Zoulim Du 2009

3 467 vues

Publié le

Publié dans : Santé & Médecine
0 commentaire
0 j’aime
Statistiques
Remarques
  • Soyez le premier à commenter

  • Soyez le premier à aimer ceci

Aucun téléchargement
Vues
Nombre de vues
3 467
Sur SlideShare
0
Issues des intégrations
0
Intégrations
134
Actions
Partages
0
Téléchargements
93
Commentaires
0
J’aime
0
Intégrations 0
Aucune incorporation

Aucune remarque pour cette diapositive
  • Comme le montre ce graphique, la classe d ’âge la plus représentée dans le réseau sentinelles est celle des 20-29 ans
  • KEY MESSAGE:
    Real-time PCR techniques, with their high sensitivity and dynamic range of HBV DNA quantification, provide a more accurate assessment of the virological response to antiviral therapy.
    This slide shows several quantitative HBV DNA assays available for monitoring response to antiviral therapy. As we can see from the figure, the dynamic ranges of quantification of the available HBV DNA assays vary considerably. Most of the assay do not cover the full range of HBV DNA values that can be observed in untreated and treated patients with chronic hepatitis B. Some recent real-time PCR assays however, have a greater dynamic range. Abbott Molecular cover a wide range from 1 to 9.5 log IU/mL. The Artus and the Roche Cobas Taqman 48 HBV assays are the first standardised real-time PCR assays with dynamic ranges from 30 IU/mL to 8 log IU/mL.
  • This describes the pathophysiologic cascade of the chronic HBV infection.
    The early phase of CHB is characterized by the presence of hepatitis B e antigen (HBeAg) and high serum levels of HBV DNA (referred to as HBeAg-positive CHB). Following infection, the immune system attempts to clear the HBV by destroying infected hepatocytes.
    This leads to increasing circulatory blood levels of alanine aminotransferase (ALT). However, the majority of patients will clear HBeAg (and produce anti-HBe antibodies) and achieve a state of nonreplicative infection, characterized by low or undetectable serum levels of HBV DNA and normal ALT levels.
    High HBV DNA and ALT levels may persist in some anti-HBe-positive patients (referred to as HBeAg-negative CHB) because of the presence of an HBV variant that is unable to produce HBeAg (HBeAg-negative variant, also called HBV precore stop codon mutant).
  • Lecture Notes
    This slide depicts the findings of two trials that studied actuarial survival in end stage liver disease.
    In a US study, Weissberg et al studied survival data from 379 patients with chronic HBV, including 130 patients with cirrhosis.1 The study found that the estimated 5-year survival rate for patients with cirrhosis was 55% compared with 86% for patients with chronic active hepatitis and 97% for patients with chronic persistent hepatitis.
    In a European study, De Jongh et al studied survival data from 98 patients with HBsAg positive cirrhosis, including 21 with hepatic decompensation, which was defined as the presence of ascites, jaundice, encephalopathy, and/or a history of variceal bleeding at entry into the study.2 Within 3 years of the start of the study, 14 of these patients had died, with the remaining 7 patients still alive after 0.8 to 5.9 years of follow-up. Overall, the 5-year survival rate for the decompensated group was 14% compared with 84% for patients with compensated cirrhosis.
    References
    1.Weissberg JI, Andres LL, Smith CI, et al. Survival in chronic hepatitis B. An analysis of 379 patients. Ann Intern Med. 1984;101:613-616.
    2.De Jongh FE, Janssen HLA, De Man RA, et al. Survival and prognostic indicators in hepatitis B surface antigen-positive cirrhosis of the liver. Gastroenterology. 1992;103:1630-1635.
  • This compares the cumulative hepatocellular carcinoma incidence at the end of the 13th year of follow-up derived from the stepwise analyses of different baseline viral levels. Approximately 15% of all participants with serum HBV DNA levels of 1 million copies/mL or greater at study entry developed hepatocellular carcinoma by the 13th year of follow-up compared with 1.3% of participants with undetectable levels of HBV DNA.The biological gradient of cumulative hepatocellular carcinoma incidence by serum HBV DNA level remained prominent in all stepwise analyses. Among the 2925 participants seronegative for HBeAg with a normal ALT level and no liver cirrhosis, the cumulative hepatocellular carcinoma incidence was 13.5% for HBV DNA levels of 1 million copies/mL or greater and 0.7% for those with undetectable levels of HBV DNA. Serum hepatitis B virus (HBV) DNA level is a marker of viral replication and efficacy of antiviral treatment in individuals with chronic hepatitis B.
    The objective of the REVEAL study was to evaluate the relationship between serum HBV DNA level and risk of hepatocellular carcinoma.This was a prospective cohort study of 3653 participants (aged 30-65 years), who were seropositive for the hepatitis B surface antigen and seronegative for antibodies against the hepatitis C virus, recruited to a community based cancer screening program in Taiwan between 1991 and 1992.The main outcome measure was the incidence of hepatocellular carcinoma during follow-up examination and by data linkage with the national cancer registry and the death certification systems.
    164 incident cases of hepatocellular carcinoma and 346 deaths during a mean follow-up of 11.4 years and 41 779 person-years of follow-up were reported. The incidence of hepatocellular carcinoma increased with serum HBV DNA level at study entry in a dose-response relationship ranging from 108 per 100 000 person-years for an HBV DNA level of less than 300 copies/mL to 1152 per 100 000 person-years for an HBV DNA level of 1 million copies/mL or greater. The corresponding cumulative incidence rates of hepatocellular carcinoma were 1.3% and 14.9%, respectively. The biological gradient of hepatocellular carcinoma by serum HBV DNA levels remained significant (P.001) after adjustment for sex, age, cigarette smoking, alcohol consumption, serostatus for the hepatitis B e antigen (HBeAg), serum alanine aminotransferase level, and liver cirrhosis at study entry. The dose-response relationship was most prominent for participants who were seronegative for HBeAg with normal serum alanine aminotransferase levels and no liver cirrhosis at study entry. Participants with persistent elevation of serum HBV DNA level during follow-up had the highest hepatocellular carcinoma risk.
    Elevated serum HBV DNA level (10 000 copies/mL) is a strong risk predictor of hepatocellular carcinoma independent of HBeAg, serum alanine aminotransferase level, and liver cirrhosis.
  • This describes the relationship between high baseline serum HBV DNA levels with increased risk of HCC mortality.
    In a prospective cohort study with 11 years of follow-up, Evans and colleagues assessed the relationship between past HBV viral load and mortality.
    They measured HBV viral load by real-time PCR on stored samples from cohort entry (1992–1993) in 2763 hepatitis B surface antigen (HBsAg)-positive adults from a prospective cohort in Haimen City, China. Follow-up was completed through 2003, with information on deaths occurring during this interval abstracted from death certificates. Major endpoints were death from HCC or chronic liver disease (CLD). There were 447 deaths in total.
    Viral load was divided into three categories: undetected (<1.6 × 103 copies/mL); low titer (<105 copies/mL); high titer (≥105 copies/mL).
    For HCC, there was a significant increase in mortality across viral load categories (p trend<0.001).
    Compared to the HBV undetected category, the relative risk (RR) for HCC mortality in the low viral load group was 1.7 (95% CI 0.5–5.7) and 11.2 (3.6–35.0) in the high viral load group.
    The relative risk associated with high viral load did not change with increased follow-up time.
  • Organization chart boxes will automatically fill with secondary color but you may want to change the box outlines and connectors to stand out on the page:
    Double click on the organization chart to enter Microsoft Organization Chart.
    Select Edit/ Select/ All in order to highlight all boxes.
    Select Boxes/ Border Color/ White.
    Select File/ Close and Return to “Your Presentation Name”.
    You will be prompted to update your presentation if you have not already done so.
  • KEY TAKEAWAY
    A single change in the amino acid sequence can have a significant impact on drug resistance. Amino acid substitutions associated with drug resistance occur in the reverse transcriptase region of HBV polymerase.
    This slide shows how amino acid substitutions can result in resistance to an antiviral drug – in this case lamivudine (LVD).
    Mutations in the sequence of the HBV polymerase gene that result in drug resistance do so through amino acid substitutions in the reverse transcriptase (RT) region of the polymerase.
    The figure on the top left of the slide shows a space-filling model of the wild-type RT region. [Build 1] In contrast, the figure on the top right-hand side of the slide shows the RT region from an LVD-resistant (LVDr) HBV variant. In this variant, the methionine at amino acid position 204 has been replaced with a valine (M204V) and the leucine at amino acid position 180 has been replaced with a methionine (L108M).
    The M204V substitution reduces the size of the binding pocket of the RT enzyme, meaning that LVD triphosphate (LVD-TP) is unable to bind to enzyme due to steric hindrance. However, the mutated RT enzyme is still able to bind it’s natural substrates (nucleoside triphosphates), so the virus can continue to replicate.
    [Build 2] The final figure on the bottom left-hand side of the slide shows the LVDr RT region binding entecavir triphosphate (ETV-TP). In this case, there is minimal steric clash between ETV-TP and the valine at amino acid position 204, accounting for why there is only partial cross-resistance between LVD and ETV.
  • FZ
  • Key message: The genetic barrier to resistance depends, in part, on the number of substitutions required for virologic breakthrough. Resistance to lamivudine and adefovir requires one substitution. Resistance to entecavir requires three substitutions (two lamivudine-resistance substitutions and at least one entecavir-resistance substitution.
    When wild-type virus is treated with lamivudine or adefovir, it has only to acquire one mutation in order to escape the inhibitory effects of the drug (a change from methionine to either isoleucine or valine at position 204 for lamivudine; or either an asparagine to threonine mutation at position 236 or an alanine to valine or threonine at position 181 for adefovir).
    In the absence of lamivudine refractory isolates, no resistant virus has yet been seen to emerge with up to 2 years of Baraclude treatment in nucleoside-naive patients. Evidence from in vitro studies and from lamivudine-refractory patients suggests that multiple mutations are required for the development of meaningful resistance to Baraclude. This represents a genetic barrier that may be more difficult for the virus to overcome, since the likelihood of two or three mutations arising simultaneously is much lower than for a single mutation.
    Virus that has already developed resistance to lamivudine has a reduced sensitivity to entecavir in vitro and has a backbone of mutations on which to build entecavir resistance. This virus has to acquire at least one additional mutation at position 184, 202 or 250 in order to develop resistance to entecavir.
  • KEY TAKEAWAY
    Archived covalently closed circular DNA (cccDNA) plays an important role in viral persistence.
    This slide provides an overview of the archiving process. When HBV infects a hepatocyte in the liver, viral replication in the hepatocyte results in the formation of cccDNA within the cell. This cccDNA can serve as a template for the production of new virus, but can also remain within the hepatocyte, where it is said to be archived.
    Archived cccDNA plays an important role in viral persistence and in the reactivation of viral replication after the cessation of antiviral therapy.
  • KEY TAKEAWAY
    Viral variants with antiviral drug resistance may be archived in the form of cccDNA.
    By drawing comparisons with animal models of HBV infection, it is believed that drug resistance may be archived in the form of cccDNA. In this slide, a viral variant with drug resistance (represented by the red circle) is formed via a point mutation during the replication of a sensitive variant (represented by the light blue circle). As described on the previous slide, during the normal course of replication cccDNA from this resistant variant may become archived in hepatocytes. Once archived in this way, drug resistance may persist for long periods in the absence of drug.
    Archived cccDNA molecules in hepatocytes act mainly as a reservoir for future viral replication and are therefore not inhibited by nucleos(t)ide analogues, which inhibit replication when they are incorporated into nucleic acid molecules during replication.
  • Since cccDNA acts as a reservoir for future viral replication, the archiving of resistant variants may lead to the persistence and expansion of this population – as demonstrated on this slide where the number of resistant variants (red circles) has increased to become the majority population.
  • Genotypic resistance is the first manifestation of resistance. This may be followed by an increase in viral load (Virologic Breakthrough) which, in turn, may be followed by a rise in ALT (Biochemical Breakthrough)
    There is a time lag between each of these events, the time may vary from patient to patient and from drug to drug
    For practical reasons, viral load is normally used to monitor patients. ALT may also be used in certain regions.

  • 14.2.21.3
    14.2.21.4
    14.2.21.5
    14.2.21.6
  • This study showed a clear link between the magnitude of early viral suppression and the probability of achieving clinically important endpoints after 1 year
    Significant relationships were seen between viral load at 6 months and efficacy outcomes at 1 year.
    For HBeAg loss, a difference was evident even between those patients who were below 1000 copies/mL at 6 months but still PCR-positive (i.e. >200 copies/mL), and those who were PCR-negative.
    A similar, although less pronounced, relationship was seen with ALT normalization.
    None of the patients who were below 1000 copies/mL at 6 months developed resistance at 1 year.
    These results support the concept that maximizing early viral suppression is a key therapeutic objective in order to achieve the best possible efficacy outcomes.
