoulim2 traitement hépatite b 2016 d uv2
Zoulim2  traitement hépatite b 2016 d uv2Zoulim2  traitement hépatite b 2016 d uv2
Zoulim2 traitement hépatite b 2016 d uv2odeckmyn
 
Zoulim vhb du16
Zoulim vhb du16Zoulim vhb du16
Zoulim vhb du16odeckmyn
 
Thabut2 vhc vhb du16
Thabut2 vhc  vhb du16Thabut2 vhc  vhb du16
Thabut2 vhc vhb du16odeckmyn
 
Sos hepatites du16
Sos hepatites du16Sos hepatites du16
Sos hepatites du16odeckmyn
 
Rosmorduc carninogenese du16
Rosmorduc  carninogenese du16Rosmorduc  carninogenese du16
Rosmorduc carninogenese du16odeckmyn
 
Samuel2 hcv lt du16
Samuel2 hcv  lt du16Samuel2 hcv  lt du16
Samuel2 hcv lt du16odeckmyn
 
Samuel1 hbv lt du16
Samuel1 hbv lt du16Samuel1 hbv lt du16
Samuel1 hbv lt du16odeckmyn
 
Rudler hépatites ir du16
Rudler hépatites ir du16Rudler hépatites ir du16
Rudler hépatites ir du16odeckmyn
 
Rudler réinfection vhb du16
Rudler réinfection vhb du16Rudler réinfection vhb du16
Rudler réinfection vhb du16odeckmyn
 
Pawlotzky hcv resistances.pptx du16
Pawlotzky hcv resistances.pptx du16Pawlotzky hcv resistances.pptx du16
Pawlotzky hcv resistances.pptx du16odeckmyn
 

Plus de odeckmyn (20)

VHC,VHB : femme enceinte et transmission mère-enfant
VHC,VHB : femme enceinte et transmission mère-enfantVHC,VHB : femme enceinte et transmission mère-enfant
VHC,VHB : femme enceinte et transmission mère-enfant
 
Sujets examen DU - 2015
Sujets examen DU - 2015Sujets examen DU - 2015
Sujets examen DU - 2015
 
Examen DU - 2014
Examen DU - 2014 Examen DU - 2014
Examen DU - 2014
 
Thabut beneferadic16
Thabut beneferadic16Thabut beneferadic16
Thabut beneferadic16
 
Thabut vhc2016duhv
Thabut vhc2016duhvThabut vhc2016duhv
Thabut vhc2016duhv
 
Du 2016 programme v2 a4
Du 2016 programme v2 a4Du 2016 programme v2 a4
Du 2016 programme v2 a4
 
Histoire hcv du 2016
Histoire hcv du 2016Histoire hcv du 2016
Histoire hcv du 2016
 
Du 2016 tp biomarkers
Du 2016 tp biomarkersDu 2016 tp biomarkers
Du 2016 tp biomarkers
 
Zoulim fz traitement vhb du16
Zoulim fz traitement vhb du16 Zoulim fz traitement vhb du16
Zoulim fz traitement vhb du16
 
Thabut1 vhc tt du16
Thabut1 vhc tt du16Thabut1 vhc tt du16
Thabut1 vhc tt du16
 
Zoulim2 traitement hépatite b 2016 d uv2
Zoulim2  traitement hépatite b 2016 d uv2Zoulim2  traitement hépatite b 2016 d uv2
Zoulim2 traitement hépatite b 2016 d uv2
 
Zoulim vhb du16
Zoulim vhb du16Zoulim vhb du16
Zoulim vhb du16
 
Thabut2 vhc vhb du16
Thabut2 vhc  vhb du16Thabut2 vhc  vhb du16
Thabut2 vhc vhb du16
 
Sos hepatites du16
Sos hepatites du16Sos hepatites du16
Sos hepatites du16
 
Rosmorduc carninogenese du16
Rosmorduc  carninogenese du16Rosmorduc  carninogenese du16
Rosmorduc carninogenese du16
 
Samuel2 hcv lt du16
Samuel2 hcv  lt du16Samuel2 hcv  lt du16
Samuel2 hcv lt du16
 
Samuel1 hbv lt du16
Samuel1 hbv lt du16Samuel1 hbv lt du16
Samuel1 hbv lt du16
 
Rudler hépatites ir du16
Rudler hépatites ir du16Rudler hépatites ir du16
Rudler hépatites ir du16
 
Rudler réinfection vhb du16
Rudler réinfection vhb du16Rudler réinfection vhb du16
Rudler réinfection vhb du16
 
Pawlotzky hcv resistances.pptx du16
Pawlotzky hcv resistances.pptx du16Pawlotzky hcv resistances.pptx du16
Pawlotzky hcv resistances.pptx du16
 

