Ce diaporama a bien été signalé.
Nous utilisons votre profil LinkedIn et vos données d’activité pour vous proposer des publicités personnalisées et pertinentes. Vous pouvez changer vos préférences de publicités à tout moment.
EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/20071. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única p...
3. (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estruturaprimária e na função...
6. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dosseres vivos terrest...
8. (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. Entretanto, esse código segueo padrão do...
12. O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico, portantoé formado por...
15. (Fatec 2006) O metabolismo celular depende de uma série de reações químicas controladas por enzimas,isto é, proteínas ...
20. (Cesgranrio 92) A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que osidentificam:Se um RNA m...
23. (Fuvest 95) Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e osaminoácidos por elas codi...
genético de um organismo.27. (Uel 98) Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especifica...
29. (Ufpi 2000) Se uma proteína possui 100 aminoácidos, quantos códons, que especificam esses aminoácidos,devem estar pres...
34. (Puccamp 2002) Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes quecodificam RNA transportador....
39. (Ufrs 2005) O cientista britânico Francis Crick, um dos descobridores da estrutura da molécula de DNA,morto em julho d...
GABARITO1. a) Os corrimãos correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). Os degraussão consti...
c) UUA8. a) RNA-polimerase.b) UAC.c) W - A - T - S - O - N - E - C - R - I - C - K.d) A proteína não será formada, pois fo...
Prochain SlideShare
Chargement dans…5

Exercicios%20 de%20biologia%20a%20prof%20marcelo

43 257 vues

Publié le

Publié dans : Formation
  • Soyez le premier à commenter

Exercicios%20 de%20biologia%20a%20prof%20marcelo

  1. 1. EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/20071. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado"A estrutura molecular dos ácidos nucléicos", quase ignorado de início, revolucionou para sempre todas asciências da vida sejam elas do homem, rato, planta ou bactéria. James Watson e Francis Crick descobriram aestrutura do DNA, que permitiu posteriormente decifrar o código genético determinante para a síntese protéica.a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a quecorrespondem os "corrimãos" e os "degraus" dessa escada.b) Que relação existe entre DNA, RNA e síntese protéica?c) Como podemos diferenciar duas proteínas?2. (Fuvest 96) Uma doença genética de herança dominante é causada por mutações em um gene localizado emum autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja seqüêncianormal está representada a seguir.Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde aser transcrita é aquela assinalada com a letra m, responda:a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C?b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê?Seqüência normalCAA AAC TGA GGA ATG CAT TTC (m)GTT TTG ACT CCT TAC GTA AAGIndivíduo ACAA AAC TGA GGA ATT CAT TTC (m)GTT TTG ACT CCT TAA GTA AAGIndivíduo BCAT AAC TGA GGA ATG CAT TTC (m)GTA TTG ACT CCT TAC GTA AAGIndivíduo CCAA TAC TGA GGA ATG CAT TTC (m)GTT ATG ACT CCT TAC GTA AAG
  2. 2. 3. (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estruturaprimária e na função das proteínas.a) Considere o segmento de DNA, cuja seqüência de nucleotídeos é5 - GTG - CAC - CTG - ACT - CCT - GAG - GAG - AAG - 3e, utilizando-se da tabela do código genético apresentada a seguir, forneça o produto da síntese protéica(polipeptídio parte da cadeia beta prevista para a globina humana).b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutaçãopontual, do tipo substituição, pode afetar a saúde e a qualidade de vida do portador dessa mutação.4. (Ufrj 97) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídospor vários aminoácidos. Um gene é constituído por um número N de nucleotídeos que codifica uma proteínaconstituída por P aminoácidos.Por que sempre encontramos N > P ?5. (Ufrj 99) Com o auxílio da tabela do código genético representada a seguir, é sempre possível deduzir-se aseqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene, ou do RNA-mcorrespondentes.Entretanto, o oposto não é verdadeiro, isto é, a partir da seqüência de aminoácidos de uma proteína, não sepode deduzir a seqüência de nucleotídeos do gene. Explique por quê.