  • Zoulim Du 2009

    1. 1. Hépatite BHépatite B Fabien ZoulimFabien Zoulim Département d’hépatologieDépartement d’hépatologie & INSERM U871, Lyon& INSERM U871, Lyon
    2. 2. VHBVHB HCAHCA cirrhosecirrhose CHCCHC VaccinVaccin ANTIVIRAUXANTIVIRAUX IFNIFN Antiviraux/IFN?Antiviraux/IFN? NiederauNiederau N Engl J Med 1996N Engl J Med 1996 & Liaw& Liaw N Engl J Med 2004N Engl J Med 2004 RESISTANCE VIRALERESISTANCE VIRALE 30-50 ans30-50 ansGuérisonGuérison Lee, N Engl J Med 1997; Lok, Hepatology 2001Lee, N Engl J Med 1997; Lok, Hepatology 2001
    3. 3. EPIDEMIOLOGIE DE L’HÉPATITE BEPIDEMIOLOGIE DE L’HÉPATITE B
    4. 4. EPIDEMIOLOGIE DE L'INFECTION A VHBEPIDEMIOLOGIE DE L'INFECTION A VHB • Hépatites aiguesHépatites aigues – VHA : 40%VHA : 40% – VHB : 30%VHB : 30% – VHC : 20%VHC : 20% • incidence : 300 000 infections à VHB / anincidence : 300 000 infections à VHB / an • 30 000 nouveaux porteurs chroniques / an30 000 nouveaux porteurs chroniques / an • 3 000 décès / an3 000 décès / an AUX USAAUX USA
    5. 5. MODES DE TRANSMISSION DU VIRUS DE L'HÉPATITE B EN EUROPEMODES DE TRANSMISSION DU VIRUS DE L'HÉPATITE B EN EUROPE sexuellesexuelle 34%34% hétérohétéro 23%23% homohomo 11%11% drogue IVdrogue IV 26%26% inconnueinconnue 31%31% hémodialyséshémodialysés 8%8% transfusionstransfusions 2%2% personnels de santépersonnels de santé 2%2% contact aveccontact avec porteur du VHBporteur du VHB 4%4% AsieAsie Transmission verticaleTransmission verticale
    6. 6. Déclaration obligatoire de l’hépatite B en France : résultats des 12 premiers mois de notification Denise Antona, E Delarocque-Astagneau, D Lévy-Bruhl département des maladies infectieuses
    7. 7. Incidence of acute hepatitis B in France Sentinel networks 1991-1996 et Lyon (COURLY) 1983-1997 0 5 10 15 20 25 1983 1985 1987 1989 1991 1993 1995 1997 Taux /100 000 COURLY Réseau "Sentinelles"
    8. 8. Circuit de l’information Biologiste InVS MISP de DDASS du département d’exercice Médecin prescripteur Fiche de notification autocopiante à 4 feuillets Partie 1 : code d’anonymat irréversible, caractéristiques du patient Partie 2 : information biologique Parties 3-4-5 : information clinique et épidémiologique Parties 6-7 : identification du médecin prescripteur et du biologiste déclarants Feuillet 1 : parties 1-2 et 6-7 renseignées Feuillets 2 et 3 à compléter Feuillet 2 : parties 3-4-5 complétées Feuillets 1 et 2 complétés et validés Relance
    9. 9. Results 158 acute hepatitis cases158 acute hepatitis cases • Hospital doctor in 64% casesHospital doctor in 64% cases • Sex ratio M/F : 2,95 (118/40)Sex ratio M/F : 2,95 (118/40) • Median age: 37 yrs for males, 36yrs for femalesMedian age: 37 yrs for males, 36yrs for females • Jaundice : 69%Jaundice : 69% • Hospitalisation : 46%Hospitalisation : 46% • Fulminant hepatitis : 3 (2 death)Fulminant hepatitis : 3 (2 death)
    10. 10. Age distribution: comparison of the different periods 1991-94 versus 03/2003 - 02/2004 0% 10% 20% 30% 40% 0-9 ans 10-19 ans 20-29 ans 30-39 ans 40-49 ans 50-59 ans Classes d'âge % de cas Réseau "Sentinelles" Déclarations obligatoires years 1991- 94 n= 151 March 03- February 04 n= 158
    11. 11. Risk exposure within 6 months preceding the acute case Source : obligatory declaration 2003-04 • Source: obligatory declaration march 03- february 2004 N=145Source: obligatory declaration march 03- february 2004 N=145 – SexualSexual 5959 40,6%40,6% No factorNo factor 4343 29,6%29,6% – IVDUIVDU 99 6,2%6,2% >1 factor>1 factor 3838 26,3%26,3% – Invasive treatmentInvasive treatment 1515 10,3%10,3% – Tatoo, piercingTatoo, piercing 55 3,4%3,4% – FamilialFamilial 1414 9,7%9,7% – Perinatal 2Perinatal 2 1,4%1,4% – Live in instiutionLive in instiution 1111 7,6%7,6% – Travel in endemic 21Travel in endemic 21 14,5%14,5% areasareas 91/145 patients (63 %) had a vaccine indication (2 vaccinated ≥ 3 doses)91/145 patients (63 %) had a vaccine indication (2 vaccinated ≥ 3 doses) • Sentinel networks 91-96Sentinel networks 91-96 N=195N=195 – sexualsexual 35%35% – IVDUIVDU 19%19% – « percutaneous »« percutaneous » 15%15% – No factorNo factor 35%35%
    12. 12. Hépatites virales B: épidémiologie - Vaccin mais 400 millions de porteurs chroniques dans le monde - 300 000 porteurs chroniques en France (INVS) - 1 300 décès par an en France - 60 000 avec hépatite chronique active - Seulement 13 000 patients traités
    13. 13. VIROLOGIEVIROLOGIE
    14. 14. • FAMILLE : Hepadnaviridae, seul représentant humain •VIRUS RESISTANT : - 7 jours dans l’environnement - pendant 5 mn à 100°C, 10 h à 60°C - à la congélation. LE VIRUS DE L ’HEPATITE B
    15. 15. LE GÉNOME DU VIRUS DE L’HÉPATITE BLE GÉNOME DU VIRUS DE L’HÉPATITE B déterminant adéterminant a vaccin/IgHBsvaccin/IgHBs Gène polGène pol antivirauxantiviraux Mt pre-coreMt pre-core Réponse anti-HBeRéponse anti-HBe ?? Mt du coreMt du core Réponse CTLRéponse CTL 8 génotypes8 génotypes A to HA to H Tiollais Nature 1985Tiollais Nature 1985 Günther Adv Virus Res 1999Günther Adv Virus Res 1999 Norder J Gen Virol 2003Norder J Gen Virol 2003
    16. 16. Ganem & Prince, NEJM 2004Ganem & Prince, NEJM 2004
    17. 17. ARN pg ss DNA RC DNA cccDNA intégration virion10% 90% ds DNA cccDNA illégitime noyau Réplication du génome viral. Implication pour la persistance virale et l’intégration du génome viral Membrane cellulaire
    18. 18. VHB HUMAINVHB HUMAIN MARMOTTE (WHV)MARMOTTE (WHV) CANARD (DHBV)CANARD (DHBV) QuickTime™ et un décompres seur Photo - JPEG sont requis pour visualiser cette image. Modèles AnimauxModèles Animaux Souris TransgéniquesSouris Transgéniques Souris SCID uPaSouris SCID uPa ChimpanzéChimpanzé TupaiaTupaia Summers PNAS 1978, Mason J Virol 1981, Chisari Science 1985, Petersen PNAS 1998Summers PNAS 1978, Mason J Virol 1981, Chisari Science 1985, Petersen PNAS 1998
    19. 19. • Polymerase viralePolymerase virale – DHBV : lysat réticulocytaireDHBV : lysat réticulocytaire – HBV : baculovirusHBV : baculovirus ModèlesModèles in vitroin vitro UU Polymerase VHBPolymerase VHB DNA(-)DNA(-) ELONGATIONELONGATION CCC -CCC - RC -RC - L -L - SS -SS - • Culture cellulaireCulture cellulaire – Transfection : lignées d’hépatomeTransfection : lignées d’hépatome – Infection : hépatocytes primaires, HepaRGInfection : hépatocytes primaires, HepaRG – Baculovirus ou adenovirus recombinantBaculovirus ou adenovirus recombinant Sells PNAS 1987, Wang Cell 1992, Zoulim J Virol 1994,Sells PNAS 1987, Wang Cell 1992, Zoulim J Virol 1994, Lanford J Virol 1995, Gripon PNAS 2002, Sprinzl J Virol 2001Lanford J Virol 1995, Gripon PNAS 2002, Sprinzl J Virol 2001
    20. 20. interaction virion noyau hépatocyte traduction encapsidation transcription inverse ARNpgADN (-) amplification de l’ADNccc transcription ARNm ARNpg AAA AAA AAA AAA ADNcccADNccc formation d’ADNccc ADN RC entrée polymérase ADN (+) Synthèse du brin (+) sécrétion des virions RE Ag HBe Ag HBs récepteur ? RE sécrétion des protéines virales Cycle de réplication du HBV Analogues de nucléosides ADN RC
    21. 21. Comparative dynamics among three virusesComparative dynamics among three viruses (Tsiang et al. Hepatology 1999)
    22. 22. Infection à VHB et risque de CHCInfection à VHB et risque de CHC • Etude de Beasley à TaiwanEtude de Beasley à Taiwan – risque relatif = 100 chez les porteurs de l'AgHBsrisque relatif = 100 chez les porteurs de l'AgHBs • Etude de TsukumaEtude de Tsukuma – risque cumumatif de CHC à 3 ansrisque cumumatif de CHC à 3 ans • 12,5% chez 240 patients avec cirrhose12,5% chez 240 patients avec cirrhose • 3,8% chez 677 patients avec hépatite chronique3,8% chez 677 patients avec hépatite chronique – risque x 7 si AgHBs +risque x 7 si AgHBs + – risque X 4 si anti-HCV +risque X 4 si anti-HCV + • Facteurs associés : alcool, tabac, aflatoxineFacteurs associés : alcool, tabac, aflatoxine • Diminution incidence avec la vaccination de masseDiminution incidence avec la vaccination de masse (Chen,(Chen, NEJM 1995)NEJM 1995)
    23. 23. CARCINOME HEPATOCELLULAIRE ET VIRUSCARCINOME HEPATOCELLULAIRE ET VIRUS DE L'HEPATITE BDE L'HEPATITE B • Co-incidence de répartition géographiqueCo-incidence de répartition géographique VHB / CHCVHB / CHC • Porteurs AgHBs : RR x 100 pour le CHCPorteurs AgHBs : RR x 100 pour le CHC • CHC dans les modèles animaux de l'hépatite B :CHC dans les modèles animaux de l'hépatite B : – marmottemarmotte – écureuilécureuil • Présence d'ADN viral intégré dans les tumeursPrésence d'ADN viral intégré dans les tumeurs
    24. 24. HBV replication and its role in HCC development Wands, NEJM 2004
    25. 25. PATHOGENIE DU CARCINOMEPATHOGENIE DU CARCINOME HEPATOCELLULAIREHEPATOCELLULAIRE VHBVHB ALCOOLALCOOL VHCVHC LESIONS HEPATIQUES CHRONIQUESLESIONS HEPATIQUES CHRONIQUES ACTIVATION FACTEURSACTIVATION FACTEURS DE CROISSANCEDE CROISSANCE REGENERATIONREGENERATION ALTERATIONS GENETIQUESALTERATIONS GENETIQUES CARCINOME HEPATOCELLULAIRECARCINOME HEPATOCELLULAIRE DESORDRESDESORDRES METABOLIQUESMETABOLIQUES FACTEURSFACTEURS ENVIRONNEMENTAUXENVIRONNEMENTAUX
    26. 26. Role du VHB dans l’oncogénèse hépatique VHB INFECTION CHRONIQUE CARCINOGENES CO-FACTEURS REACTION INFLAMMATOIRE CHRONIQUE REGENERATION HEPATIQUE MUTAGENESE INSERTIONNELE TRANSACTIVATION DE GENES CELLULAIRES INTERACTIONS PROTEIQUES INACTIVATION DE GENES SUPPRESSEURS DE TUMEUR CHC
    27. 27. PHYSIOPATHOLOGIE /PHYSIOPATHOLOGIE / IMMUNOPATHOLOGIEIMMUNOPATHOLOGIE
    28. 28. Ganem and Prince, NEJM 2004Ganem and Prince, NEJM 2004
    29. 29. HÉPATOCYTE INFECTÉHÉPATOCYTE INFECTÉ VHBVHB CTLCTL FasFas perforineperforine HÉPATOCYTEHÉPATOCYTE NON INFECTÉNON INFECTÉ IMMUNOPATHOGÉNIEIMMUNOPATHOGÉNIE DES HÉPATITES B CHRONIQUESDES HÉPATITES B CHRONIQUES AgHBc/eAgHBc/e HLAIHLAI cytokinescytokines RÉPONSE IMMUNITAIRERÉPONSE IMMUNITAIRE CYTOKINESCYTOKINES ANTIVIRAUXANTIVIRAUX ANTICORPS NEUTRALISANTSANTICORPS NEUTRALISANTS
    30. 30. IMMUNOPATHOLOGY OF HBV INFECTIONIMMUNOPATHOLOGY OF HBV INFECTION Immune toleranceImmune tolerance Clairance phaseClairance phase Chronic hepatitisChronic hepatitis SeroconversionSeroconversion RemissionRemission CD8+CD8+ HBVHBV CD8+CD8+ HBVHBV CD8+CD8+ HBVHBV
    31. 31. Immunopathology Fulminant hepatitisFulminant hepatitis CD8+CD8+ HBVHBV
