The more the merrier: the genomics of single, double and polysymbioses
•Download as PPT, PDF•
0 likes•807 views
Talk by Jonathan Eisen at PAG2007
Recommended
More Related Content
What's hot
What's hot (20)
Similar to The more the merrier: the genomics of single, double and polysymbioses
Similar to The more the merrier: the genomics of single, double and polysymbioses (20)
More from Jonathan Eisen
More from Jonathan Eisen (20)
Recently uploaded
Recently uploaded (20)
The more the merrier: the genomics of single, double and polysymbioses
- 1. The more the merrier: the genomics of single, double and polysymbioses Jonathan A. Eisen U. C. Davis Genome Center
- 2. The more the merrier: the metagenomics of single, double and polysymbioses Jonathan A. Eisen U. C. Davis Genome Center
- 3. Outline • Introduction – Symbionts – Phylogenomics • Two endosymbiont genomics tales – Wolbachia – Sharpshooter • Where next?
- 4. Sources for the Origin of Novelty • New biochemical functions – Evolution of new genes – Old genes with new functions – Mixing and matching existing genes • Changes in uses of existing genes – Targeting – Regulation • Acquisition of new functions – Recombination – Lateral gene transfer – Symbioses
- 5. Endosymbioses Drove Eukaryotic Evolution
- 7. “Nothing in biology makes sense except in the light of evolution.” T. H. Dobzhansky (1973)
- 8. Phylogenomic Analysis • Evolutionary reconstructions greatly improve genome analyses • Genome analysis greatly improves evolutionary reconstructions • There is a feedback loop such that these should be integrated
- 9. Wolbachia pipientis wMel • Wolbachia are obligate, maternally transmitted intracellular symbionts • Wolbachia infect many invertebrate species – Many cause male specific deleterious effects – Model system for studying sex ratio changes in hosts – Some are mutualistic (e.g., in filarial nematodes) • wMel selected as model system because it infects Drosophila melanogaster
- 10. Wolbachia Metagenomic Sequencing shotgunshotgun sequencesequence Analysis led by Matin Wu in collaboration with lab of Scott O’Neill
- 15. Genome Completed Wu et al., PLoS Biology 2004
- 16. alanine/glycine Na+ alanine/glycine Na+ alanine/glycine Na+ proline/betaine H+ proline/betaine H+WD0168 WD0414 WD1046 WD1047 WD0330 Na+ glutamate/aspartate Na+ WD0211 WD0229 glutamate/aspartate ornithine putrescine WD0957 H+ Na+ H+ Na+ WD0316 WD0407 H+ WD1107 WD1299 WD1300 WD1391 WD0816 WD0765 Mg2+ WD0375 H+ Zn2+ /Cd2+ WD1042 ATPADP Zn2+ WD0362 WD0938 WD0937 ATPADP Fe3+ WD1136 WD0153 WD0897 glycerol-3-phosphate/ hexose-6-phosphate phosphate WD0619 H+ drugs H+ drugs WD0056 WD0248 H+ drugs H+ drugs WD1320 WD0384 H+ ? H+ ? WD0621 WD0099 H+ metabolite? WD0470 H+ metabolite? WD1033 H+WD0249 metabolite? ATPADP heme WD0411 WD1093 WD0340 K+ WD1249 Na+ H+ drugs ATP ADP WD0400 phosphate ATPADP ORF00100 ORF00714 ORF00927 ORF00940 (2?) H+ F-type ATPase ATP ADP WD1233 WD0203 WD0204 WD0427 WD0428 WD0429 WD0655 WD0656 phosphoenolpyruvate 1,3-bisphosphoglycerate 3-phosphoglycerate 2-phosphoglycerate pyruvate acetyl-CoA citrate isocitrate oxaloacetate suc-CoAsuccinate fumarate malate oxaloacetate TCA CYCLE glyceraldehyde-3P fructose-1,6-P2 dihydroxyacetone-P WD1238 WD0091 WD0451 WD1167 WD0868 WD0494 WD0690 WD0105 WD0791 WD1309 WD0544 WD0751 WD1209 WD1210 WD0437 WD0727 WD1221 WD1222 WD0492 WD1121 mannose-1P mannose-6P WD0695 MALATEWD0488 WD1177 WD0416 WD0473 WD0751 WD0325 Non-oxidative Pentose Phosphate Pathway xylulose-5P glyceraldehyde-3P sedoheptulose-7P fructose-6P ribose-5P ribulose-5P glyceraldehyde-3P WD0551 WD0387 WD0387 WD0712 erythrose-4P WD1151 glycerol-3P WD0731 Amino Acid catabolism GLUTAMATE glutamine WD1322 GLUTAMINE glutamateWD0535 CYSTEINE alanine WD0997 THREONINE glycine WD0617,WD0617 PROLINE glutamate WD0103 SERINE glycineWD1035 Fatty Acid Biosynthesis WD0985, WD0650, WD1083, WD1170, WD0085 PRPP WD0036 Thiamine metabolismWD1109,WD0763,WD0029,WD0913,WD1018,WD1024 AMP,ADP,dAMP, dADP,ATP,dATP,ITP, dITP,IMP,XMP,GMP,GDP,dGDP,dGTP,dGMP WD1142 WD1305 WD1023 WD0786 WD0867 WD0337 WD0786 WD0661 WD1183 WD0197 WD0089 WD0195 WD0439 WD0197 adenylosuccinate WD0786 Purine Metabolism UMP UDP WD0684 WD1295 WD0895 WD0230 WD1239 WD0228 WD0461 aspartate semialdehydeaspartateWD1029 WD0960 WD0954