Hépatite C Virus et marqueurs.pdf

  • 1. HEPATITE C Virus & Marqueurs Stéphane Chevaliez Centre National de Référence Des Hépatites B, C et delta Laboratoire de Virologie & INSERM U955 Hôpital Henri Mondor Université Paris-Est Créteil
  • 2. Hépatite C : virus et marqueurs Virus de l’Hépatite C • Découvert par Houghton en 1989 • 1ère cause d’hépatite chronique et de cirrhose en Europe et en Amérique du Nord • 1ère indication de transplantation hépatique dans les pays industrialisés Afdhal,
NH.
2004;
Sem
Liv
Dis,
24(Supp
2):
3‐8
  • 3. Hépatite C : virus et marqueurs Virus de l’Hépatite C • Famille : Flaviviridae • Genre : Hepacivirus Phylogénie de la région codant la protéine NS5B Adapted
from
Simmonds
et
al.,
1999;
2001.
  • 4. Hépatite C : virus et marqueurs Virus de l’Hépatite C • Famille : Flaviviridae • Genre : Hepacivirus • Hôte naturel : Homme • Tropisme : Hépatocyte
  • 5. Hépatite C : virus et marqueurs Organisation Structurale
  • 6. Hépatite C : virus et marqueurs Organisation Génomique des Flaviviridae 0 1800 3600 5400 7200 9000 10800 Hepatitis
C
virus 5’UTR 3’UTR C E1 E2 NS2 NS3 NS4B NS5A NS5B p7 4A Pestivirus 5’UTR 3’UTR C E0 E1 E2 NS2 NS3 NS4B NS5A NS5B Npro 4A p7 Yellow
fever
virus 5’UTR 3’UTR prM Cap C E NS1 2A 2B NS3 NS4A 4B NS5
  • 7. Hépatite C : virus et marqueurs Organisation Génomique Protéines structurales Protéines non structurales Popescu
and
Dubuisson,
Bio.
Cell
2010,
102(1):
63‐74.
  • 8. Hépatite C : virus et marqueurs Organisation Génomique Bartenschlager
et
al,
Trends
Microbiol,
in
press.
  • 9. Hépatite C : virus et marqueurs IRES et Traduction From
Department
of
Structural
Biology,
Stanford
University
Medical
School,
USA.
  • 10. Hépatite C : virus et marqueurs Réseaux d’Interactions Park
et
al,
BMC
Bioinformatics
2010,
11(Suppl
1):
S23.
  • 11. Hépatite C : virus et marqueurs Protéine de Capside Boulant
et
al,
J
Virol
2005,
79(17):
11353‐11365.
  • 13. Hépatite C : virus et marqueurs Capside et Lipides Bartenschalger
et
al.,
Tends
Microbiol,
in
press.
  • 14. Hépatite C : virus et marqueurs Interaction entre la Capside et DGAT-1 *Diacylglycérol diacyltransférase-1 Herker
et
al.,
Nat
Med
2010,
16(11):
1295‐1298.
  • 15. Hépatite C : virus et marqueurs Glycoprotéine E2 • Hétérodimère avec E1 • Régions hypervariables – HVR1 – HVR2 – igVR • Rôles – HVR2 et igVR indispensables au “folding“ E1-E2 – Étapes précoces (interaction avec CD81, peptide de fusion) Krey
et
al.,
PLoS
Pathog.
2010,
6(2):
e1000762;
McCaffrey
et
al.,
J
Gen
Virol
2011,
92:
112‐121.
  • 16. Hépatite C : virus et marqueurs Étape Précoce : Entrée du VHC Popescu
et
al.,
Bio
Cell
2010,
102:
63‐74.
  • 17. Hépatite C : virus et marqueurs HVR1 Région HVR1 (27 amino-acides)  80% de divergence nucléotidique entre génotypes  Epitope majeur de neutralisation Timm
et
al.,
World
J
Gastroenterol
2007;
13(36)4808‐4817.