    32. 32. Non cytolytic processesNon cytolytic processes TH1 cytokines with direct antiviralTH1 cytokines with direct antiviral effecteffect Turn-over of infected cellsTurn-over of infected cells Immune mediated lysis of infected cellsImmune mediated lysis of infected cells DucksDucks WoodchucksWoodchucks (Guo J Virol 1999(Guo J Virol 1999 Summers PNAS 2003&2004)Summers PNAS 2003&2004) Transgenic miceTransgenic mice ChimpanzeesChimpanzees (Guidotti Science 1999,(Guidotti Science 1999, Thimme J Virol 2003)Thimme J Virol 2003) AntiviralsAntivirals Inhibition of viral DNA synthesisInhibition of viral DNA synthesis -> inhibition of intracellular recycling of-> inhibition of intracellular recycling of cccDNAcccDNA (Werle Gastroenterology 2004)(Werle Gastroenterology 2004) Restoration of anti-HBV immune responseRestoration of anti-HBV immune response MECHANISMS OF VIRAL CLEARANCEMECHANISMS OF VIRAL CLEARANCE
    33. 33. Non cytolytic clearance of acuteNon cytolytic clearance of acute HBV infection in chimpanzeeHBV infection in chimpanzee Wieland S et al, PNAS 2004
    34. 34. Hepatocyte turn-over is required for clearance ofHepatocyte turn-over is required for clearance of viral infection in acute infectionviral infection in acute infection Summers et al, PNAS 2003 & 2004Summers et al, PNAS 2003 & 2004
    35. 35. Hépatocyte infectéHépatocyte infecté HBVHBV HépatocyteHépatocyte non infecténon infecté Phase de tolérance immunitairePhase de tolérance immunitaire MarqueursMarqueurs AgHBe +AgHBe + HBV DNA +++HBV DNA +++ ALAT = NALAT = N Foie = NFoie = N HBc/e AgHBc/e Ag
    36. 36. Hépatocyte infectéHépatocyte infecté HBVHBV CTLCTL FasFas perforineperforine HépatocyteHépatocyte non infecténon infecté Phase de clairance immunePhase de clairance immune (hépatite chronique)(hépatite chronique) MarqueursMarqueurs AgHBe+AgHBe+ HBV DNA +HBV DNA + ALAT +++ALAT +++ Foie:Foie: HépatiteHépatite chroniquechronique HBc/e AgHBc/e Ag HLAIHLAI cytokinescytokines
    37. 37. Hépatocyte infectéHépatocyte infecté HBs AgHBs Ag HépatocyteHépatocyte non infecténon infecté MarqueursMarqueurs AgHBe-AgHBe- anti-HBe +anti-HBe + HBV DNA < 10HBV DNA < 1044 /mL/mL ALAT = NALAT = N Foie = rémissionFoie = rémission Phase de rémissionPhase de rémission portage inactif de l’AgHBsportage inactif de l’AgHBs RéactivationRéactivation Virus sauvageVirus sauvage ou mt pre-coreOncogénèseOncogénèse
    38. 38. Hépatocytes infectésHépatocytes infectés HépatocytesHépatocytes non infectésnon infectés MarqueursMarqueurs HBsAg -HBsAg - anti-HBc +anti-HBc + Anti-HBs +/-Anti-HBs +/- HBV DNA - mais PCR +HBV DNA - mais PCR + Clairance de l’AgHBsClairance de l’AgHBs Mutants d’échappementMutants d’échappement Infections occultesInfections occultes OncogénèseOncogénèse
    39. 39. cccDNAcccDNA(copies/cell)(copies/cell) TotalHBVDNATotalHBVDNA (copies/cell)(copies/cell) cccDNA levels in the different phases ofcccDNA levels in the different phases of chronic HBV infectionchronic HBV infection • HBeAg+ patients had significantly higher cccDNA (90-fold) and total HBV DNA (147- fold) levelsHBeAg+ patients had significantly higher cccDNA (90-fold) and total HBV DNA (147- fold) levels compared to HBeAg- patients. (p<0.001, Wilcoxon tests)compared to HBeAg- patients. (p<0.001, Wilcoxon tests) 10-3 10-2 10-1 100 101 102 103 104 10-3 10-2 10-1 100 101 102 103 HBeAg+ (63) HBeAg+ (63) Inact. Carriers (10) Inact. Carriers (10) HBSAg- (7) HBSAg- (7) HBeAg- (18) HBeAg- (18) HBeAg+ (63) HBeAg+ (63) Inact. Carriers (10) Inact. Carriers (10) HBSAg- (7 HBSAg- (7) HBeAg- (18) HBeAg- (18) Werle et al, Gastroenterology 2004
    40. 40. HISTOIRE NATURELLE ET VIROLOGIE CLINIQUE
    41. 41. Histoire Naturelle de l’hépatite BHistoire Naturelle de l’hépatite B Infection aigueInfection aigue Infection chroniqueInfection chronique Tolérance immunitaireTolérance immunitaire Hépatite chroniqueHépatite chronique Portage inactifPortage inactif GuérisonGuérison 5% nx-nés5% nx-nés 90% adultes90% adultes Virus sauvage (HBeAg+)Virus sauvage (HBeAg+) Mutant pre-core (HBeAg-)Mutant pre-core (HBeAg-) CirrhoseCirrhose Carcinome hépatocellulaireCarcinome hépatocellulaire RéactivationRéactivation 30-50 ans30-50 ans Seeger, Zoulim, Mason; Fields Virology; 2007
    42. 42. MARQUEURS SEROLOGIQUESMARQUEURS SEROLOGIQUES • Système AgHBe /anti-HBeSystème AgHBe /anti-HBe – distinction virus sauvage / virus muté AgHBedistinction virus sauvage / virus muté AgHBe négatifnégatif • VirémieVirémie – détection quantitative de l'ADN viraldétection quantitative de l'ADN viral
    43. 43. HEPATITE B AIGUE • Incubation 1 à 6 moisIncubation 1 à 6 mois • Le plus souvent asymptomatiqueLe plus souvent asymptomatique – Évolution plus fréquente vers la chronicitéÉvolution plus fréquente vers la chronicité • Prodromes:Prodromes: – Maladie sérique : arthralgies, urticaire,Maladie sérique : arthralgies, urticaire, acrodermatite etc. ..acrodermatite etc. .. • Formes ictériques : + graves que VHA et VHCFormes ictériques : + graves que VHA et VHC – Durée de l’ictère : jusqu’à 4 moisDurée de l’ictère : jusqu’à 4 mois • Evolution : chronicité 5 à 10%Evolution : chronicité 5 à 10% • Hépatites fulminantesHépatites fulminantes
    44. 44. Laboratory Diagnosis of Acute Hepatitis B 0 100 200 300 400 500 600 700 800 900 1000 0 1 2 3 4 5 6 12 24 36 48 60 ALT HBsAg HBeAg HBV DNA Normal Months After Exposure ALTandHBVDNA IU/Landmillioncopies/ml Symptoms Anti-HBs Ab Anti-HBe Ab IgM anti-HBc Total anti-HBc Seeger, Zoulim, Mason, Fields Virology 2007
    45. 45. HEPATITE B PROLONGEE • DéfinitionDéfinition – Persistance réplication virale à la 8èmePersistance réplication virale à la 8ème semaine d’évolution :semaine d’évolution : – AgHBe + ou ADN-VHB +AgHBe + ou ADN-VHB + • EvolutionEvolution – Chronicité : 8 cas / 10Chronicité : 8 cas / 10 • Traitement : IFNTraitement : IFN – Guérison : 7 à 8 cas / 10Guérison : 7 à 8 cas / 10
    46. 46. INFECTIONS CHRONIQUES A VHBINFECTIONS CHRONIQUES A VHB FORMES CLINIQUESFORMES CLINIQUES • virus sauvagevirus sauvage – tolérance immunitairetolérance immunitaire – rupture de tolérance -> lésions hépatocytaires : HCArupture de tolérance -> lésions hépatocytaires : HCA – séroconversion anti-HBe spontanée (portage inactif) :séroconversion anti-HBe spontanée (portage inactif) : 5-10% /an5-10% /an – > diminution significative réplication virale> diminution significative réplication virale – > amélioration signes histologiques> amélioration signes histologiques • virus muté pré-C (-)virus muté pré-C (-) – sélection au moment de la séroconversion anti-HBesélection au moment de la séroconversion anti-HBe – dépend du génotype viraldépend du génotype viral – immunopathologie ?immunopathologie ? – sévérité de l'hépatopathie : controverséesévérité de l'hépatopathie : controversée – association au CHCassociation au CHC
    47. 47. 0 100 200 300 400 500 600 700 800 0 1 2 3 4 5 6 12 24 36 48 60 ALT HBsAg HBeAg HBV DNA Normal Months After Exposure ALTandHBVDNA IU/Lormillioncopies/ml Laboratory Diagnosis of Chronic Hepatitis B associated with wild type virus infection Diapositive 25 Seeger, Zoulim, Mason, Fields Virology 2007
    48. 48. ALT ``HBsAg HBeAg HBV DNA Normal Months After Exposure ALTandHBVDNA IU/Landmillioncopies/ml Anti-HBe Laboratory Diagnosis of Transition of Chronic Hepatitis B to The inactive Carrier State 0 100 200 300 400 500 600 700 800 0 1 2 3 4 5 6 12 24 36 48 60 72 80 92 104 Seeger, Zoulim, Mason, Fields Virology 2007
    49. 49. 0 50 100 150 200 250 300 350 400 450 0 3 6 9 12 15 18 21 24 27 30 33 36 39 42 45 48 ALT HBsAg HBV DNA Normal ALT levels Months ALTandHBVDNA IU/Landmillioncopies/ml Anti-HBeHBeAg Laboratory Diagnosis of HBeAg negative Chronic Hepatitis B Seeger, Zoulim, Mason, Fields Virology 2007
    50. 50. 0,001 0,01 0,1 1 10 100 1000 ALAT ADN- VHB AgHBe +AgHBe + anti-HBe +anti-HBe + UI/mlUI/ml pg/mlpg/ml AgHBsAgHBs Tolérance hép chronique p. inactif mt pré-core VHB occulte hybridationhybridation PCRPCR 9 log 8 log 7 log 6 log 5 log 4 log 3 log 2 log 1 log
    51. 51. HBV DNA concentration in log IU/mL Ranges of quantitative HBV DNA assays 0 2 4 6 8 10 COBAS Amplicor HBV Monitor COBAS Taqman 48 HBV Amplicor HBV Monitor Roche Molecular Systems Bayer Corp. Versant HBV DNA 3.0 Versant HBV DNA 1.0 Digene Corp. HBV Digene Hybrid Capture I Artus Biotech HBV Digene Hybrid Capture II Ultra-Sensitive Digene Hybrid Capture II Real Art HBV PCR Assay Abbott Molecular ABBOTT real time HBV DNA assay
    52. 52. Formes cliniques
    53. 53. MANIFESTATIONSMANIFESTATIONS EXTRAHEPATIQUES DU VHBEXTRAHEPATIQUES DU VHB • PANPAN – Complexes immuns circulants HBs/anti-HBsComplexes immuns circulants HBs/anti-HBs – Dépots artères moyens et petit calibreDépots artères moyens et petit calibre – Traitement : plasmaphéreses, corticoides, antivirauxTraitement : plasmaphéreses, corticoides, antiviraux (vidarabine / IFN / famciclovir / lamivudine)(vidarabine / IFN / famciclovir / lamivudine) • GlomérulonéphritesGlomérulonéphrites • CryoglobulinémiesCryoglobulinémies • Guillain-BarréGuillain-Barré • MyocarditeMyocardite
    54. 54. TRANSMISSION VERTICALE DU VHBTRANSMISSION VERTICALE DU VHB • mère AgHBe +mère AgHBe + – transmission : 90%transmission : 90% • mère anti-HBe +mère anti-HBe + – transmission : 10-20%transmission : 10-20% – VHB muté pré-C (-) : hépatites fulminantesVHB muté pré-C (-) : hépatites fulminantes • chronicité chez l’enfant : 90%chronicité chez l’enfant : 90%
    55. 55. PRESENTATION CLINIQUEPRESENTATION CLINIQUE • INFECTION PERI-NATALEINFECTION PERI-NATALE – ALT normales ou subnormalesALT normales ou subnormales – ADN-VHB > 1000 pg/mlADN-VHB > 1000 pg/ml – histologie : lésions minimeshistologie : lésions minimes • INFECTION POST-NATALEINFECTION POST-NATALE – ALT élevéesALT élevées – ADN-VHB < 1000 pg/mlADN-VHB < 1000 pg/ml – histologie : hépatite modérée à sévèrehistologie : hépatite modérée à sévère • CARCINOME HEPATOCELLULAIRE : 30 ANSCARCINOME HEPATOCELLULAIRE : 30 ANS
    56. 56. Histoire naturelle de l’infection chronique par le virus de l’hépatite B en Alaska • McMahon BJ, Ann Intern Med 2001;135(9):759-68McMahon BJ, Ann Intern Med 2001;135(9):759-68 • 1536 natifs d’Alaska : 641 AgHBe+, 83 anti-HBe+1536 natifs d’Alaska : 641 AgHBe+, 83 anti-HBe+ • Probabilité d’éliminer l’Ag HBe à 10 ans : 72,5 %.Probabilité d’éliminer l’Ag HBe à 10 ans : 72,5 %. • Elimination de l’Ag HBs chez 106 porteursElimination de l’Ag HBs chez 106 porteurs chroniques du VHB (7 %)chroniques du VHB (7 %) • Incidence des événements cliniques: 2,3/1000Incidence des événements cliniques: 2,3/1000 porteurs/annéeporteurs/année • Incidence du CHC: 1,9/1000 porteurs/année (2,3 chezIncidence du CHC: 1,9/1000 porteurs/année (2,3 chez l’homme; 1,2 chez la femme).l’homme; 1,2 chez la femme).