- 18. Wolbachia Evolutionary Rate is Accelerated
- 19. Endosymbiont Trends • Compared to free-living relatives – Smaller genomes – Lower GC content – Higher pIs – Higher rates of sequence evolution • Wolbachia shows ALL of these
- 20. Explanations for Endosymbiont Differences with Free-Living Relatives • Repair hypothesis – Loss of DNA repair genes leads to increased mutation rate – Trends are the direct and indirect result of this increased mutation rate • Population genetics hypothesis – Smaller effective population size leads to more genetic drift – Trends are mostly the result of accumulation of slightly deleterious mutations • PopGen explanations favored – Wolbachia has full suite of repair genes
- 21. Endosymbiont Trends • Compared to free-living relatives – Smaller genomes – Lower GC content – Higher pIs – Higher rates of sequence evolution • Wolbachia shows ALL of these • However ….
- 22. Wolbachia Overrun by Mobile Elements Repeat Class Size (Median) Copies Protein motifs/families IS Family Possible Terminal Inverted Repeat Sequence 1 1512 3 Transposase IS4 5’ ATACGCGTCAAGTTAAG 3’ 2 360 12 - New 5’ GGCTTTGTTGCATCGCTA 3’ 3 858 9 Transposase IS492/IS110 5’ GGCTTTGTTGCAT 3’ 4 1404.5 4 Conserved hypothetical, phage terminase New 5’ ATACCGCGAWTSAWTCGCGGTAT 3’ 5 1212 15 Transposase IS3 5’ TGACCTTACCCAGAAAAAGTGGAGAGAAAG 3’ 6 948 13 Transposase IS5 5’ AGAGGTTGTCCGGAAACAAGTAAA 3’ 7 2405.5 8 RT/maturase - 8 468 45 - - 9 817 3 conserved hypothetical, transposase ISBt12 10 238 2 ExoD - 11 225 2 RT/maturase - 12 1263 4 Transposase ??? 13 572.5 2 Transposase ??? None detected 14 433 2 Ankyrin - 15 201 2 - - 16 1400 6 RT/maturase - 17 721 2 transposase IS630 18 1191.5 2 EF-Tu - 19 230 2 hypothetical - Wu et al. 2004
- 26. Glassy Winged Sharpshooter • Feeds on xylem sap • Can transmit Pierce’s Disease agent from infected plants to uninfected plants like mosquitoes with malaria • Potential bioterror agent • Needs to get amino- acids and other nutrients from symbionts like aphids
- 27. Xylem and Phloem From Lodish et al. 2000
- 28. Endosymbionts Present Moran et al. Env. Microbiol. 5: 2003
- 29. Long Term Mutualism Moran et al. Env. Microbiol. 5: 2003
- 30. Sharpshooter Shotgun Sequencing shotgunshotgun sequencesequence 400,000 100,000 200,000 300,000 500,000 600,000 1 Wu et al. PLoS Biology 2006
- 34. Genome Helps Resolve Phylogeny
- 35. Higher Evolutionary Rates in Clade
- 36. Endosymbiont Trends • Compared to free-living relatives – Smaller genomes – Lower GC content – Higher pIs – Higher rates of sequence evolution • Baumannia shows ALL of these
- 37. Explanations for Endosymbiont Differences with Free-Living Relatives • Repair hypothesis • Population genetics hypothesis • PopGen explanations favored
- 38. Variation in Evolution Rates Correlated with Repair Gene Presence MutS MutL + + + + + + + + _ _ _ _
- 39. Explanations for Endosymbiont Differences with Each Other • Repair hypothesis • Population genetics hypothesis • Repair explanations favored
- 40. Polymorphisms in Metapopulation • Data from ~200 hosts – 104 SNPs – 2 indels • PCR surveys show that this is between host variation • Much lower ratio of transitions:transversions than in Blochmannia • Consistent with absence of MMR from Blochmannia
- 44. ???????