  • 18. Hépatite C : virus et marqueurs Transmission du VHC
  • 19. Hépatite C : virus et marqueurs Analyse Phylogénique 4a_ED43 Patient 7 Patient 4 Patient 8 1b_AWV2C33 Patient 6 1a_HCT18X5 Région HVR1 (81 nt) 3a_CB CLUSTALX 2a_Q2B DNADist (PHYLIP 3.5) 1a_HCT27X5 Matrice de distance: Kimura 2-parameter (Ts/Tv=2) S1 (6/05) Neighbor-Joining Patient 3 (01/05) Bootstraping : 1000 replicates NJPlot S2 (6/05) S3 (6/05) S4 (6/05) Patient 3 (7/04) Patient 2 (9/04) Patient 2 (7/04) 100 Patient 3 (9/05) Patient 3 (7/05) S5 (7/05) 1b_HVR3812 5a_SA13 Patient 1 (7/04) 2b_JFH1 Surfaces inertes 6a_33 Séroconversion VHC 0.2 Patients VHC chroniques Girou
et
al.,
Clin
Infect
Disease
2008,
47(5):
627‐633.
  • 20. Hépatite C : virus et marqueurs Protéine p7 • Viroporine dont la structure 3D a été récemment déterminée par ME • Rôle(s) in vivo ? • Cible thérapeutique potentielle Luik
et
al.,
Proc
Natl
Acad
Sci
2009,
4;106(31):
12712‐6;
Griffin
S,
Proc
Natl
Acad
Sci
2009,
106(31):
12567‐68.
  • 21. Hépatite C : virus et marqueurs Activité Antivirale du BIT225 • IC50 de 314 nM dans le modèle du BVDV • Activité synergique Luscombe
et
al.,
Antiviral
Res
2010
May;86(2):144‐53.
  • 22. Hépatite C : virus et marqueurs Protéine NS2 • NS2 (région N-ter) – Rôle dans l’organisation de la formation des nucléocapsides • NS2pro (région C-ter) Jirasko
et
al.,
PLoS
pathog
2010
Dec
16;6(12):
e1001233;
Ivo
et
al.,
Nature
2006,
442:
831‐835.
  • 23. Hépatite C : virus et marqueurs Protéine NS3-4A Raney
et
al.,
J
Biol
Chem
2010,
285(30):
22725‐731.
  • 24. Hépatite C : Nouvelles Hepatite C : virus et marqueurs Inhibition de la Production d’IFN par NS3
  • 25. Hépatite C : virus et marqueurs Protéase NS3 Raney
et
al.,
J
Biol
Chem
2010,
285(30):
22725‐731.
  • 26. Hépatite C : virus et marqueurs Etudes de Phase III Présentées à l’AASLD™ 2010 • SPRINT-2 BOCEPREVIR (BOC) • RESPOND-2 • ADVANCE • ILLUMINATE TELAPREVIR (TVR) • REALIZE
  • 27. Hépatite C : virus et marqueurs SPRINT-2—BOC + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : Design de l’Etude S4 S28 S48 S72 48 PR PR PR + placebo Suivi n = 363 Lead-in ARN-VHC indétectable à S8-24 Suivi S24 BOC/TGR PR PR + boceprevir ARN-VHC détectable à S8-24 n = 368 Lead-in P/R + placebo Suivi BOC/PR48 PR PR + boceprevir Suivi n = 366 Lead-in *BOC 800 mg q8h; pegIFN alfa-2b 1,5 µg/kg/s; RBV 600-1400 mg/j adaptée au poids. Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
  • 28. Hépatite C : virus et marqueurs SPRINT-2—BOC + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : Caractéristiques des Patients Cohorte 1 (caucasiens) [n=938] PR48 BOC/RGT BOC/PR48 n=311 n=316 n=311 Sexe masculin [n(%)] 171 (55) 198 (63) 187 (60) Age (années) [moyenne] 48 49 49 IMC (kg/m2) [moyenne (±DS)] 27 (±5) 28 (±5) 27 (±5) ARN du VHC >400,000 UI/mL [n(%)] 286 (92) 287 (91) 289 (93) Type/sous-type du VHC [n(%)]* 1a 186 (60) 196 (62) 196 (63) 1b 112 (36) 110 (35) 102 (33) Fibrose sévère/Cirrhose 22 (7) 25 (8) 37 (12) (METAVIR F3/F4) [n(%)] *La détermination du type et du sous-type a été réalisée par séquençage d’une portion de la région NS5B codant l’ARNpol (méthode de référence) Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
  • 29. Hépatite C : virus et marqueurs SPRINT-2—BOC + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : RVS et Taux de Rechute p
<0,0001 p
<0,0001 Taux de RVS Proportion
de
patients
(%) Taux de rechute Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
  • 30. Hépatite C : virus et marqueurs SPRINT-2—BOC + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : RVS et Taux de Rechute p
<0,0001 p
<0,0001 Taux de RVS Proportion
de
patients
(%) Taux de rechute ➜ Le BOC améliore significativement les chances de guérison par rapport au SOC ➜ L’adaptation de la durée du traitement à la réponse (TGR) ne semble pas diminuer les chances de guérison Poordad
et
al.,
AASLD
2010,
Abstract
LB4.
  • 31. Hépatite C : virus et marqueurs ADVANCE—TVR + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : Design de l’Etude S8 S12 S24 S36 S48 S72 PR48 Placebo PR Suivi (n = 361) + P/R eRVR+ Suivi T12PR (n = 363) TVR + PR PR PR Suivi eRVR+ Suivi T8PR Pbo TVR + (n = 364) PR + PR PR PR Suivi eRVR- *TVR 750 mg q8h; pegIFN alfa-2a 180 µg/s; RBV 1000-1200 mg/j adaptée au poids. eRVR : réponse virologique rapide étendue (ARN indétectable à S4 et à S12) Jacobson
et
al.,
AASLD
2010,
Abstract
211.