    57. 57. Pathophysiologic Cascade of Chronic HBV Infection HBV ReplicationHBV Replication (Measured by(Measured by Serum HBV DNA)Serum HBV DNA) HBV ReplicationHBV Replication (Measured by(Measured by Serum HBV DNA)Serum HBV DNA) LiverLiver InflammationInflammation LiverLiver InflammationInflammation Worsening HistologyWorsening Histology • NecroinflammationNecroinflammation • FibrosisFibrosis • CirrhosisCirrhosis Worsening HistologyWorsening Histology • NecroinflammationNecroinflammation • FibrosisFibrosis • CirrhosisCirrhosis Disease ProgressionDisease Progression • Liver FailureLiver Failure • Liver CancerLiver Cancer • TransplantTransplant • DeathDeath Disease ProgressionDisease Progression • Liver FailureLiver Failure • Liver CancerLiver Cancer • TransplantTransplant • DeathDeath Adapted from: Lavanchy D. Journal of Viral Hepatitis, 2004, 11, 97–107. Chen JC, et al. JAMA. 2006;295:65-73. Iloeje U. H, et al. Gastroenterology. 2006;130:678-86. ALTALT ElevationElevation ALTALT ElevationElevation
    58. 58. Normal Aminotransferase Levels and Risk of Mortality from Liver Diseases Kim HC et al.Kim HC et al. BMJBMJ 2004; 328:9832004; 328:983 0 10 20 30 40 50 60 70 80 90 Risk ratio (95% CI) <20 20-29 30-39 40-49 50-99 >100 ALT 1.01.0 2.92.9 9.59.5 19.219.2 30.030.0 59.059.0 NormalNormal ElevatedElevated • Korea Medical Insurance Corporation – 94,533 men; 47,522 women – 35-59 yrs old – Relative risk for liver mortality compared with AST and ALT <20 IU/l
    59. 59. Survie chez les patients au stade cirrhose 1. Weissberg et al. Ann Intern Med. 1984;101:613. 2. De Jongh et al. Gastroenterology. 1992;103:1630. 1 32 4 50 20 40 60 100 80 Cirrhosis1 (n = 130) Decompensated cirrhosis2 (n = 21) 14% 55% PatientsSurviving,% Years 0
    60. 60. AgHBeAg et risque de CHC Yang et al. N Engl J Med. 2002;347:168-174. Cumulativeincidence(%) Year HBsAg+ HBeAg+ HBsAg+, HBeAg - HBsAg -, HBeAg - 62 10 0 4 6 8 12 10 2 0 4 8 • 11,893 Taiwanese men; 92,359 person-years follow-up
    61. 61. Charge virale et incidence du CHC Chen et al; JAMA 2006
    62. 62. REVEAL-Incidence of HCC Increases with Increasing HBV DNA Baseline Viral Level Chen JC, et al. JAMA. 2006;295:65-73. 14.9% 12.2% 3.6% 1.4%1.3% 0% 5% 10% 15% 20% <300 >300 - 103 Baseline HBV DNA (copies/mL) %cumulativeincidenceofHCC > 103 - 104 >104 - 106 ≥106
    63. 63. High Baseline Serum HBV DNA Levels are Associated with Increased Risk of HCC Mortality in HBsAg-Positive Patients 80% 84% 88% 92% 96% 100% 0 1 2 3 4 5 6 7 8 9 10 11 12 Survival time (Years) Survival distribution function HBV DNA Negative HBV DNA LowHBV DNA Low < 10< 1055 copies/mLcopies/mL RR = 1.7 (0.5-5.7)RR = 1.7 (0.5-5.7) HBV DNA HighHBV DNA High ≥≥ 101055 copies/mLcopies/mL RR = 11.2 (3.6-35.0)RR = 11.2 (3.6-35.0)p < 0.001 across viral categories http://www.fccc.edu/docs/sci_report/Evans.pdf#search=%22haimen. Accessed 1/23/07. Chen G, et al. J Hepatology 2005; 42 (suppl 2):477A. Chen G, et al. Hepatology 2005; 40 (suppl 1):594A.
    64. 64. Relationship Between Persistent Viremia and HCC: Argument For Antiviral Therapy • Persistent replication associated with greater risk of HCC • Decreased risk when viral replication declines Chen, et al. JAMA 2006 Baseline HBV DNA, (copies/mL) < 104 ≥105 ≥105 ≥105 Follow-up HBVDNA, copies/mL --- < 104 104 to <105 ≥105 Adjusted RR (95% CI) 1.0 (ref) 3.6 (1.7-7.6) 6.9 (3.4-13.8) 9.1 (5.8-14.1) P Value -- < 0.001 < 0.001 < .001 HCCIncidence RatePer100,000 0 1473 5882 8730 10,108 2.0x103 4.0x103 6.0x103 8.0x103 1.0x104 1.2x104
    65. 65. Impact Clinique de la Variabilité du Génome Viral
    66. 66. VARIABILITE GENETIQUE DU VHBVARIABILITE GENETIQUE DU VHB • Multiplication viraleMultiplication virale » taux d'erreur de la transcriptase inversetaux d'erreur de la transcriptase inverse • Pression de sélectionPression de sélection » réponse immunitaire cellulaire / humoraleréponse immunitaire cellulaire / humorale » antivirauxantiviraux -> possibilité de variants d'échappement-> possibilité de variants d'échappement • Conséquences cliniquesConséquences cliniques » diagnostic sérologiquediagnostic sérologique » traitements antivirauxtraitements antiviraux
    67. 67. • SOUS-TYPES : acides aminés et déterminants HBsSOUS-TYPES : acides aminés et déterminants HBs – boucle 139-147 -> det aboucle 139-147 -> det a – 122 -> det d ou y122 -> det d ou y – 127 -> det w1-4127 -> det w1-4 – 160 -> det w ou r160 -> det w ou r • GENOTYPES : variabilité de séquence génomiqueGENOTYPES : variabilité de séquence génomique – du génome complet : 8%du génome complet : 8% – du gène S : 4%du gène S : 4% – 8 génotypes A à H8 génotypes A à H • MUTANTS DU VHBMUTANTS DU VHB – mutations ponctuelles / délétions / insertionsmutations ponctuelles / délétions / insertions VARIABILITE GENETIQUE DU VHBVARIABILITE GENETIQUE DU VHB
    68. 68. 8 genotypes, numerous sub-genotypes, and recombinant forms World J Gastroenterol 2007; 13: 14-21 D/E B6 D1
    69. 69. Génotypes VHB chez les patients atteintsGénotypes VHB chez les patients atteints d’hépatite chronique en Franced’hépatite chronique en FranceNumberofsubjectsNumberofsubjects FF GGAA BB CC DD EE 00 1010 2020 3030 4040 5050 6060 7070 8080 9090 100100 30.2%30.2% 7.9%7.9% 12.5%12.5% 37.4%37.4% 11.3%11.3% 0.4 %0.4 % 1.1%1.1% Zoulim et al J Viral Hepatitis 2006
    70. 70. Impact du génotype sur la séroconversion 1 Janssen, Lancet 2005; 2 Flink, Am J Gastro 2006 PEG-IFN a-2b HBeAg Loss 1 0 10 20 30 40 50 A n=90 28% 47% 44% 25% B n=23 C n=39 D n=103 Percentageofpatients(%) HBV genotype 0 3 6 9 12 15 A n=90 5% 8% 0% B n=23 C n=39 D n=103 18 15% Percentageofpatients(%) 21 HBV genotype PEG-IFN a-2b HBsAg Loss 2
    71. 71. LES MUTANTS DU GÉNOME DU VHBLES MUTANTS DU GÉNOME DU VHB déterminant adéterminant a vaccin/HBIgvaccin/HBIg polymérasepolymérase antivirauxantiviraux Mt pré-coreMt pré-core Réponse anti-eRéponse anti-e ?? Mt coreMt core Réponse CTLRéponse CTL
    72. 72. ROLE DE LA RÉGION PRÉ-C ET DE L’AgHBeROLE DE LA RÉGION PRÉ-C ET DE L’AgHBe • Non nécessaire à la réplication du VHBNon nécessaire à la réplication du VHB – Culture cellulaireCulture cellulaire – Modèles in vivoModèles in vivo • MarmotteMarmotte • CanardCanard • Modulation de la réponse immuneModulation de la réponse immune – Tolérogène : souris transgéniquesTolérogène : souris transgéniques – Cible de la réponse anti-capsideCible de la réponse anti-capside Chang et al, J. Virol 1987; Schlicht et al J. Virol 1987; Chen J. Virol 1992; Millich et al PNASChang et al, J. Virol 1987; Schlicht et al J. Virol 1987; Chen J. Virol 1992; Millich et al PNAS
    73. 73. LES MUTANTS PRÉ-C (-)LES MUTANTS PRÉ-C (-) • codon stop / région pré-Ccodon stop / région pré-C TGG -> TTGG -> TAAG en pos. 1896G en pos. 1896 – génotypes B à E (A : exceptionnel)génotypes B à E (A : exceptionnel) – arrêt traduction protéine pré-C/Carrêt traduction protéine pré-C/C – AgHBe négatifAgHBe négatif • mutation dans promoteur pré-Cmutation dans promoteur pré-C TTAAAGG -> TTAATTAAAGG -> TTAATTGGAA en pos. 1762 /1764en pos. 1762 /1764 – génotypes A à Egénotypes A à E – transcrits pré-C/C :transcrits pré-C/C : – synthèse d'AgHBe :synthèse d'AgHBe : Carman et al Lancet 1989, Okamoto et al J Virol 1990/1994, Tong et al Virology 1990Carman et al Lancet 1989, Okamoto et al J Virol 1990/1994, Tong et al Virology 1990
    74. 74. HBeAg and Precore Mutation 1814 1901 Precore Core region region HBcAg HBeAg G 1896A = stop codon, TAG ATG ATG Virion Serum Core gene
    75. 75. HBeAg and Precore Mutation 1814 1901 Precore Core region region HBcAg HBeAg ATG ATG Virion Serum Core gene
    76. 76. VARIANTS NÉGATIFS POUR L ’AgHBeVARIANTS NÉGATIFS POUR L ’AgHBe mRNAmRNA ProtéineProtéine pré-C/Cpré-C/C PRE-CPRE-C CCPROMOTEURPROMOTEUR TAGTAG****** 1762-17641762-1764 18961896 arrêt des synthèses protéiquesarrêt des synthèses protéiques Diminution de l’expression de l ’AgHBeDiminution de l’expression de l ’AgHBe
    77. 77. Main pre-c/core promoter mutations observed in vivo GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCATAAATT Pre-C mRNAPre-C mRNA Basic core promoter 17621762 6464 TTGGAA LEF HNF1GGTTAATNATTA HNF4AGGTCA TTTTAA 6666 6868 Deletion 63-70 Insertion (RGTTAATYATTA) at 74/75 Mutation AGG to TCA and insertion TA at 65/66 WTRTTKRY Insertion (TTG) at 66/67 TTTTGG HNF3
    78. 78. Sélection des mutants pré-core au cours deSélection des mutants pré-core au cours de l’histoire naturelle de l’hépatite B chroniquel’histoire naturelle de l’hépatite B chronique 0 500 1000 1500 2000 2500 temps ALATALAT ADN-VHBADN-VHB AgHBeAgHBe Anti-HBeAnti-HBe 0 20 40 60 80 100 temps sauvagesauvage Mt pré-CMt pré-C
    79. 79. Outcome of Chronic Anti-HBe Positive Hepatitis B 0 100 200 300 400 0 100 200 300 400 0 100 200 300 400 Biochemical patterns in 164 untreated patientsBiochemical patterns in 164 untreated patients after 23 months (range 12-36) monthly monitoringafter 23 months (range 12-36) monthly monitoring 00 1212 2424 monthsmonths With flares and normalizationWith flares and normalization Without flaresWithout flares With flares and without normalizationWith flares and without normalization 73 pts73 pts ( 44.5% )( 44.5% ) 59 pts59 pts ( 36.0% )( 36.0% ) 32 pts32 pts ( 19.5% )( 19.5% ) AsymptomaticAsymptomatic flare-up:flare-up: 90% of cases90% of cases AA LL TT Flare-up yearlyFlare-up yearly frequency:frequency: once 57.1%once 57.1% twice 20%twice 20% < once 22.8%< once 22.8% Brunetto MR et al, J Hepatol 2002Brunetto MR et al, J Hepatol 2002
    80. 80. Augmentation de prévalence des hépatites chroniques avec AgHBe négatif en France HBeAg(+) HBeAg(-) 48% N=119 62% N=164 Zoulim et al, J Viral Hepatitis 2006
    81. 81. No pre-core mutationNo pre-core mutation (n = 42; 14.8%)(n = 42; 14.8%) Both mutationsBoth mutations (n = 95; 33.6%)(n = 95; 33.6%) Promoter mutationPromoter mutation (n = 99; 27.9%)(n = 99; 27.9%) Stop codon mutationStop codon mutation (n = 55; 19.4%)(n = 55; 19.4%) Data unavailableData unavailable (n = 12; 4.2%)(n = 12; 4.2%) Pre-core mutationsPre-core mutations Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
    82. 82. HBe serotype and pre-core mutationsHBe serotype and pre-core mutations 00 1010 2020 3030 4040 5050 6060 7070 8080 9090 No pre-coreNo pre-core mutationmutation Stop codonStop codon mutationmutation PromoterPromoter mutationmutation BothBoth mutationsmutations NumberofsubjectsNumberofsubjects HBe-positiveHBe-positive HBe-negativeHBe-negative Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