- 45. Suggested Methods for Binning Did Not Work Well • Assembly – Only Baumannia generated good contigs • Depth of coverage – Everything else 0-1X coverage • Nucleotide composition – No detectible peaks in any vector we looked at
- 46. Binning by Phylogeny? • Identified putative genes • Built phylogenetic trees • Examined and classified trees
- 47. Host Sequence?
- 49. CFB Phyla
- 50. Sulcia symbionts in Sharpshooters Moran et al. 2005
- 51. Sulcia symbionts in Sharpshooters Moran et al. 2005
- 52. Binning by Phylogeny • Four main “phylotypes” – Gamma proteobacteria (Baumannia) – Arthropoda (sharpshooter) – Bacteroidetes (Sulcia) – Alpha-proteobacteria (Wolbachia)
- 53. Binning by Phylogeny • Four main “phylotypes” – Gamma proteobacteria (Baumannia) – Arthropoda (sharpshooter) – Bacteroidetes (Sulcia) - only a.a. genes here – Alpha-proteobacteria (Wolbachia)
- 54. Finished 130 kb of Sulcia
- 55. Co-Symbiosis?
- 57. What is Next? • More endosymbioses – Diversity of host species – Diversity of symbionts – Diversity of biology • Epibionts and other obligate symbioses • Commensals – Human gut – Hotspring mats
- 58. TIGRTIGR Other peopleOther people Mom and DadMom and Dad H. OchmanH. OchmanF. RobbF. Robb J. BattistaJ. Battista E. OriasE. Orias D. BryantD. Bryant S. O’NeillS. O’Neill M. EisenM. Eisen N. MoranN. Moran R. MyersR. Myers C. M. CavanaughC. M. Cavanaugh P. HanawaltP. Hanawalt J. HeidelbergJ. Heidelberg N. WardN. Ward J. VenterJ. Venter C. FraseC. Fraser S. SalzbergS. Salzberg I. PaulsenI. Paulsen $$$$$$ NSFNSF DOEDOE NIHNIH M. WuM. Wu D. WuD. Wu S. ChatterjiS. Chatterji H. HuseH. Huse A. HartmanA. Hartman MooreMoore VIVI D. RuschD. Rusch A. HalpernA. Halpern EisenEisen GroupGroup J. MorganJ. Morgan JGIJGI E. EisenstadtE. Eisenstadt M. FrazierM. Frazier T. WoykeT. Woyke E. RubinE. Rubin
- 61. C. magnifica symbiont sequencing • Collaboration between Cavanaugh Lab at Harvard (Irene Newton led analysis), Eisen lab, and JGI (Woyke and others). • Funded by DOE through CSP program and sequencing and closure done at JGI • Annotation and analysis involved DOE (JGI, ORNL), Harvard, TIGR, Davis, et al.
- 62. Ruthia magnifica
- 65. A Streamlined Chemoautotrophic Machine
- 66. Correlation of Endosymbiont Features • Correlation makes it difficult to tease apart cause and effect • Need examples where properties are decoupled • May be the case in Baumannia with genome size
- 67. Long Term Effects of Repair Loss • Endosymbionts are model systems for understanding the consequences of loss of repair activities • RecA lost in Buchnera and Blochmannia but kept in Baumannia and Wigglesworthia • MutSL loss mentioned previously • RecBCD present even in species without RecA • Mfd present in many species without UvrABCD
- 68. Endosymbionts and Extremophiles Origin of New Functions Species Evolution Genome Dynamics Phylogeny, Processes, Biogeography, Convergence Mutation, Selection, Repair, Replication Multiple Origins, Simple Communities New genes, Changes in old genes, AcquisitionEisen Lab
- 69. Comparative vs. Evolutionary Approaches • Comparative approaches involve documenting similarities and differences • Evolutionary approaches involve documenting how and why the similarities and differences arose
- 70. Comparative vs. Evolutionary Topic Comparative Evolutionary Structure prediction for rRNA Conserved regions Correlated changes along tree Gene presence vs. phenotpye Presence and absence of genes Gain and loss, lateral transfer Selection Degree and pattern of conservation HKA, Ds/Dn Functional prediction Ranking by level of similarity Predicting function from trees
- 71. Phylogenomic Analysis • Evolutionary reconstructions greatly improve genome analyses • Genome analysis greatly improves evolutionary reconstructions • There is a feedback loop such that these should be integrated
Editor's Notes
- The Wolbachia genome revealed an unexpectedly high amount of repetitive DNA and mobile genetic elements (which were never seen before in a small-genomed intracellular species)
- My major research interests