  • 32. Hépatite C : virus et marqueurs ADVANCE—TVR + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : Caractéristiques des Patients T12PR (n = 363) T8PR (n = 364) PR (n = 361) Sexe masculin [n (%)] 214 (59) 211 (58) 211 (58) Origine ethnique Caucasiens [n (%)] 325 (90) 315 (87) 318 (88) Afro-Américains 26 (7) 40 (11) 28 (8) Hispaniques 35 (10) 44 (12) 38 (11) Âge (années) [médiane (intervalle)] 49 (19-69) 49 (19-68) 49 (18-69) IMC (kg/m2) [médiane (intervalle)] 26 (18-47) 26 (17-46) 26 (17-48) ARN du VHC > 800 000 UI/ml* [n (%)] 281 (77) 279 (77) 279 (77) Type/sous-type du VHC** [n (%)] 1a 213 (59) 210 (58) 208 (58) 1b 149 (41) 151 (41) 151 (42) 1 non sous-typable 1 (< 1) 3 (1) 2 (1) Stade de fibrose, n (%) Fibrose en ponts 52 (14) 59 (16) 52 (14) Cirrhose 21 (6) 26 (7) 21 (6) *La charge virale (ARN du VHC, UI/ml) a été déterminée par PCR en temps réel (TaqMan® Roche), avec une limite de quantification de 25 UI/mL **La détermination du génotype viral a été réalisée par hybridation inverse, INNO-LiPA v1.0 Jacobson
et
al.,
AASLD
2010,
Abstract
211.
  • 33. Hépatite C : virus et marqueurs ADVANCE—TVR + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : RVS p
<0,0001 p
<0,0001 Proportion
de
patients
ayant développé
une
RVS
(%) Jacobson
et
al.,
AASLD
2010,
Abstract
211.
  • 34. Hépatite C : virus et marqueurs ADVANCE—TVR + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : RVS p
<0,0001 p
<0,0001 Proportion
de
patients
ayant développé
une
RVS
(%) ➜ Le TVR améliore significativement les chances de guérison par rapport à la bithérapie standard ➜ Le traitement par TVR 8 ou 12 semaines donne des taux de RVS comparables (différence NS) Jacobson
et
al.,
AASLD
2010,
Abstract
211.
  • 35. Hépatite C : virus et marqueurs RESPOND-2—BOC + PegIFN + RBV chez des Patients en échec Thérapeutique de G1 : Design de l’Etude S4 S28 S48 S72 PR48 PR PR + placebo Suivi n = 80 Lead-in ARN-VHC indétectable à S8 Suivi S24 BOC/TGR PR PR + boceprevir S32 ARN-VHC détectable à S8 n = 162 Lead-in PR + Suivi placebo BOC/PR48 PR PR + boceprevir Suivi n = 162 Lead-in *BOC 800 mg q8h; pegIFN alfa-2b 1,5 µg/kg/s; RBV 600-1400 mg/j adaptée au poids. Bacon
et
al.,
AASLD
2010,
Abstract
216.
  • 36. Hépatite C : virus et marqueurs RESPOND-2—BOC + PegIFN + RBV chez des Patients en échec Thérapeutique de G1 : RVS et Taux de Rechute p
<0,0001 p
<0,0001 Taux de RVS Proportion
de
patients
(%) Taux de rechute 17/60 8/25 95/162 17/111 107/161 14/121 Lead‐in
+ 32
BOC/PR
±
PR12 Bacon
et
al.,
AASLD
2010,
Abstract
216.
  • 37. Hépatite C : virus et marqueurs RESPOND-2—BOC + PegIFN + RBV chez des Patients en échec Thérapeutique de G1 : RVS et Taux de Rechute p
<0,0001 p
<0,0001 Taux de RVS Proportion
de
patients
(%) Taux de rechute 17/60 8/25 95/162 17/111 107/161 14/121 Lead‐in
+ 32
BOC/PR
±
PR12 ➜ Le BOC améliore significativement les chances de guérison par rapport au retraitement par SOC Bacon
et
al.,
AASLD
2010,
Abstract
216.
  • 38. Hépatite C : virus et marqueurs RESPOND-2—BOC + PegIFN + RBV chez des Patients en échec Thérapeutique de G1 : RVS Selon la Réponse Antérieure Répondeurs partiels RR Proportion
de
patients
(%) 2/29 15/51 23/57 72/105 30/58 77/103 Lead‐in
+ 32
BOC/PR
±
PR12 Bacon
et
al.,
AASLD
2010,
Abstract
216.
  • 39. Hépatite C : virus et marqueurs RESPOND-2—BOC + PegIFN + RBV chez des Patients en échec Thérapeutique de G1 : RVS Selon la Réponse à S4 p
<0,0001 p
<0,0001 Proportion
de
patients
(%) Diminution de l’ARN <1 Log10 Diminution de l’ARN ≥1 Log10 17/66 15/46 80/110 15/44 17/66 Lead‐in
+ 32
BOC/PR
±
PR12 ➜ Intérêt de la phase de Lead-in comme facteur prédictif de la RVS Bacon
et
al.,
AASLD
2010,
Abstract
216.
  • 40. Hépatite C : virus et marqueurs REALIZE—TVR + PegIFN + RBV chez des Patients en Echec Thérapeutique de G1 : Design de l’Etude S4 S8 S12 S16 S48 S72 48 PR PR + placebo PR Suivi n = 130 PR n = 260 PR + TVR (Ll) PR Suivi PR n = 260 (LI) PR + TVR PR Suivi *TVR 750 mg q8h; pegIFN alfa-2a 180 µg/s; RBV 1000-1200 mg/j adaptée au poids. Press
release,
Sept
2010.
  • 41. Hépatite C : virus et marqueurs REALIZE—TVR + PegIFN + RBV chez des Patients en Echec Thérapeutique de G1 : RVS Proportion
de
patients PR48 (n=130) ayant
une
RVS
(%) T12/PR48* (n=520) *Bras
poolés Press
release,
Sept
2010.
  • 42. Hépatite C : virus et marqueurs TMC435 Administré en Monothérapie chez des Patients de Génotype 2, 3, 4, 5 et 6 Diminution
moyenne
de
l’ARN
 du
VHC
(Log
UI/mL) J3 J7 Manns
et
al.,
AASLD
2010,
Abstract
82.
  • 43. Nouvelles Hépatite C : virus et marqueurs Protéine NS5B: RdRp Lesburg
et
al.,
Nat
struct
Biol
1999,
6:
937‐943;
Bressanelli
et
al.,
Proc
Natl
Acad
Sci
USA
1999,
96:
13034‐13039;
Ago
et
al.,
Srructure
Fold
Des
1999,
7: 1417‐1426.
  • 44. Hépatite C : virus et marqueurs Réplication Virale – Modèle du poliovirus . Virus à ARN monocaténaire de polarité positive Réplication De
Clercq.,
Nature
Review
Drug
Discovery,
2007;
6:
1001‐18