    83. 83. MUTANTS PRÉ-C ET SÉVÉRITÉ HISTOLOGIQUEMUTANTS PRÉ-C ET SÉVÉRITÉ HISTOLOGIQUE LA CONTROVERSELA CONTROVERSE • ItalieItalie – Cirrhose plus fréquenteCirrhose plus fréquente • Bonino Gastroenterology 1986, Fattovich Hepatology 1988Bonino Gastroenterology 1986, Fattovich Hepatology 1988 • FranceFrance – Activité idem / cirrhose plus fréquenteActivité idem / cirrhose plus fréquente • Zarski et al, J Hepatol 1993Zarski et al, J Hepatol 1993 • Grandjacques et al, J Hepatol 2000Grandjacques et al, J Hepatol 2000 • Zoulim et al, J Viral Hepatitis 2006Zoulim et al, J Viral Hepatitis 2006 • AsieAsie – Mt promoteur : activité histologique et fibrose plus importanteMt promoteur : activité histologique et fibrose plus importante – Mt pré-C : activité histologique moins importanteMt pré-C : activité histologique moins importante • Lindh et al, J Infect Dis 1999Lindh et al, J Infect Dis 1999 – Rémission histologiqueRémission histologique • Chan et al, Hepatology 1999Chan et al, Hepatology 1999 • AfriqueAfrique – Mt promoteur : plus fréquents dans le CHCMt promoteur : plus fréquents dans le CHC • Baptista et al, Hepatology 1999Baptista et al, Hepatology 1999
    84. 84. HBe serotype and liver pathologyHBe serotype and liver pathology 0-40-4 5-95-9 10-1410-14 15-2215-22 00 1010 2020 3030 4040 5050 6060 7070 Knodell scoreKnodell score NumberofsubjectsNumberofsubjects Metavir scoreMetavir score ≤≤ F2F2 F3F3 F4F4 00 1010 2020 3030 4040 5050 6060 7070 HBe-positiveHBe-positive HBe-negativeHBe-negative Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
    85. 85. HÉPATITES FULMINANTES ET MUTANTS PRE-CHÉPATITES FULMINANTES ET MUTANTS PRE-C • Lien de causalité :Lien de causalité : – Épidémies hépatites fulminantesÉpidémies hépatites fulminantes – Transmission souche mutée pré-C (-)Transmission souche mutée pré-C (-) – Rôle immunomodulateur de l ’AgHBeRôle immunomodulateur de l ’AgHBe • Pas de lien de causalitéPas de lien de causalité – Séquençage génome completSéquençage génome complet – Pas de profil commun de mutationPas de profil commun de mutation • Sélection des mutants par la réponse immunitaire cytotoxiqueSélection des mutants par la réponse immunitaire cytotoxique dirigée contre la souche à l ’origine de l ’HFdirigée contre la souche à l ’origine de l ’HF Stuyver et al, Hepatology 1999, Sternbeck et al Hepatology 1996, Liang et al, NEJM 1991Stuyver et al, Hepatology 1999, Sternbeck et al Hepatology 1996, Liang et al, NEJM 1991
    86. 86. DIAGNOSTICS DIFFICILESDIAGNOSTICS DIFFICILES I. Porteur inactifI. Porteur inactif II. ExacerbationII. Exacerbation
    87. 87. Diagnosis of inactive carrier versusDiagnosis of inactive carrier versus HBeAg negative chronic hepatitisHBeAg negative chronic hepatitis • Inactive CarrierInactive Carrier – Persistently normal ALT levelsPersistently normal ALT levels – Persistently low levels of serum HBV DNAPersistently low levels of serum HBV DNA • Threshold : 10Threshold : 1033 copies / mL ?copies / mL ? • HBeAg negative chronic hepatitisHBeAg negative chronic hepatitis – Fluctuation / exacerbation of ALTFluctuation / exacerbation of ALT – Fluctuations of HBV DNA levels usually below 10Fluctuations of HBV DNA levels usually below 1066 copies / mLcopies / mL – Presence of pre-core / core promoter mutationsPresence of pre-core / core promoter mutations
    88. 88. DIAGNOSTIC D'UNE EXACERBATION AIGUEDIAGNOSTIC D'UNE EXACERBATION AIGUE SUR HEPATITE B CHRONIQUESUR HEPATITE B CHRONIQUE • Définition : poussée cytolytiqueDéfinition : poussée cytolytique ≠ réactivation viraleréactivation virale • Ag HBe + initialementAg HBe + initialement – rupture de tolérance immunitairerupture de tolérance immunitaire – séroconversion anti-HBeséroconversion anti-HBe – très fréquent chez patients asiatiquestrès fréquent chez patients asiatiques • Anti-HBe + initialementAnti-HBe + initialement – réactivation virus sauvage : -> AgHBe +réactivation virus sauvage : -> AgHBe + – réactivation virus muté pré-C (-)réactivation virus muté pré-C (-) – corticothérapiecorticothérapie – surinfection delta / VHCsurinfection delta / VHC
    89. 89. 0 5 10 15 20 25 0 1 2 5 9 12 13 16 months 1 10 100 1000 10000 100000 1000000 10000000 100000000 1000000000 10000000000 ALT pre-S1 bDNA PCR case#6case#6 Genotype AGenotype A pre-C promoterpre-C promoter WTWT MTMT pre-C regionpre-C region WTWT M2M2 M4M4 M2+M4M2+M4 -- ++ -- ++ ++ ++ ++ -- -- ++ ++ -- ++ -- -- -- ++ -- -- -- ++ -- -- -- ++ -- -- -- ++ -- -- -- ++ -- -- -- HBeAgHBeAg Anti-HBe AbAnti-HBe Ab -- ++ ++ ++ ++ -- -- ++ -- ++ ++ -- -- ++ -- ++ interferoninterferon Pichoud et al, J hepatol 2000
    90. 90. COOH 137 149 107 99 NH2 S - S S - S S - S S- S S-S 138 139 147 Tiollais P. et al., Nature 1985. Torresi J., J. Clin Virol 2002; Dryden KA. et al., Mol Cell 2006 « a » determinant HBs Ag « a » determinant induces the synthesis of anti-HBs neutralizing antibodies sG145R sP120T sD144H/A/E PreS1 PreS2 SPol Pré-C C Brin(+) 2,4kb Brin(-) 3,2kb X TATAA U5-like DR1 DR2 Enh1Enh2 G R E 0/3221 SHBs (S) MHBs (preS2+S) LHBs (preS2+preS2+S)
    91. 91. Variants de l'Ag HBsVariants de l'Ag HBs • échappement à la réponse humorale anti-HBséchappement à la réponse humorale anti-HBs – naturellenaturelle – vaccination (transmission mère-enfant)vaccination (transmission mère-enfant) – immunoprophylaxie (transplantation hépatique)immunoprophylaxie (transplantation hépatique) • infection active malgré Ac anti-HBsinfection active malgré Ac anti-HBs • sérologie AgHBs faussement négativesérologie AgHBs faussement négative Risques : transmission virale + infections occultesRisques : transmission virale + infections occultes
    92. 92. VARIANTS DE L'AgHBsVARIANTS DE L'AgHBs • Mutations ponctuelles dans le déterminant a deMutations ponctuelles dans le déterminant a de l'AgHBs (124-147)l'AgHBs (124-147) – aa 145 : Gly -> Argaa 145 : Gly -> Arg – aa 126 : Ile -> Ser / Thr -> Asnaa 126 : Ile -> Ser / Thr -> Asn • transmission mère-enfant malgré la serovaccinationtransmission mère-enfant malgré la serovaccination (3%)(3%) • infection du greffon hépatique malgréinfection du greffon hépatique malgré Immunoglobulines anti-HBsImmunoglobulines anti-HBs • hépatites chroniques avec anti-HBc et anti-HBs +hépatites chroniques avec anti-HBc et anti-HBs +
    93. 93. Presence of HBV DNA in the liver (± serum) of individuals testing HBsAg negative by currently available assays Occult HBV Infection (OBI) Raimondo et al, J Hepatol 2008
    94. 94. How to Detect Occult HBV Infection Currently there is no standardized diagnostic assay for occult HBV infection
    95. 95. Reported Prevalence of Occult HBV Infection in HIV Positive Patients Study Country N° of patients Occult HBV N° (%) Methods Hofer, 1998 Switzerland 57 51 (89%) “nested” PCR (serial evaluation) Torres-Baranda, 2006 Mexico 35 7 (20%) “nested” PCR Filippini, 2006 Italy 86 17 (20%) single step PCR Mphahlele, 2006 South Africa 140 31 (22.%) “nested” PCR Pogany, 2005 Netherlands 93 4 (4%) single step PCR Neau, 2005 France 160 1 (0.6%) Santos, 2003 Brazil 101 16 (16%) single step PCR Wagner, 2004 France 30 11 (37%) “nested” PCR Goncales, 2003 Brazil 159 8 (5%) “nested” PCR Nunez, 2002 Spain 85 0 Cobas Amplicor HBV Monitor (Roche) Piroth, 2000 France 37 13 (35%) single step PCR Raffa, 2007 Italy “nested” PCR (liver) Cobas Amplicor HBV Monitor (Roche) 101 42 (41%) Raimondo et al, J Hepaol 2007, modified
    96. 96. OBI Cause(s) for the failure of HBsAg detection Suppression of HBV replication and gene expression Infection by S gene Variants “false” OBI
    97. 97. Occult HBV infection HBV cccDNA Integrated HBV DNA HBV mutants Epigenetic control HBV replication Immune surveillance Viral co-infections
    98. 98. OBI SeropositiveSeropositive SeronegativeSeronegative HBsAg lost during CH HBsAg lost during CH HBsAg lost after AH HBsAg lost after AH Progressive antibody disappearence Progressive antibody disappearence Primary occultPrimary occult Schematic representation of HBV serum marker profile in OBI and “false” OBI „false“ OBI S gene escape mutants S gene escape mutants HBV DNA levels comparable to overt infection HBV DNA levels < 200 UI/ml
    99. 99. Occult hepatitis B Torbenson M. & Thomas D.L., Lancet Inf Dis, 2002
    100. 100. High prevalence ROLE in HCC Diagnostic Tools ? Worsen HCV infection ? Co-infections ? Therapy? To be improved Specific treatments ? Not fully understood ? Occult HBV infections: unresolved issues
    101. 101. AntivirauxAntiviraux Persistance viralePersistance virale Resistance aux antivirauxResistance aux antiviraux Monitoring des traitementsMonitoring des traitements
    102. 102. Goals and types of responseGoals and types of response Biochemical responseBiochemical response - normalization of ALT levels- normalization of ALT levels Virological responseVirological response - HBV DNA < 10- HBV DNA < 1044 or 10or 1033 copies/mLcopies/mL Histological responseHistological response - improvement in HAI or Metavir score- improvement in HAI or Metavir score Combined responseCombined response Complete responseComplete response -> decrease in viral load-> decrease in viral load -> normalization of ALT levels-> normalization of ALT levels -> HBe/HBs seroconversion-> HBe/HBs seroconversion -> improvement of liver disease-> improvement of liver disease Hoofnagle, J Hepatol 2003Hoofnagle, J Hepatol 2003
    103. 103. Mommeja-Marin H et al. Hepatology 2003Mommeja-Marin H et al. Hepatology 2003 Median logMedian log1010 HBV DNA level decrease from BaselineHBV DNA level decrease from Baseline Efficacy : Correlation between HBV DNAEfficacy : Correlation between HBV DNA response and histologic benefitresponse and histologic benefit MedianHistologicActivityIndexMedianHistologicActivityIndex ImprovementfromBaselineImprovementfromBaseline 11 22 33 44 55 IFNIFN
    104. 104. Definition of response to therapyDefinition of response to therapy Initial responseInitial response - decrease in viral load by at least one log10- decrease in viral load by at least one log10 Maintained responseMaintained response - viral load below 12IU /mL- viral load below 12IU /mL End of treatment responseEnd of treatment response Sustained reponseSustained reponse -> can we stop therapy ?-> can we stop therapy ?