  3. 3. 6. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dosseres vivos terrestres. Já o código genético desses organismos é determinado por códons de 2 bases.a) As proteínas A, B e C, encontradas nos organismos da Terra, apresentam, respectivamente, 13, 16 e 19tipos diferentes de aminoácidos. Explique a possibilidade da ocorrência dessas três proteínas nos seres deZbohrnya.b) Sabendo que a vida em Zbohrnya e na Terra existe há 3,5 bilhões de anos, faça uma comparação entre adiversidade dos organismos encontrados nesses dois planetas.c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre,a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique suaresposta.7. (Ufv 2000) Considere a tabela abaixo, contendo códigos de trincas de bases do DNA com os aminoácidoscorrespondentes, para resolver os itens seguintes:a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizadoabaixo da tabela.b) Se ocorresse uma substituição, por uma purina, na 3 base do código correspondente ao 6Ž aminoácido dopolipeptídeo, qual seria o aminoácido da tabela a ser incorporado?c) Qual é anticódon correspondente ao novo aminoácido incorporado?
  4. 4. 8. (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. Entretanto, esse código segueo padrão do código genético universal, no qual três bases codificam um aminoácido.Analise a tabela e faça o que se pede:a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro.b) Cite a seqüência do anticódon correspondente ao códon de iniciação.c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figuraanterior.d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mRNA, após umadeleção do TERCEIRO nucleotídeo?9. (G2) Os códons AGA, CUG, e ACU do RNA mensageiro codificam, respectivamente os aminoácidos arginina,leucina e treonina. Escreva esses aminoácidos na ordem correspondente à seqüência TGA - TCT - GAC de umsegmento de DNA.10. (Unifesp 2006) Uma fita de DNA tem a seguinte seqüência de bases 5ATGCGT3.a) Considerando que tenha ocorrido a ação da DNA-polimerase, qual será a seqüência de bases da fitacomplementar?b) Se a fita complementar for usada durante a transcrição, qual será a seqüência de bases do RNA resultante eque nome recebe esse RNA se ele traduzir para síntese de proteínas?11. (Ufrj 2004) Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir umaúnica mutação pontual (que afeta apenas um nucleotídeo por célula), analisou-se a seqüência de aminoácidosde uma determinada proteína em diversos mutantes gerados. Verificou-se que um desses mutantes produziauma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades dacadeia peptídica.Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompidaprematuramente.TEXTO PARA A PRÓXIMA QUESTÃO(Ufsm 2006) A história da maioria dos municípios gaúchos coincide com a chegada dos primeirosportugueses, alemães, italianos e de outros povos. No entanto, através dos vestígios materiais encontrados naspesquisas arqueológicas, sabemos que outros povos, anteriores aos citados, protagonizaram a nossa história. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo, "o índio", foiselecionada a área temática CULTURA e as questões foram construídas com base na obra "Os PrimeirosHabitantes do Rio Grande do Sul" (Custódio, L. A. B., organizador. Santa Cruz do Sul: EDUNISC; IPHAN,2004)."Nossos ancestrais, uma mistura de índios, brancos e negros, deixaram-nos um legado que, muitas vezes,diferencia-nos. Nosso chimarrão nos identifica em qualquer parte do mundo. Ainda hoje, convivemos comgrupos indígenas, como os Kaingáng; ainda hoje, as três raças se mesclam em nossos descendentes."
  5. 5. 12. O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico, portantoé formado porI. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem, formando ligações fosfo-diéster.II. duas cadeias polinucleotídicas paralelas e complementares entre si, através dos pareamentos deaminoácidos.III. nucleotídeos que são compostos por uma base nitrogenada, uma pentose e um radical "fosfato".Está(ão) correta(s)a) apenas I.b) apenas II.c) apenas III.d) apenas I e II.e) apenas II e III.13. (Fuvest 2005) Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular, issosignifica quea) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares.b) o núcleo produz moléculas que, no citoplasma, promovem a síntese de enzimas catalisadoras das reaçõesmetabólicas.c) o núcleo produz e envia, para todas as partes da célula, moléculas que catalisam as reações metabólicas.d) dentro do núcleo, moléculas sintetizam enzimas catalisadoras das reações metabólicas.e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares, catalisando asreações metabólicas.14. (Pucmg 2006) A figura mostra cinco tipos de moléculas de grande importância para uma célula animal.Analise o esquema, reflita sobre esse assunto e assinale a afirmativa INCORRETA.a) Uma das moléculas apresentadas pode fornecer informações para a produção de uma outra representada.b) Uma das moléculas representadas no desenho não é normalmente encontrada no citoplasma celular.c) Apenas duas das moléculas indicadas na figura podem ser quebradas e fornecer energia para as células.d) Uma das moléculas representadas pode favorecer a captação do carboidrato indicado no esquema.