  • 45. Hépatite C : virus et marqueurs Variabilité Génétique • Erreurs au cours de la réplication – Fréquentes • 10-4-10-4 mutations par nucléotide copié au cours de la réplication du VHC – Spontanées – Au hasard • Absence d’activité exonucléasique 3’⇒5’ ("proofreading") – Accumulation de mutations • A l’origine de : – La diversification des types et des sous-types – La distribution en quasi-espèces
  • 46. Hépatite C : virus et marqueurs Diversification des Génotypes Simmonds
et
al.,
Hepatology
2005,
42(4):962‐73.

  • 47. Hépatite C : virus et marqueurs Distribution des Génotypes 1a, Adapted
from
Fang
J.,
et
al.
J.
Clin
Liver
Dis.
1997.

  • 48. Hépatite C : virus et marqueurs Distribution en Quasi-espèce Weiner
et
al.,
Virology
1991;
180:842‐848;
Martell
et
al.,
J
Virol
1992;66:3225‐36.
  • 49. Hépatite C : virus et marqueurs Cibles des Molécules Antivirales Site C (Palm) Site A (Thumb/fingertips) (A-837093) (JTK-109) Mutants: 411, 414, 448 Mutants: 495, 496, 499 A B E C D Site B (Thumb) HCV-371 Site E (Finger, hypothetical) Mutants: 419, 423, 482 GS-9190 Mutants: 445,448,452 Site D (Palm) (HCV796) Site Actif Mutants: 316 (R7128) Mutants: 282 Copyright
©
2006
Merck
&
Co.,
Inc.,
Whitehouse
Station,
New
Jersey,
USA
  • 50. Hépatite C : virus et marqueurs Activité Antivirale du MK-0608 wt S282R/T/I wt S282 MK-0608 at 1mg.kg-1 orally 7 6 HCV RNA (Log IU/mL) 5 4 3 2 - 4,6 - 4,1 LOQ 1 (20 IU/mL) TMA + + + + - - - - - - - - + + 0 -15 -10 -5 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 Days
  • 51. Hépatite C : virus et marqueurs Cycle Viral Adapted
from
Lindenbach
and
Rice,
Nature
(2005),
436:
933‐938.
  • 52. Hépatite C : virus et marqueurs Complexes de Réplication Moradpour
et
al.,
Nature
Reviews
Microbiology,
2007;
5:
453‐463.
  • 53.
  • 54. HEPATITE C Stratégie Diagnostique & Suivi Virologique
  • 55. Stratégie diagnostique & suivi virologique Marqueurs Virologiques Marqueurs indirects Anticorps anti-VHC totaux Marqueurs directs Ag de capside (AgC) ARN VHC Génotype VHC Profil de résistance
  • 56. Stratégie diagnostique & suivi virologique Tests Sérologiques • Détection et quantification de l’Ag de capside • Test “Combo” – Détection simultanée de l’Ag de capside et des anticorps anti-VHC • Détection des anticorps anti-VHC à l’aide d’une trousse de 3ème génération
  • 57. Stratégie diagnostique & suivi virologique Antigène de Capside : un Marqueur de la Réplication r = 0.92; p < 0.0001 Bouvier‐Alias
et
al.,
Hepatology
2002,
36(1):
211‐218.
  • 58. Stratégie diagnostique & suivi virologique Performances Analytiques de la Trousse Architect (Abbott) • Spécificité – 99,2% à 100% • Sensitivité – ≤10 fmol/L (i.e 500 to 3 000 UI/mL d’ARN VHC) – Tous les génotypes (excepté génotype 2) • Intervalle de quantification – 10 à 20 000 fmol/L (≤ 7,8 Log10 UI/mL d’ARN VHC) • Stable à 37°C pendant 96 heures Ross
et
al.,
J
Clin
Micribiol
2010,
48(4):
1161‐8;
Mederacke
et
al.,
J
Clin
Virol
2009,
46(3):
210‐5;
Miedouge
et
al.,
J
Clin
Virol
2010,
48(1):18‐21.
  • 59. Stratégie diagnostique & suivi virologique Trousse Architect : Monitoring des Cinétiques Virales RVR (G1b) SVR (G1b) Relapser (G1b) NR (G1a) Core Ag RNA Ross
et
al.,
J
Clin
Microbiol