    105. 105. Pyrimidine dideoxynucleoside analogues 2 ’ Fluoro-substituted arabinosylpyrimidines Lamivudine Emtricitabine ElvucitabineClevudine OH O OHN HN O O CH3 β-L-2’-deoxythymidine telbivudine Purine dideoxynucleoside analogues acyclic nucleoside phosphonates carbocyclic guanosine analogue entecaviradefovir N N N N NH2 P O HO HO O CH3 tenofovir PMPA
    106. 106. Anti-HBV Active Compounds Drug type Approved Phase 3 Phase 2 Nucleoside analogs Lamivudine Entecavir Telbivudine Emtricitabine* Clevudine** Elvucitabine Valtorcitabine Amdoxovir Racivir LB80380 Nucleotide analogs Adefovir Tenofovir Alamifovir Pradefovir Cytokines Interferon alfa Peg-interferon alfa-2a * Currently approved for HIV ** Approved in South Korea
    107. 107. L(-)-SddC, 3TCL(-)-SddC, 3TC LamivudineLamivudineL(-)-SddCL(-)-SddC mitochondriamitochondria nucleusnucleus L(-)-SddC-TPL(-)-SddC-TP HBV DNAHBV DNA Nuclear DNANuclear DNA Mt DNAMt DNA L(-)-SddC-TPL(-)-SddC-TP L(-)-SddC-TPL(-)-SddC-TP cytoplasmcytoplasm kinasekinase L(-)-SddUL(-)-SddU deaminasedeaminase Bridges; Progress in Liver Disease 1995
    108. 108. interaction Virion Nucleus Hepatocyte translation encapsidation reverse transcription pgRNADNA (-) cccDNA amplification transcription mRNA pgRNA AAA AAA AAA AAA cccDNAcccDNA cccDNA formation RC DNA entry polymerase DNA (+) (+) strand synthesis virion secretion ER HBeAg HBsAg receptor ? ER viral proteins secretion The HBV life cycle Zoulim et al Future Virology 2006 Nucleoside analogs
    109. 109. Blood stream viral load Infected hepatocytes Infected liver CD8 NKT CD4 B
    110. 110. Blood Stream Viral Load Infected hepatocytes Infected Liver Antiviral CD8 NKT CD4 B
    111. 111. uncoating CCC DNA removal of protein primer removal of RNA primer completion of viral (+) strand DNA ligation of DNA strands extremities supercoiled DNA minichromosome viral polymerase? DNA repair protein? other cellular enzymes? topoisomerase? Acetyl transferase ? Histones Formation of the recalcitrant cccDNA: a difficultFormation of the recalcitrant cccDNA: a difficult target for antiviral therapytarget for antiviral therapy Tuttleman et al Cell 1986 Le Guerhier et al AAC 2000 Delmas et al AAC 2002 Kock et al Hepatology 2003 Antivirals ?
    112. 112. Can we prevent cccDNA formation ? Nucleoside analogs in monotherapy or combination therapy cannot prevent the de novo formation of cccDNA in hepatocyte culture and in vivo in animal experiments (Delmas et al AAC 2000; Seigneres et al AAC 2002) Can we clear cccDNA from a chronically infected cell ? The decrease of intrahepatic cccDNA during nucleoside analog requires hepatocyte turn over in animal experiments (Zhu et al J Virol 2001; Litwin et al J Clin Virol 2005) QuickTime™ et un décompresseur TIFF (non compressé) sont requis pour visionner cette image.
    113. 113. Kinetics of Viral Loss During Antiviral Therapy with L-Kinetics of Viral Loss During Antiviral Therapy with L- FMAU (clevudine) in the woodchuck modelFMAU (clevudine) in the woodchuck model Zhu et al, J Virol 2001
    114. 114. M0 M2 M6 L-FMAU + FTC + Ad-IFNL-FMAU + FTC + Ad-IFNγγ UntreatedUntreated M0 M2 M6 M0 M2M1 Failure to eradicate cccDNA with a combination ofFailure to eradicate cccDNA with a combination of nucleoside analogs and IFN gammanucleoside analogs and IFN gamma Jacquard et al AAC 2004Jacquard et al AAC 2004
    115. 115. ADV Associated Serum HBsAg Reductions are Similar in Magnitude to cccDNA Reductions -6 -5 -4 -3 -2 -1 0 Changes in HBV Markers from Baseline (log 10 copies/cell(ml)) Serum HBV DNA Total Intracellular DNA cccDNA Serum HBsAg  48 weeks of ADV resulted in significant reductions in :48 weeks of ADV resulted in significant reductions in : serum HBV DNA > total intrahepatic HBV DNA > cccDNAserum HBV DNA > total intrahepatic HBV DNA > cccDNA  Changes in HBsAg levels correlated with cccDNA changesChanges in HBsAg levels correlated with cccDNA changes -> 14 years of therapy to clear completely viral cccDNA-> 14 years of therapy to clear completely viral cccDNA Werle et al, Gastroenterology 2004
    116. 116. • 0.8 log10 (84%) decline in cccDNA, not paralleled by a similar decline in the number of HBcAg+ cells • Suggests cccDNA depleted primarily by non-cytopathic mechanisms or that cell turn-overSuggests cccDNA depleted primarily by non-cytopathic mechanisms or that cell turn-over occurred but was associated with infection of new cells during therapyoccurred but was associated with infection of new cells during therapy Immunohistochemical Staining of Patient Biopsies atImmunohistochemical Staining of Patient Biopsies at Baseline and After 48 Weeks ADV TherapyBaseline and After 48 Weeks ADV Therapy BaselineBaseline Week 48Week 48
    117. 117. Maynard et al, J Hepatol 2005Maynard et al, J Hepatol 2005 Persistence of cccDNA after HBs seroconversionPersistence of cccDNA after HBs seroconversion
    118. 118. Clearance of viral infection versus selection ofClearance of viral infection versus selection of escape mutantsescape mutants The most important factors to consider:The most important factors to consider: § The rate of immune killing of infected hepatocytesThe rate of immune killing of infected hepatocytes § The rate of replication and spread of mutant virus in theThe rate of replication and spread of mutant virus in the chronically infected liver (I.e. fitness of the virus: the rate ofchronically infected liver (I.e. fitness of the virus: the rate of spread to uninfected hepatocytes)spread to uninfected hepatocytes) § Small changes in these factors may have profound effect onSmall changes in these factors may have profound effect on whether treatment response is durable or subject to rapidwhether treatment response is durable or subject to rapid reboundrebound (Litwin et al J Clin Virol 2005)(Litwin et al J Clin Virol 2005) § These factors may be subject to therapeutic interventionThese factors may be subject to therapeutic intervention
    119. 119. LamivudineLamivudine II IIII IIIIII IVIV wtwt mtmt nini INHIBITION OF WILD TYPE VIRUS REPLICATIONINHIBITION OF WILD TYPE VIRUS REPLICATION DELAYED EMERGENCE OFDELAYED EMERGENCE OF DRUG RESISTANT VIRUSDRUG RESISTANT VIRUS XX XX XX XX XX XXXX Zhou et al AAC 1999 Kinetics of emergence of drug resistantKinetics of emergence of drug resistant virus during antiviral therapyvirus during antiviral therapy • Free liver space • Mutant fitness
    120. 120. 1,E+01 1,E+03 1,E+05 1,E+07 1,E+09 -3 1 5 9 13 17 21 25 29 33 Viralload LamivudineLamivudine Changement de la quasi-espèce virale et de la sensibilité auxChangement de la quasi-espèce virale et de la sensibilité aux drogues pendant le traitement antiviraldrogues pendant le traitement antiviral 0 0,1 0,2 0,4 0,8 1,6 3,2 6,3 12,5 mM Lamivudine 3 2 1.5 1.2 1 Lamivudine 0 1,6 3,2 6,3 12,5 25 50 100 mM 3 2 1.5 1.2 Linear ds HBV 1 IC50» 0.1µM IC90 » 2 µM IC50> 50µM IC90>>100µM Quasi-espèce Phenotype Quasi-espèce Durantel, Hepatology 2004
    121. 121. Mechanisms of HBV Drug Resistance Viral persistence cccDNA Long half-life Infected cells Long half-life DefectiveDefective immuneimmune responseresponse VirusVirus HepatocytesHepatocytes Impairment ofImpairment of innate responseinnate response HostHost Selective pressure Antivirals or others Viral polymerase spontaneous error rate VirusVirus Selection of escapeSelection of escape mutantsmutants Treatment failureTreatment failure Replication fitness Replication space Viral quasi-species Immune response Drug PK Zoulim Antivir Res 2004;64:1–15
    122. 122. Polymerase gene mutations reponsible for drug resistance Allen et al. Hepatology 1998; Gish et al. J Hepatol 2005; Qi et al. J Hepatol 2004; Tenney et al. AAC 2004 & 2007; Lai et al. Gastroenterology 2005; Sheldon et al. Antivir Ther 2005; Delaney et al. AAC 2006 ; Schildgen et al NEJM 2006 ; Borroto-Esoda JID 2007; Durantel et al Antiviral Therapy 2008; Villet et al Gastroenterology 2006, J Hepatol 2007 & 2008; Warner et al Hepatology 2008 RNaseH 845 a.a. Terminal protein Spacer Pol/RTPol/RT AA BB CC EEDD 1 183 349 692 YMDD V173L L180M M204I/V GVGLSPFLLA I(G)I(G) II(F)II(F) (rt1) (rt 344) LAM / FTC ETV I169T T184G S202G/I M250V ADV A181V/T N236T I233V ? LdT M204I TDF A194T ? M204I/V
    123. 123. Mechanisms of resistance
    124. 124. Treatment failure Primary non response Partial response Secondary treatment failure Antiviral drug resistance Host factors Drug metabolism Patient’s compliance Drug factors Antiviral potency Drug factors Barrier to resistance Viral factors Resistant mutants
    125. 125. Partial response to adefovir dipivoxil is not due to the selection of DR mutants • The top 25% patients (quartile 1): > 4.91 log10 reduction in serum HBV DNA at week 48. • In Q2: 3.52 to 4.90 log10 reduction of viral load. • In Q3: 2.22 to 3.51 log10 reduction in viral load. • The bottom 25% of patients (Q4):< 2.22 log10 reduction in HBV DNA levels at week 48. • Phenotypic analysis of viral strains: Q4 as sensitive to ADV as Q1 strains • Documented Drug Compliance (% of days without taking ADV) • Wilcoxon rank sum test, P=0.01 Durantel et al, Antiviral Therapy, 2008 Virological Response Q1 (best response) (n=38) Virological Response Q2 (n=38) Virological Response Q3 (n=38) Virological Response Q4 (worse response) (n=38) Median 99% 99% 99% 97%a range 86-100% 41*-100% 91-100% 70-100%
    126. 126. M204V reduces pocket size Steric clash between lamivudine and V204 Wild-type M204/L180 L180 M204 LVD-TP LVDr M204V/L180M L180M M204V LVD-TP LVDr M204V/L180M L180M M204V ETV-TP Langley DR, et al. J Virol. 2007;81:3992-4001. Amino acid substitutions result in conformation changes of the polymerase catalytic site Minimal steric clash between entecavir and V204
    127. 127. Polymerase gene mutations may result in decreased inhibitory activity of antivirals Jacquard et al, Antimicrob Agents Chemother 2006 wt polymerase 3TC-R polymerase PMEA-R polymerase 3TC+PMEA-R polymerase Drug IC50 (µM) P IC50 (µM) P IC50 (µM) P IC50 (µM) P Elongation FLG-TP 4 ± 0.9 5.43 ± 0.6 7.8 ± 1.9 6.33 ± 1.3 3TC-TP 10.75 ± 4.8 <0.05 >100 <0.05 14 ± 5.7 <0.05 >100 <0.05 PMEA-DP 2.8 ± 0.3 >0.05 0.9 ± 0.1 <0.05 49.5 ± 3.4 <0.05 16.5 ± 7.2 <0.05
    128. 128. Definition of fitness • A parameter that quantifies the adaptation of an organism or a virus to a given environment • For a virus, ability to produce infectious progeny relative to a reference viral clone, in a defined environment Esteban Domingo, In Fields Virology 2007
    129. 129. Polymerase gene mutations Surface gene mutations wt none none mutant #1 T128I; V173L; L180M; A181V; N236T F20S; P120S; E164D; L173F mutant #2 T128I; V173L; L180M; A181V; M204V R79H; P120S; E164D; L173F; I195M; Y206F mutant #3 ∆111-120; T128I; V173L; L180M; A181V F20S; ∆102-111; P120S; E164D; L173F mutant #4 T128I; V173L; L180M; A181V; M204V; L220I; N236T P120S; E164D; L173F; I195M Polymerase clonal genetic analysis lamivudine adefovir HBIg wt Mutant #1 Mutant #2 Mutant #3 Mutant #4 Villet et al, Gastroenterology 2006
    130. 130. Villet, Billioud et al, Gastroenterology 2008 0 50 100 150 200 250 300 350 400 wt #1 #2 #3 #4 Mutant Mutantreplicationcapacity/wt(%) Viral replication capacity in the presence of both antivirals (LAM + ADV)
    131. 131. Mutant wt #1 #2 #3 #4 1,7 kb A B wt #1 #2 #3 #4 Mutant Mutantinfectivity/wt(%) 0 20 40 60 80 100 120 Villet, Billioud et al, Gastroenterology 2008 Infectivity of the mutants in HepaRG cells Impact of mutations in the overlapping S gene HDV hybrids with HBV mutant envelopes HDV replication in HepaRG cells as a reporter of infection
    132. 132. Kinetics of HBV drug resistance emergence Si Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Locarnini et al Antiviral Therapy 2004; Villet et al Gastroenterology 2006 J Hepatol 2007 & 2008; Pallier et al J Virol 2007; Yim et al Hepatology 2006. Treatment begins Drug-resistant variant Drug-susceptible virus Naturally—occurring viral variants Time HBVreplication Primary resistance mutations Secondary resistance mutations / compensatory resistance mutations
    133. 133. Model for the selection of drug resistant mutants Villet et al, J Hepatol 2007; Villet et al Gastroenterology 2006; Yim et al Hepatology 2006; Palier et al J Virol 2006; Durantel et al Hepatology 2004; Tenney et al AAC 2004 & 2007 LAM-R 204+ 180 184 / 202 / 250 ETV 236 and/or 181 ADV 204 ± 180 Wild-type 204 + 180 LAM Wild-type Wild-type ETV 184 / 202 /250 ADV-R ETV-R ETV-R LAM-R TDF ?