  6. 6. 15. (Fatec 2006) O metabolismo celular depende de uma série de reações químicas controladas por enzimas,isto é, proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas oueliminadas.Assinale a alternativa correta, levando em conta os ácidos nucléicos, a ocorrência de mutações e asconseqüentes mudanças do ciclo de vida da célula.a) O DNA é constituído por códons, que determinam a seqüência de bases do RNA mensageiro, necessária àformação dos anticódons, responsáveis pela produção das proteínas.b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmoaminoácido, não haverá alteração na molécula protéica formada, nem no metabolismo celular.c) A mutação altera a seqüência de aminoácidos do DNA, acarretando alterações na seqüência de bases doRNA mensageiro e, conseqüentemente, na produção das proteínas.d) As mutações atuam diretamente sobre as proteínas, provocando a desnaturação dessas moléculas e,conseqüentemente, a inativação delas.e) Quando algumas proteínas são alteradas por mutações, suas funções no metabolismo celular passam a serrealizadas pelos aminoácidos.16. (Pucrs 2005) A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligarà fita complementara) AUGCACCU.b) UACGUGGA.c) TACGTGGA.d) TCCACGTA.e) ATGCACCT.17. (Pucsp 2006) O gato doméstico (Felis domestica) apresenta 38 cromossomos em suas células somáticas.No núcleo do óvulo normal de uma gata são esperados:a) 19 cromossomos simples e 19 moléculas de DNA.b) 19 cromossomos duplicados e 38 moléculas de DNA.c) 38 cromossomos simples e 38 moléculas de DNA.d) 38 cromossomos simples e 19 moléculas de DNA.e) 19 cromossomos duplicados e 19 moléculas de DNA.18. (Uerj 2004) É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos doarquiteto para todo o prédio. (...) No homem, os planos do arquiteto montam 46 volumes.Nessa analogia, proposta por Richard Dawkins no livro "O gene egoísta", cada página de cada volume contémum texto formado por uma seqüência de:a) fenótiposb) aminoácidosc) cromossomosd) bases nitrogenadas19. (Unifesp 2004) Em abril de 2003, a finalização do Projeto Genoma Humano foi noticiada por vários meios decomunicação como sendo a "decifração do código genético humano". A informação, da maneira como foiveiculada, estáa) correta, porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos.b) correta, porque agora se sabe toda a seqüência de genes dos cromossomos humanos.c) errada, porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidosnas proteínas.d) errada, porque o Projeto decifrou os genes dos cromossomos humanos, não as proteínas que eles codificam.e) errada, porque não é possível decifrar todo o código genético, existem regiões cromossômicas com alta taxade mutação.
  7. 7. 20. (Cesgranrio 92) A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que osidentificam:Se um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA, a seqüência deaminoácidos no polipeptídeo correspondente será, de acordo com a tabela anterior:a) Cis - Val - Leu - Arg - Ileb) Leu - Val - Cis - Arg - Ilec) Arg - Ile - Val - Leu - Cisd) Ile - Arg - Cis - Val - Leue) Val - Cis - Arg - Ile - Leu21. (Fatec 95) A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes.Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguintetetrapeptídeo: GLU - GLI - FEN - LEUa) GUU - GGU - UUU - CUC;b) GAA - GGC - TTT - CTC;c) CTT - CCG - AAA - AAC;d) GAA - GGA - UUU - CUC;e) GUU - GGC - UUU - UUG.22. (Fuvest 94) Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídicacom número de aminoácidos aproximadamente igual aa) 200b) 300c) 600d) 1200e) 1800
  8. 8. 23. (Fuvest 95) Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e osaminoácidos por elas codificados.Com base na tabela fornecida e considerando um segmento hipotético de DNA, cuja seqüência de bases éAAGTTTGGT, qual seria a seqüência de aminoácidos codificada?a) Aspargina, leucina, valina.b) Aspargina, lisina, prolina.c) Fenilalanina, lisina, prolina.d) Fenilalanina, valina, lisina.e) Valina, lisina, prolina.24. (Mackenzie 99) Os códons UGC, UAU, GCC e AGC codificam, respectivamente os aminoácidos cisteína,tirosina, alanina e serina; o códon UAG é terminal, ou seja, indica a interrupção da tradução. Um fragmento deDNA, que codifica a seqüência serina - cisteína - tirosina - alanina, sofreu a perda da 9 base nitrogenada.Assinale a alternativa que descreve o que acontecerá com a seqüência de aminoácidos.a) O aminoácido tirosina será substituído por outro aminoácido.b) O aminoácido tirosina não será traduzido, resultando numa molécula com 3 aminoácidos.c) A seqüência não será traduzida, pois essa molécula de DNA alterada não