2010,
48(4):
1161‐8.
  • 60. Stratégie diagnostique & suivi virologique Intérêts Cliniques de la Quantification de l’AgC • Diagnostic de l’infection – Trousses commerciales – Facile à utiliser, automatisée, peu couteux (20% par rapport à une charge virale VHC) • Décision de traiter et suivi de l’efficacité des traitements antiviraux – Quantitatif (≤20,000 fmol/L*) – Alternative aux techniques de détection quantification de l’ARN du VHC (*Abbott Architect HCV Ag Assay)
  • 61. Stratégie diagnostique & suivi virologique Tests Virologiques Moléculaires Tests qualitatifs Tests quantitatifs Très sensibles Seuil de détection ≥ qualitatifs (≤ 50 IU/mL) Quelle quantité est présente ? Est-ce que le VHC est présent ? Détermination Détection de la résistance du Génotype Quel est le génotype du virus ? Quel type de VHC est présent ?
  • 62. Stratégie diagnostique & suivi virologique Tests Virologiques Moléculaires Tests Qualitatifs-Quantitatifs Est-ce que le VHC est présent et en quelle quantité ? Détermination Détection de la résistance du Génotype Quel est le génotype du virus ? Quel type de VHC est présent ?
  • 63. Stratégie diagnostique & suivi virologique Intervalle de Quantification 10 102 103 104 105 106 107 108 Cobas Amplicor HCV Monitor v2.0 SuperQuant LCx HCV RNA Assay Versant HCV RNA 3.0 (bDNA)
  • 64. Stratégie diagnostique & suivi virologique Avantages Techniques de la PCR en Temps Réel - Diminution du risque de contamination - Amélioration de la sensibilité - Augmentation de l’intervalle de quantification linéaire - Amélioration précision et reproductibilité - Augmentation de débit à travers l’automatisation
  • 65. Stratégie diagnostique & suivi virologique Intervalle de Quantification 10 102 103 104 105 106 107 108 Cobas Amplicor HCV Monitor v2.0 SuperQuant LCx HCV RNA Assay Versant HCV RNA 3.0 (bDNA) TaqMan 48 HCV (Roche) HCV Quant ASR (Abbott) Versant HCV RNA 1.0 (kPCR, Siemens)* Artus HCV QS-RGQ (Qiagen)* *in development
  • 66. Stratégie diagnostique & suivi virologique Plates-formes CAP-CTM96 (ROCHE) kPCR (SIEMENS) m2000SP-m2000RT (ABBOTT)
  • 67. Stratégie diagnostique & suivi virologique Avantages Cliniques de la PCR en Temps Réel • Remplace les techniques qualitatives de détection de l’ARN VHC • Quantifie l’ensemble des charges virales observées en pratique clinique – Charges élevées préthérapeutiques – Faibles charges virales au cours du traitement • Surveille efficacement les cinétiques virales (évaluation précoce des réponses virologiques au traitement)
  • 68. Stratégie diagnostique & suivi virologique Quantification ARN du VHC (CTM, Roche) 8 HCV RNA level in CAP/CTM48 (Log10 IU/mL) 7 Genotype 1 (n=29) 6 Genotype 2 (n=27) Genotype 3 (n=29) 5 Genotype 4 (n=30) Genotype 5 (n=9) 4 Genotype 6 (n=2) r = 0.889; p < 0.0001 3 3 4 5 6 7 8 HCV RNA level in Versant HCV 3.0 Assay bDNA (Log10 IU/mL) Chevaliez
et
al.,
2007;
Hepatology,
46(1):
22‐31.
  • 69. Stratégie diagnostique & suivi virologique Absence de Détection de l’ARN Viral de patients Fortement Virémiques Infectés par un Génotype 4 (Log10 IU/mL) CAP/CTM96 m2000SP/m2000RT Versant 3.0 Patient 1 (4h) <1.08 5.4 5.0 Patient 2 (4l) <1.08 6.0 5.7 80 90 100 110 120 130 140 150 160 170 180 |.........|.........|.........|.........|.........|.........|.........|.........|.........|.........| F_7157 (4a): TAGCCATGGCGTTAGTATGAGTGTTGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATCGCCGG Patient 1 (4h): ...........................A.....................................A...................T............... Patient 2 (4l): ...........................A.....................................A...................T............... 190 200 210 220 230 240 250 260 270 .........|.........|......-...|.........| .........|.........|.........|.........| .........|........ F_7157 (4a): GATGACCGGGTCCTTTCTTGGATTAA-CCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCC Patient 1 (4h): ......................A.T.A.......................................................................... Patient 2 (4l): .......................C..-.......................................................C.......T.......... 280 290 300 310 320 330 340 |.........|.........|.........|.........|.........|.........|. F_7157 (4a): TTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACC Patient 1 (4h): ............................................................. Patient 2 (4l): ............................................................. Chevaliez
et
al.,
2008;
Hepatology,
49(4):
1397‐1398.
  • 70. Stratégie diagnostique & suivi virologique Quantification de Transcrits d’ARN Sauvages ou Mutés en Position 145 et/ou 165 Measured HCV RNA levels (Log10 IU/mL) HCV 5’NC sequence Real-time PCR assays bDNA assay CTM m2000 Versant 3.0 Wild-type (G145 and 5.73±0.13 6.05±0.10 6.43±0.01 A165) Single mutant (G145A and 4.02±0.13 6.00±0.11 6.69±0.02 A165) Single mutant (G145 and 4.28±0.35 5.88±0.20 6.30±0.02 A165T) Double mutant (G145A <1.08* 5.95±0.25 6.60±0.18 and A165T) *Target not detected Chevaliez
et
al.,
Hepatology,
2009,
50(5):
1681.
  • 71. Stratégie diagnostique & suivi virologique Quantification ARN du VHC (m2000, Abbott) HCV RNA level in m2000SP/m2000RT (Log10 IU/mL) 8 7 Genotype 1 (n=55) 6 Genotype 2 (n=21) Genotype 3 (n=29) 5 Genotype 4 (n=24) Genotype 5 (n=9) 4 Genotype 6 (n=3) r = 0.972; p < 0.0001 3 3 4 5 6 7 8 HCV RNA level in Versant HCV 3.0 Assay bDNA (Log10 IU/mL) Chevaliez
et
al.,
J
Clin
Microbiol,
2009,47(6):1726‐32.
  • 72. Stratégie diagnostique & suivi virologique Quantification ARN du VHC (kPCR, Siemens) 132 clinical samples David
Sherman.,
Molecular
Symposium,
September
2007
(source:
Siemens
Medical
Solutions
Diagnostics).
  • 73. Stratégie diagnostique & suivi virologique Résumé • En pratique clinique, la quantification de l’ARN du VHC doit être réalisée à l’aide d’une technique de PCR en temps réel – Avec une limite de détection de l’ordre de 10 à 15 UI/mL
  • 74. Stratégie diagnostique & suivi virologique Génotypes du VHC Simmonds
et
al.
Hepatology
2005.