    134. 134. Archiving of resistant mutants
    135. 135. • cccDNA in the liver: – Is propagated during the normal replication cycle of HBV – Can serve as a template for the production of new virus Archiving of viral variants Viral quasispecies cccDNA variants Liver Majority population Minority variants Resistant variants Blood circulation Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
    136. 136. • cccDNA in the liver: – Is propagated during the normal replication cycle of HBV – Can serve as a template for the production of new virus • It is believed that viral variants with antiviral resistance may be archived in this way Archiving of viral variants Viral quasispecies cccDNA variants Blood circulation Liver Majority population Minority variants Resistant variants Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
    137. 137. • cccDNA in the liver: – Is propagated during the normal replication cycle of HBV – Can serve as a template for the production of new virus • It is believed that viral variants with antiviral resistance may be archived in this way Archiving of viral variants Viral quasispecies cccDNA variants Liver Majority population Minority variants Resistant variants Blood circulation Zhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
    138. 138. Multidrug resistance
    139. 139. Important factors involved in selection of MDR mutants • Use of inadequate sequential monotherapies and inadequate treatment adaptation • Incomplete viral suppression – > Persistent replication in the presence of antiviral pressure • Use of drugs sharing cross-resistance characteristics – One mutation may confer resistance to several drugs – > Persistent replication • Accumulation of mutations • Wide replication space (liver transplantation) Zoulim & Perrillo, J Hepatol 2008
    140. 140. The Problem of Sequential Therapy with Nucleoside Analogs + one mutation + one mutation ? Multiple drug resistant mutants with complex pattern of mutations Drug A Drug B Risk of selection of MDR mutants by sequential therapy, especially when using drugs sharing cross-resistance characteristics
    141. 141. 103 104 105 106 107 108 109 0 20 40 60 80 100 120 Treatment (months) HBVDNA(copies/ml) entecavir IFN adefovir lamivudine Genotype H lamivudine Drugs sharing cross-resistance characteristics: Switching strategy emergence of MDR mutant L180M+S202G+M204V L180M+M204V Villet et al, J Hepatol 2007
    142. 142. Treatment(months) lamivudineentecavir 0 20 40 60 80 100 1 L180M+M204V M204V wt V173L+L180M+M204V L180M+M204V V173L+L180M+M204V L180M+S202G+M204V I169L+L180M+S202G+M204V V173L+P177S+L180M+S202G+M204V V173L+P177S+L180M+S202G+M204V L180M+A181G+S202G+M204V L180M+S202G+M204V L180M+A181G+S202G+M204V wt % clones in the quasi-species 27/0 0 11 34 36 - Lamivudine therapy: Selection of a main population harboring the V173L+L180M+M204V mutations = primary resistance mutations - Entecavir therapy: Selection of three populations, all harboring the L180M+S202G+M204V mutations = secondary resistance mutations Genotypic analysis of the viral quasi-species during lamivudine and entecavir therapy Lamivudine rebound Entecavir rebound Villet et al, J Hepatol 2007
    143. 143. Role of cross-resistance, inefficacy of viral load suppression, and replication space, in MDR mutant selection Villet et al Gastroenterology 2006 Genotype E 102 103 104 105 106 107 108 0 500 1000 1500 2000 2500 3000 3500 days of treatment HBVDNA(Meq/ml) lamivudine adefovir HBIg tenofovir V173L+L180M+A181V+N236TL180M+M204V Liver transplantation
    144. 144. 0 10 20 30 40 50 60 70 80 90 100 1 Lamivudine+adefovirtreatment(months) 1 8 24 34 38 40 42 to 50 Viral rebound 0 16 26 30 32 34 to 42 Timepost-transplantation(months) % of variants in the viral quasi-species Accumulation of mutations and selection of a complex mutant YMDDYMDD Terminal Protein spacer Pol/RT RNaseH V173L L180M A181V N236T Pre-S/S gene P120S dominant HBV mutant L180M+M204I wt V173L+L180M+A181V+M204V M204I V173L+L180M+A181V V173L+L180M+A181V+M204V+N236T V173L+L180M+A181V+N236T V173L+L180M+A181V+N236T V173L+L180M+A181V+N236T V173L+L180M+A181V+M204V+N236T V173L+L180M+A181V+M204V V173L+L180M+A181V+M204V V173L+L180M+A181V+M204V V173L+L180M+A181V+M204V L180M+M204I V173L+L180M+A181V+M204I I169V+L180M+T184I+M204V V173L+L180M+A181V+N236T
    145. 145. Conclusions • Resistant mutants do pre-exist prior to therapy • Their selection depends on: – their intrinsic fitness • infectivity • replication capacity • level of resistance – replication space in the liver • Resistant mutants are archived in cccDNA • Complex mutants can be selected leading to multidrug resistance
    146. 146. Perspectives Prevention of drug resistance • First line therapy – Use of antivirals with high antiviral potency and high barrier to resistance – Combination therapy with complementary drugs • Second line treatment – Add-on strategies with complementary drugs preferred to sequential monotherapies – Early treatment adaptation to prevent accumulation of mutations – Choice always based on cross-resistance data
    147. 147. Antiviraux Monitoring et resistance Aspects cliniques
    148. 148. Clinical Definition of HBV Resistance to Antivirals Clinical • Genotypic Resistance: Detection of mutations in the HBV genome, known to confer resistance, which develop during anti-viral therapy • Virologic Breakthrough: Rebound in serum HBV DNA levels following the development of genotypic resistance • Clinical Breakthrough: Virologic breakthrough with increased ALT levels or worsening histology Laboratory Investigations • Phenotypic Resistance: Decreased susceptibility (in vitro testing) to inhibition by anti-viral drugs associated with genotypic resistance. • Cross Resistance: Mutants selected by one agent that also confer resistance to other antiviral agents Zoulim et al; Future Virology 2006
    149. 149. Nafa et al Hepatology 2000; Lok et al. J Clin Microbiol. 2002Nafa et al Hepatology 2000; Lok et al. J Clin Microbiol. 2002 Line Probe Assay Versus Sequencing for the Detection ofLine Probe Assay Versus Sequencing for the Detection of HBV Drug ResistanceHBV Drug Resistance Can detect any new mutation Very sensitive (minor species and low viremia) Line probe assayLine probe assay Sequencing of PCR productsSequencing of PCR products 0 20 40 60 80 100 HBVDNA (10E+6genomeeq/ml) ALT(U/L) 0 20 60 100 140 180 1 595100 200 300 400 Codon 528 LiPA Seq Codon 552 LiPA Seq Codon 555 LiPA Seq 1 L L M M V V 39 L L M M V V 290 L/M L/M M/V M V V 400 M M V V V V 595 M M V V V V Day T A T A T G C T C M T G G A T G C T
    150. 150. 600 500 200 150 100 50 0 8 7 6 5 4 3 0 6 12 18 24 30 36 Lamivudine Months42 ALT(U/L) HBVDNAlogcopies/mL M M V M M/V V L M V L/M M V M M/V V L M V M V V Codon 180 Codon 204 Codon 207 M V V Genotypic resistance Dynamics of Resistance Emergence Genotypic Resistance Si Ahmed et al. Hepatology 2000;32:1078–88
    151. 151. 600 500 200 150 100 50 0 8 7 6 5 4 3 0 6 12 18 24 30 36 Lamivudine Months42 PCR assay ALT(U/L) M M V M M/V V L M V L/M M V M M/V V L M V M V V Codon 180 Codon 204 Codon 207 M V V HBVDNAlogcopies/mL Rebound of serum HBV DNA* > 1 log10 copies/mL Dynamics of Resistance Emergence Virologic Breakthrough Si Ahmed et al. Hepatology 2000;32:1078–88
    152. 152. 600 500 200 150 100 50 0 8 7 6 5 4 3 0 6 12 18 24 30 36 Lamivudine Months42 Rise in serum transaminases PCR assay M M V M M/V V L M V L/M M V M M/V V L M V M V V Codon 180 Codon 204 Codon 207 M V V ALT(U/L) HBVDNAlogcopies/mL Worsening of liver disease Dynamics of Resistance Emergence Clinical Breakthrough Si Ahmed et al. Hepatology 2000;32:1078–88
    153. 153. Sequence of Events in Resistance to antiviral Therapy Time Antiviral drug HBVDNA(log10IU/mL) ALT(IU/L) 4 6 5 3 2 ULN 1 0 Detection of Genotypic Resistance Nadir 1 log10 Virologic Breakthrough Biochemical Breakthrough Genotypic resistance Virological Breakthrough Biochemical Breakthrough
    154. 154. Incidence of HBV Drug Resistance • Definitions of antiviral drug resistance vary across the clinical trials • Few studies report on primary non response • Clinical impact on treatment management – Incidence of resistance in nucleoside naive patients • Choice of drug as a first line treatment – Incidence of resistance in patients who are in previous treatment failure (lamivudine resistance as a current problem) • Choice of drug as a second line treatment
    155. 155. Incidence of Resistance in Nucleoside Naive Patients %ofpatientswith resistancemutations Lai et al CID 2003; Hadzyiannis et al Gastroenterology 2006; Colonno et al AASLD 2006; Di Bisceglie et al AASLD 2006 0 10 20 30 40 50 60 70 80 Lamivudine Adefovir Entecavir Telbivudine Tenofovir year 1 year 2 year 3 year 4 year 5
    156. 156. Incidence of Resistance in Lamivudine Refractory Patients %ofpatientswith resistancemutations 0 10 20 30 40 Adefovir switch Adefovir add-on Entecavir switch Tenofovir + FTC/3TC baseline Year 1 Year 2 Year 3 Year 4 Lampertico et al Hepatology 2005 & Gastroenterology 2007; Colonno et al AASLD 2007; Lacombe et al AIDS 2006
    157. 157. Biochemical and Histologic Correlates of HBV Resistance • Rise in ALT levels – Mild ALT elevations in most cases – ALT flares with acute exacerbations and liver failure: especially patients with liver cirrhosis and/or pre-core mutant infection • Progression of liver disease – Progressive worsening of liver histology – Clinical deterioration, liver decompensation, HCC developmentLai et al Clin Infect Dis 2003; 36: 687-696; Dienstag et al Gastroenterology 2003;124:105-117 ; Lok et al Gastroenterology 2003; 125 : 1714-1722; Hadziyannis et al Hepatology 2000;32:847-851; Si Ahmed et al Hepatology 2000; Zoulim et al J Viral Hepatitis 2006;13:278-288 ; Fung et al J Hepatol 2005;43:937-943; Liaw et al NEJM 2004;351:1521-1531.