é capaz de comandar esseprocesso.d) A tradução será interrompida no 2Ž aminoácido.e) A seqüência não sofrerá prejuízo, pois qualquer modificação na fita de DNA é imediatamente corrigida.25. (Puc-rio 2000) Com relação ao código genético e à síntese de proteínas, assinale a afirmativa FALSA.a) Na molécula de DNA, encontramos sempre desoxirribose e cinco tipos de bases: adenina, guanina, citosina,timina e uracil.b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas, compondo oscromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas.c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição, que compreende a passagemdo código genético do DNA para o RNA, e a tradução, que compreende o trabalho do RNA de organização dosaminoácidos na seqüência determinada pelo código genético.d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode serprovocada por radiações, por raios cósmicos, por raios-X, ou mesmo por exposição aos raios ultravioleta do sol.e) Todas as células do corpo têm a mesma coleção de genes, mas, apesar disso, encontramos células comformas e funções diferentes. Este processo chama-se diferenciação celular.26. (Puc-rio 2001) Em 1987, foi oficialmente fundado o Projeto Genoma, que visa decifrar e mapear o códigogenético humano. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas:a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula,determinando as características de um ser vivo.b) Todas as células do corpo têm a mesma coleção de genes, mas, apesar disto, encontramos células comformas e funções diferentes.c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ousubstâncias químicas.d) As mudanças na programação genética de um organismo não alteram a produção de proteínas, nem as suascaracterísticas.e) A Engenharia Genética, que é uma técnica de manipulação dos genes, pode corrigir defeitos no código
  9. 9. genético de um organismo.27. (Uel 98) Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados:ACA = treoninaGUU = valinaAssinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNArelacionados com esses aminoácidos.28. (Uerj 2005) A mutação em um gene, por conseqüência da substituição de uma única base na estrutura doDNA, pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene.Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtudeda troca de uma única base no gene correspondente são:5 AUGUGGUUUGCACACAAAUGAUAA 3 (normal)5 AUGUGGUUUGAACACAAAUGAUAA 3 (alterada)A tabela a seguir identifica alguns codons.Observe que:- o codon da metionina é também o do início da tradução;- os codons de término da tradução são UAA, UAG e UGA.O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são,respectivamente:a) lisina e cisteínab) treonina e triptofanoc) alanina e ácido glutâmicod) fenil alanina e ácido aspártico
  10. 10. 29. (Ufpi 2000) Se uma proteína possui 100 aminoácidos, quantos códons, que especificam esses aminoácidos,devem estar presentes no seu mRNA?a) 100b) 33c) 99d) 300e) 50030. (Ufrn 2000) Observe as seqüências de nucleotídeos de um vírus de RNA:5 GCA UCA CAC CUC AUU GCG UAG 3Considerando que esse segmento de RNA codifica um determinado peptídeo, é correto afirmar:a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos.b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético.c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes.d) Os anticódons do 1ª do 2ª códon dessa seqüência são, respectivamente, GCA e UGA.31. (Unifesp 2007) Os códons AGA, CUG e ACU do RNA mensageiro codificam, respectivamente, osaminoácidos arginina, leucina e treonina. A seqüência desses aminoácidos na proteína correspondente aosegmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será, respectivamente,a) treonina, arginina, leucina.b) arginina, leucina, treonina.c) leucina, arginina, treonina.d) treonina, leucina, arginina.e) leucina, treonina, arginina.32. (G2) A seqüência de aminoácidos de uma proteína é determinada pela seqüência dea) pentoses da molécula de DNA.b) pentoses da molécula de RNA - mensageiro.c) bases da molécula de DNA.d) bases da molécula de RNA - transportador.e) bases da molécula de RNA - ribossômico33. (Mackenzie 2001)Considerando o esquema acima, que representa um fragmento de ácido nucléico, cuja função é transportaraminoácidos, assinale a alternativa INCORRETA.a) A substância representada em I é obrigatoriamente ribose.b) Cada trinca de bases, representada em II, é denominada anticódon.c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma, unindo-se aos aminoácidos.d) II pode apresentar moléculas de adenina.e) Se a ação desse ácido for bloqueada, o processo de transcrição não ocorrerá.