  • 75. Stratégie diagnostique & suivi virologique Répartition des Génotypes 1a, Adapted
from
Fang
J.,
et
al.
J.
Clin
Liver
Dis.,
1997.

  • 76. Stratégie diagnostique & suivi virologique Détermination du Génotype • Méthodes moléculaires (genotyping) – Analyse de la séquence après séquençage direct – Hybridation inverse des produits d’amplification sur des supports solides comportant des sondes génotype sépcifique : Line Probe Assay (INNO-LiPA HCV, Innogenetics) – PCR en temps réel à l’aide d’amorces et de sondes génotype spécifique • Méthodes sérologiques (“serotyping”) – ELISA compétitif Arens et al., J Clin Virol, 2001; 22:11-29; Davidson et al., J Gen Virol 1995; 76: 1197-204; Lareu et al., 1997; Le Pogam et al., 1998; J Clin Microbiol; 36: 1461-3; Ilina et al., J Clin Miocrobiol, 2005; 43(6): 2810-15.
  • 77. Stratégie diagnostique & suivi virologique Détermination du Génotype • Méthodes moléculaires (genotyping) – Analyse de la séquence après séquençage direct – Hybridation inverse des produits d’amplification sur des supports solides comportant des sondes génotype sépcifique : Line Probe Assay (INNO-LiPA HCV, Innogenetics) – PCR en temps réel à l’aide d’amorces et de sondes génotype spécifique • Méthodes sérologiques (“serotyping”) – ELISA compétitif Arens
et
al.,
J
Clin
Virol,
2001;
22:11‐29;
Davidson
et
al.,
J
Gen
Virol
1995;
76:
1197‐204;
Lareu
et
al.,
1997;
Le
Pogam
et
al.,
1998;
J
Clin
Microbiol;
36: 1461‐3;
Ilina
et
al.,
J
Clin
Miocrobiol,
2005;
43(6):
2810‐15.
  • 78. Stratégie diagnostique & suivi virologique Versant® HCV Genotype 2.0 Assay (INNO-LiPA)
  • 79. Stratégie diagnostique & suivi virologique Intérêt de la Détermination du Sous-Type ? • Direct Acting Antivirals (DAAs) pourraient avoir des efficacités antivirales différentes selon les sous-types de VHC de génotype 1 in vitro et in vivo • Le traitement par DAAs pourrait être associé à des profiles de résistance différents selon les sous-types de VHV de génotype 1 in vitro et in vivo
  • 80. Stratégie diagnostique & suivi virologique Profils de Résistance du BMS- 70052, in vitro Substitution amino Niveau de EC50 fold-change acidique Replication (%) Génotype 1b L31F/V 5-23 146±44 P32L 17 18±6 Y93H/N 19-28 20 ±7 Génotype 1a M28T 683 31±23 Q30E/H/R 1 450-24 933 130±56 L31M/V 350-3 350 117±29 P32L 233 18±5 Y93C/H/N 1 850-47 017 18±11 Fridell
et
al.
Antimicrob
Agents
Chemother.
2010;
54(9):
3641‐50
  • 81. Stratégie diagnostique & suivi virologique Profils de Résistance du Telaprevir (PROVE-2 trial), in vivo Génotype 1a Génotype 1b Pt-1 Pt-2 Pt-3 Pt-4 Pt-5 Pt-6 R26K V36L/M V36A V36A T42S A40T A40T T54S T54S T54A Y56F T91A R155K R155K R155K/E R155T/A G174S Chevaliez
et
al.
International
HIV&HEPATITIS
VIRUS
Drug
Resistance
Workshop
and
Curative
Strategies
2010.
  • 82. Stratégie diagnostique & suivi virologique Détermination du Sous-Type par une Méthode de Référence* *HCV genotype determination by means of phylogenetic analysis of a portion of the gene encoding the NS5B region was used as the reference method Chevaliez
et
al.,
PLoS
One
2009,
4(12):
e820.
  • 83. Stratégie diagnostique & suivi virologique Détermination du Sous-Type 1st Generation of Line 2nd Generation of Line Sequence Analysis of RealTime HCV Probe Assay Probe Assay the 5’NCR Genotype II (LiPA 1.0) (LiPA 2.0) GT 1a 77.6% 70.5% 97.5% 93.2% (n=237) (n=184) (n=167) (n=231) (n=220) GT 1b 90.5% 91.3% 96.2% 88.6% (n=263) (n=238) (n=240) (n=253) (n=233) Chevaliez
et
al.,
PLoS
One
2009,
4(12):
e820.
  • 84. Stratégie diagnostique & suivi virologique Résumé - Dans les essais cliniques évaluant les DAAs et probablement en pratique clinique, le détermination du sous-type des souches de génotype 1 est nécessaire pour la stratification et l’interprétation des profils de résistance - La détermination du génotype sur la seule région 5’NC doit être proscrite - La 2nd génération de Line Probe Assay qui utilise des sondes dirigées contre la région core en plus de la région 5’NC est la meilleure méthode permettant de distinguer les sous-types 1a et 1b
  • 85. Stratégie diagnostique & suivi virologique IL28B “Single Nucleotide Polymorphism” (SNP) En amont du géne de l’IL28B, codant l’IFN-λ3 rs12979860 Ge
et
al.,
Nature
2009;
461:
399‐401.
  • 86. Stratégie diagnostique & suivi virologique RVS à la Bithérapie Standard en Fonction du Génotype IL28B Réponse virologique soutenue (%) Caucasians African-Americans Hispanics Combined (n=1171) (n=300) (n=116) (n=1587) 12 14 37% 37% 22% 29% 51% 49% 48% Thompson
et
al.,
Gastroenterology
2010;
139(1):
120‐129.
  • 87. Stratégie diagnostique & suivi virologique Résumé - En pratique clinique, SNPs en amont du gène de l’IL28B (rs12979860 et rs8099917) sont les facteurs prédictifs les plus robustes de la RVS à la bithérapie - Cependant, leur valeur prédictive à l’échelon individuel n’est pas suffisante pour la prise en compte dans les décisions thérapeutiques - La détermination du génotype IL28B en association à d’autre paramètres, comme la réponse virologique à S4, pourrait être utile pour adapter le traitement, éventuellement des patients sous triple combinaison Ge
et
al.,
Nature
2009;
461:
399‐401;
Tanaka
et
al.,
Nat
Genet
2009;
41(10):
1105‐9;
Afdhal
et
al,
Hepatology
in
press.
  • 88. Stratégie diagnostique & suivi virologique Intérêts des Tests Virologiques en Thérapeutique • Décision de traiter • Optimisation du schéma thérapeutique • Etude de la réponse virologique au traitement Consensus
conference:
treatment
of
hepatitis
C;
2002,
Gastroenterol
Clin
Biol,
26(2):
B303‐20
  • 89. Stratégie diagnostique & suivi virologique Traitement de l’Hépatite Chronique C • Traitement standard – Interféron pégylé alpha-2a or alpha-2b et ribavirine à doses fixe ou adaptée au poids • Durée de traitement – 16 à 72 semaines en fonction du génotype et de la réponse virologique
  • 90. Stratégie diagnostique & suivi virologique Intérêts de la Détermination du Génotype • Détermination systématique du génotype – Facteur prédictif de la réponse au traitement – Conditionne . La dose de ribavirine . La durée du traitement
  • 91. Stratégie diagnostique & suivi virologique Dose de Ribavirine Proportion
de
patients
avec
RVS
(%) Ribavirine
0,8
g/j Ribavirin
1,0
–
1,2
g/j Hadziyannis et al., Ann Intern Med 2004;140: 346-355.
  • 92. Stratégie diagnostique & suivi virologique Durée de Traitement Proportion
de
patients
avec
RVS
(%) 24
semaines 48
semaines Hadziyannis
et
al.,
Ann
Intern
Med
2004;140:
346‐355.
  • 93. Stratégie diagnostique & suivi virologique Intérêts de la Détection - Quantification de l’ARN VHC • Evaluation de la réplication virale chez des patients anticorps anti-VHC positifs • Evaluation de la réponse virologique au cours du traitement pegIFN - RBV – Réponse virologique rapide (semaine 4) – Réponse virologique précoce (semaine 12) – Réponse fin de traitement (EoT) – Réponse virologique soutenue (semaine 24 post-Rx)
  • 94. Stratégie diagnostique & suivi virologique Réponses au Traitement en Fonction des Cinétiques Virales SOC +1 0 HCV RNA reduction from baseline (Log10 IU/mL) -1 -2 Diminution ≥ 2 Log -3 -4 -5 Detection cut-off -6 (10-15 IU/mL) 0 4 8 12 Semaines
  • 95. Stratégie diagnostique & suivi virologique Réponse Virologique Précoce : Facteur Prédictif de la RVS EoT RVS Rechute Diminution >2 Log ou Diminution <2 Log à S12 ARN indétectable à S12 Adapted
from
Ferenci
et
al.,
J
Hepatol
2005,
43:
425‐433.
  • 96. Stratégie diagnostique & suivi virologique Réponses au Traitement en Fonction des Cinétiques Virales SOC +1 0 HCV RNA reduction from baseline (Log10 IU/mL) -1 -2 Diminution ≥ 2 Log -3 -4 Slow VR -5 RVR RVP Detection cut-off -6 (10-15 IU/mL) 0 2 4 8 12 Semaines
  • 97. Stratégie diagnostique & suivi virologique Taux de RVS ViraferonPeg 1.5µg/kg/w + RBV 1000-1400 mg/d ViraferonPeg 1.0µg/kg/w + RBV 1000-1400 mg/d PegIFN alpha-2a 180µg/w + RBV 1000-1200 mg/d SVR 542/1019 667/1035 406/1019 386/1016 500/1016 423/1035 227/300 234/292 250/355 68/156 72/203 77/157 38/42 33/41 62/83 43/45 37/44 64/72 Week to first undetectable HCV RNA Semaines avec un ARN du VHC indétectable McHutchinson
et
al.,
New
Engl
J
Med
2009,
361(6):
580‐593.
  • 98. Stratégie diagnostique & suivi virologique Longer Treatment Duration Genotype 1, Slow virological responders >2 Log drop at week 12, but detectable HCV RNA 48 weeks 72 weeks Rate of SVR (%) p=0.040 34/51 27/35 104/130 90/119 78/179 94/190 17/100 31/106 121/230121/225 HCV RNA <50 IU/mL HCV RNA >50 IU/mL Berg
et
al.,
Gastroenterology
2006,
130:
1086‐97.
  • 99. Stratégie diagnostique & suivi virologique Longer Treatment Duration Genotype 1 and 4, Slow virological responders >2 Log drop at week 12, but detectable HCV RNA 48 weeks 72 weeks Rate of relapse (%) p<0.01 p<0.05 16/72 11/81 20/35 9/29 HCV RNA <50 IU/mL HCV RNA >50 IU/mL Ferenci
et
al.,
Gastroenterology
2010,
138:
503‐512.
  • 100. Stratégie diagnostique & suivi virologique Shorter Treatment Duration • A recent meta-analysis suggested that – In patients infected with HCV genotype 1 with an RVR, 24 weeks of therapy with SOC should be considered only in subjects with low baseline viral loads – The optimal cut-off defining low baseline HCV RNA level (400,000-800,000 IU/mL) is not clearly defined Moreno
et
al.,
J
Hepatol
2010;
52:
25‐31.