    158. 158. ALT flares in patients with lamivudine resistance over time QuickTime™ et un décompresseur TIFF (LZW) sont requis pour visionner cette image. Lok et al Gastroenterology 2003; 125 : 1714-1722
    159. 159. Lamivudine Resistance Accelerates Progression of Liver Disease 0 5 10 15 20 25 0 6 12 18 24 30 36 Time after randomization (Months) % With disease progression Placebo (N=215) YMDDm (N=209) (49%) Wild Type (N=221) YMDDm WT Placebo 5% 13% 21% Liaw YF et al. N Engl J Med. 2004;351:1521-1531
    160. 160. Impact of Adefovir Resistance on Virologic and Biochemical Correlates 0% 3% 11% 18% 29% 0% 3% 8% 13% 16% 0% 2% 6% 10% 11% 0% 20% 40% 60% 80% 100% Year 1 Year 2 Year 3 Year 4 Year 5 Years of lamivudine therapy % of patients Hadzyiannis et al, Gastroenterology 2006 Cumulative probabilities calculated by Life-Table analysis * ALT = >1X ULN M: detection of mutations VR: virologic breakthrough ALT: biochemical breakthrough* M M + VR M + VR + ALT
    161. 161. Baseline Predictive Factors of Resistance • Lamivudine trials • Positive correlation with emergence of Lamivudine resistant mutants – Baseline virus levels – Disease severity assessed by H.A.I. score – Increased body mass index • Lack of emergence of lamivudine resistant strains – Asian ethnicity – Female sex Lai et al Clin Infect Dis 2003; 36: 687-696; Zoulim et al, J Viral Hepatitis, 2006; 13:278-288 • Adefovir, entecavir: ?
    162. 162. Age: ≥ 50 years old Alcohol consumption Place of birth: Asia HBV DNA: > 5 x 106 IU/ml Metavir score: ≥ F3 LiPA genotype: C 0.1110 Odds ratio Zoulim et al, J Viral Hepatitis, 2006 Multivariate logistic analysis: VIRAL LOAD was the only parameter associatedMultivariate logistic analysis: VIRAL LOAD was the only parameter associated with the emergence of YMDD mutationswith the emergence of YMDD mutations Predictive Factors of Lamivudine Resistance Pre-treatment Factors (Cohort study of 295 patients undergoing lamivudine therapy)
    163. 163. Virologic Consequences of Persistent Viremia  Infection of new hepatocytes slower kinetics of clearance infected cells and cccDNA  Increases the risk of occurrence and subsequent selection of HBV mutations responsible for drug resistance  On-treatment prediction of HBV drug resistance Le Guerhier et al Antimicrob Agents Chemoter 2000;44:111-122; Delmas et al Antimicrob Agents Chemother 2002; 46:425-433; Kock et al Hepatology2003; 38:1410-1418; Richman Hepatology 2000;32:866-867
    164. 164. Viral Load at Week 24 is a Predictor of Resistance at Week 104 of Therapy (Telbivudine vs. Lamivudine trial) 4% 25% 29% 30% 9% 24% 41% 45% 0% 20% 40% 60% 80% 100% < QL, n=203,146 QL - 3, n=57,63 3 to 4, n=83,79 > 4, n=115,175 % of patients with resistance 2% 12% 20% 60% 5% 6% 50% 56% 0% 20% 40% 60% 80% 100% < QL, n=178,157 QL - 3, n=18,20 3 to 4, n=16,24 > 4, n=10,23 % of patients with resistance Telbivudine Lamivudine HBeAg Positive, n=921HBeAg Positive, n=921 HBeAg Negative, n=446HBeAg Negative, n=446 Lai et al , NEJM, 2007
    165. 165. HBeAg Seroconversion at 2 Years vs. Antiviral Effect at Week 24 Percent HBeAg Seroconversion Serum HBV DNA Level at Week 24 HBeAg Positive Patients, Combined Treatment GroupsHBeAg Positive Patients, Combined Treatment Groups 39% 46% 19% 6% 0% 20% 40% 60% Below QL QL to 3 log 3 to 4 log > 4 log Lai et al , NEJM, 2007
    166. 166. Secondary Treatment Preferences Based on Virologic Monitoring Partial virologic response Virologic breakthrough Nucleoside analog treatment Add a more potent agent* or switch to a combination of emtricitabine/tenofovir* * Choice based on cross-resistance data Monitor at 12-24 weeks Early non reponse Monitor every 12 weeks Switch to more potent agent* Zoulim & Perrillo, J Hepatol in press
    167. 167. Lamivudine Telbivudine Entecavir Adefovir Tenofovir Wild-type S S S S S M204l R R I/R S S L180M + M204V R R I S S A181 T/V I S S R S N236T S S S R I I169T + V173L + M250V* R R R S S T184G + S202lI/G * R R R S S *(+ L180M + M204I/V). Treatment adaptation should be based on cross-resistance data Durantel et al Hepatology 2004; Brunelle et al Hepatology 2005; Yang et al Antiviral Therapy 2005; Villet et al Gastroenterology 2006; Delaney et al AAC 2006; Villet et al J Hepatol 2007; Brunelle et al AAC 2007; Qi et al Antiviral therapy 2007; Tenney et al AAC 2004 & 2007 ; Villet et al J Hepatol 2008
    168. 168. Comment adapter le traitement ? Zoulim Antivir Res 2004; 64: 1-15. Villeneuve et al J Hepatol 2003. Lampertico et al Gastroenterology 2007 Wild type LAM-R ADV-R ADV + LAM ADV LAM
    169. 169. Months ADV mono Patientswithvirologicalbreakthrough 273 268 256 225 201 158 61 30% 6% P<0.001 ADV+LAM 255 238 223 213 200 177 103 PatientswithADV-R 229 225 217 194 179 146 57 16% 0% P<0.001 ADV mono ADV+LAM 242 227 214 205 200 174 92 3-yr cumulative probability * > 1 log rebound of HBV DNA compared to on-treatment nadir ** N236T or A181T-V in patients with a virological breakthrough Patients still at risk Virologic breakthrough* Virologic breakthrough* and ADV resistance** Lampertico P for the AISF ADV Study Group, 57th AASLD Meeting, October 27-31, 2006, Boston, USA. Oral presentation LB5. Hepatology. 2006;44(4, suppl 1):229A-30 (Abstract 110). 0 20 40 60 80 100 0 3 6 9 12 15 18 21 24 27 30 33 36 0 20 40 60 80 100 0 3 6 9 12 15 18 21 24 27 30 33 36 Patients with lamivudine resistance: adefovir add-on strategy
    170. 170.  HBV DNA ∆ ALT The problem of sequential therapy and switching strategy Villeneuve et al, J Hepatol 2003 N236T SerumHBVDNA (Log10copies/mL) ALT(IU/L) 300 250 200 150 100 50 L180M+ M204V LAM ADV Reverted to wild type 2 3 4 5 6 7 8 9 10 janv-98 janv-99 janv-00 janv-01 janv-02 janv-03 janv-04 janv-05 LAM
    171. 171. Resistance to Lamivudine / Telbivudine Add: • ADV • TDF Switch to TDF+FTC* Switch to ETVNot valid • LAM • FTC • LdT Zoulim and Perrillo, J Hepatol, 2008 Management of HBV resistance *The association of FTC/TDF is not yet approved in the treatment of chronic hepatitis B
    172. 172. Resistance to adefovir Add : • Lamivudine • ETV • Telbivudine Switch to TDF+FTC*Switch to : • TDF • TVD • ETV • LdT Non response to adefovir Zoulim and Perrillo, J Hepatol, 2008 *The association of FTC/TDF is not yet approved in the treatment of chronic hepatitis B Management of HBV resistance
    173. 173. Resistance to Entecavir Add •ADV •TDF Switch to TDF+FTCNot valid •LAM •LdT Zoulim and Perrillo, J Hepatol, 2008 Management of HBV resistance *The association of FTC/TDF is not yet approved in the treatment of chronic hepatitis B
    174. 174. M0 M6 M12M18M24M30 M36 ALT 0 2 4 6 8 ALT HBV DNA Month of therapy Rescue therapy in patients with clinical breakthrough Drug A Drug B SerumHBVDNA(Log10copies/mL) andALT(xULN)
    175. 175. M0 M6 M12 M18 M24 M30 M36 ALT 0 2 4 6 8 ALT HBV DNA Month of therapy Rescue therapy in patients at the time of virologic breakthrough Drug A Drug B SerumHBVDNA(Log10copies/mL) andALT(xULN)
    176. 176. M0 M6 M12 M18 M24 M30 M36 ALT 0 2 4 6 8 ALT HBV DNA Month of therapyMonth of therapy Early add-on therapy to prevent drug resistance Drug A Drug B SerumHBVDNA(Log10copies/mL) andALT(xULN)
    177. 177. Very Early Add-on Therapy to Keep Viral Load as Low as Possible 2 3 4 5 6 7 8 M0 M3 M6 M9 M12 M15 M18 M21 M24 Serum HBV DNA (Log10 copies/mL) Drug ADrug A Drug ADrug A ++ Drug BDrug B Month of therapy 1. Start with a drug having a high genetic barrier for resistance 2. Add a drug with a different cross-resistance profile outgrowth of drug resistant mutant ? MDR ?
    178. 178. Rationale for de novo Combination Therapy Drug A Drug B Wild type Drug B resistant mutant Drug A resistant mutant Combination of drugs without cross-resistanceCombination of drugs without cross-resistance wt Low risk ofLow risk of selection of MDRselection of MDR Clavel et al NEJM 2004;350:1023-35 ; Zoulim Antiviral Res 2004;64: 1-15
    179. 179. M0 M6 M12 M18 M24 M30 M36 ALT 0 2 4 6 8 ALT HBV DNA Month of therapyMonth of therapy De novo combination therapy to prevent drug resistance Drug A Drug B SerumHBVDNA(Log10copies/mL) andALT(xULN)
    180. 180. Preventing L-Nucleosides Resistance with de novo Combination Therapy 1 Marcellin et al. N Engl J Med 2004; 351: 1206-17 2 Lau et al. Hepatology 2004;40:171A 3 Lai et al. Hepatology 2003;38:262A 4 Sung et al. J Hepatol 2003 ;38 (suppl 2):25-26 5 Lau et al. Hepatology 2004:40:666A * After 1- year therapy 20%18% 34% 21% 2%1% 11% 12% 5% 0 20 40 60 80 100 Sung 4 Marcellin 1 Lau 2 Lai 3 LAMLAM LAM LAM LAM +ADV LAM +Peg LAM +Peg LAM +LdT Incidenceofresistance*(%) LdT FTC FTC +ADV 0% 0% Lau 5
    181. 181. Future Needs for the Management of HBV Drug Resistance • Algorithm for the use of viral load & genomic assays in the monitoring of antiviral therapy • Management of drug resistance: – Best strategies to rescue drug resistance with long-term treatment end-points • Prevention of drug resistance: – Treatment strategy trials: de novo combination versus early add-on therapy – Drugs without cross-resistance – Long-term endpoints
    182. 182. Conclusions 1 • Maladie fréquente et graveMaladie fréquente et grave – 300 000 porteurs chroniques en france300 000 porteurs chroniques en france – 1ère cause de cancer du foie dans le monde1ère cause de cancer du foie dans le monde – 1300 décès par an en France1300 décès par an en France • Maladie méconnueMaladie méconnue – Souvent asymptomatique, ou symptomes non spécifiquesSouvent asymptomatique, ou symptomes non spécifiques – Seulement 60 000 personnes connaissent leur maladieSeulement 60 000 personnes connaissent leur maladie – 13 000 sont traitées13 000 sont traitées • Persistance viralePersistance virale – Pas d’éradication du génome viralPas d’éradication du génome viral – Surveillance prolongée, possibilité de réactivationsSurveillance prolongée, possibilité de réactivations
    183. 183. Conclusions 2 • Différentes formes d’hépatites en fonction deDifférentes formes d’hépatites en fonction de l’interaction virus / réponse immunitairel’interaction virus / réponse immunitaire – Portage asymptomatique / hépatite chronique / cirrhose /Portage asymptomatique / hépatite chronique / cirrhose / cancer du foiecancer du foie • Impact de la variabilité du génome viralImpact de la variabilité du génome viral - Role dans la persistance virale et la résistance aux antiviraux- Role dans la persistance virale et la résistance aux antiviraux - Echappement diagnostique- Echappement diagnostique • Nécessité d’un dépistage et traitement précoce desNécessité d’un dépistage et traitement précoce des formes chroniquesformes chroniques • Prévention par la vaccination !!!Prévention par la vaccination !!!

    ×