  • 101. Stratégie diagnostique & suivi virologique Shorter Treatment Duration Genotype 2 and 3, Rapid virological responders (<50 IU/mL at week 4) 16
weeks p<0.001 p<0.001 24
weeks Rate of SVR (%) 375/458 368/405 197/243 115/212 181/215 174/193 Diago
et
al.,
Hepatology.
2010;
51(6):
1897‐903.
  • 102. Stratégie diagnostique & suivi virologique Shorter Treatment Duration Genotype 2 and 3, Rapid virological responders with a low baseline viral load (<400,000 IU/mL) 16
weeks p=0.20 24
weeks Rate of SVR (%) 111/122 95/100 Diago
et
al.,
Hepatology.
2010;
51(6):
1897‐903.
  • 103. HCV genotype HCV-1 (4,5,6) HCV-2,3 RNA quantification SOC SOC 48 weeks 24 weeks Ribavirin (1000-1400 mg.d-1) Ribavirin (800 mg.d-1) RNA quantification at W4 HCV RNA HCV RNA RNA quantification at W4 undetectable detectable Consider HCV RNA HCV RNA 24 weeks RNA quantification at undetectable detectable of therapy1 W12 Decrease ≥ 2 Log Decrease ≥ 2 Log Decrease < 2 Log HCV RNA detectable HCV RNA undetectable Continue Rx until W24 If HCV RNA Consider Stop antiviral undetetectable Continue Rx Continue Rx until 16 weeks treatment Continue Rx Until until W24 W48 of therapy2 W72 1In patients with a low viral load at baseline (<400,000 IU/mL); 2In patients with a low viral load at baseline (400,000-600,000 IU/mL)
  • 104. Stratégie diagnostique & suivi virologique Future HCV Therapy • Future standard treatment – Pegylated interferon alpha-2a or alpha-2b – Ribavirin – Specific inhibitor of the NS3/4A protease . Telaprevir . Boceprevir
  • 105. Stratégie diagnostique & suivi virologique ADVANCE Trial Telaprevir, Naïve, Genotype 1 T12PR Follow‐up TVR+PR PR no
eRVR N
=
363 PR Follow‐up T8PR TVR Follow‐up PR no
eRVR N
=
364 +PR PR Follow‐up PR48 PR Follow‐up N
=
350 *eRVR
=
undetectable
HCV
RNA
at
week
4
and
week
12 0 8 12 24 36 48 60 72 Jacobson
et
al.,
AASLD
2010,
Abstract
211. Weeks
on
therapy
  • 106. Stratégie diagnostique & suivi virologique SVR Rates p
<0.0001 p
<0.0001 Proportion
of
Patients 
with
SVR
(%) Jacobson
et
al.,
AASLD
2010,
Abstract
211.
  • 107. Stratégie diagnostique & suivi virologique SPRINT-2 Trial Boceprevir, Naïve, Genotype 1 BOC/RGT Follow‐up VR LI BOC+
PR N
=
368 PR Follow‐up no
VR BOC/PR48 LI BOC
+
PR Follow‐up N
=
366 PR48 PR Follow‐up N
=
363 *VR
=
HCV
RNA
undetectable
between
weeks
8
and
24 0 4 12 24 28 36 48 60 72 Poordad
et
al.,
AASLD
2010,
Abstract
LB‐4. Weeks
on
therapy
  • 108. How to use molecular techniques to optimize management of chronic heptitis C Taux de RVS p
<0.0001 p
<0.0001 Proportion
of
Patients 
with
SVR
(%) Poordad et al., AASLD 2010, Abstract LB-4.
  • 109. Stratégie diagnostique & suivi virologique Résumé - Duration of triple therapy with pegylated IFN, ribavirin and a protease inhibitor will be tailored to the virological response at week 4 or earlier - Response-guided therapy is associated with high rates of SVR in genotype-1 treatment naïve patients - The ideal time points, frequency, and the feasibility in real-life practice need to be further evaluated