  11. 11. 34. (Puccamp 2002) Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes quecodificam RNA transportador. A função celular drasticamente afetada por essa mutação seráa) a replicação do DNA.b) a síntese de RNA mensageiros.c) a síntese de proteínas.d) o transporte de proteínas.e) o transporte de RNA.35. (Pucmg 99) O DNA apresenta importantes funções celulares. Uma delas é a síntese de proteína. Numasíntese de proteína com 185 ligações peptídicas, o filamento de DNA que proporcionou essa síntese deverá tero seguinte número total de nucleotídeos:a) 62b) 93c) 186d) 279e) 55836. (Pucmg 2007) O esquema a seguir é um processo celular vital, que ocorre também em você.Nesse processo ocorre produção de, EXCETO:a) macromoléculas de reserva energética.b) enzimas usadas, por exemplo, no processo digestivo.c) moléculas de defesa do corpo.d) moléculas utilizadas nos processos de cicatrização.37. (Ufal 99) Considere os seguintes códons: UAC - GAU - UGC - AUGOs anti-códons correspondentes são:a) AUG - CUA - ACG - UACb) ATG - CTA - ACG - TACc) TUG - CUT - TCG - UTCd) AGT - CGA - ACT - GACe) GCA - UCG - GUA - CGU38. (Ufc 99) Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmarcorretamente que:a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica.b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do tRNA.c) o transporte de aminoácido para o local da síntese é feito pelo mRNA.d) a seqüência de bases do rRNA é transcrita a partir do código do mRNA.e) a extremidade livre dos diversos tRNA tem seqüências de bases diferentes.
  12. 12. 39. (Ufrs 2005) O cientista britânico Francis Crick, um dos descobridores da estrutura da molécula de DNA,morto em julho de 2004, será lembrado como um dos mais influentes cientistas de todos os tempos. Em 1958,publicou um manifesto sobre a síntese de proteínas, apresentando suas hipóteses sobre a estrutura teórica dabiologia molecular, lançando, assim, as bases para a descoberta do código genético.Entre as hipóteses apresentadas naquele texto, destaca-se o dogma central da Biologia. Segundo esse dogma,a) o código genético é degenerado, pois um aminoácido pode ser codificado por mais de uma trinca.b) a transferência de informações genéticas ocorre do DNA para o RNA, e deste para a proteína.c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene.d) cada molécula de DNA é formada pela reunião de nucleotídeos, que podem ser de quatro tipos diferentes.e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos.40. (Unirio 2003) Supondo que o peso molecular médio de um aminoácido é de 100 daltons, quantosnucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m, responsável pelosequenciamento dos aminoácidos em um peptídeo com peso molecular de 27000 daltons?a) 810b) 300c) 270d) 81000e) 2700
  13. 13. GABARITO1. a) Os corrimãos correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). Os degraussão constituídos por pares de bases nitrogenadas, unidas por pontes de hidrogênio, onde adenina pareia comtimina, e citosina com guanina.b) O DNA realiza a transcrição, isto é, produz o RNA mensageiro, que conduz os códons para a síntese daproteína nos ribossomos.c) As proteínas podem ser diferenciadas pelo número, tipos e seqüências de seus aminoácidos.2. a)Proteína normal:Val - Leu - Tre - Pro - Tir - Val - LisIndivíduo A: Val - Leu - Tre - ProIndivíduo B: Val - Leu - Tre - Pro - Tir - Val - LisIndivíduo C: Val - Met - Tre - Pro - Tir - Val - Lisb)A é afetado porque produz uma proteína menor.B é normal, apesar da substituição de uma base nitrogenada no seu DNA, porque o código genético édegenerado.C é afetado porque possui um aminoácido diferente em sua proteína.3. a) Produto da síntese protéica (polipeptídio):val - his - leu - thr - pro - glu - glu - lysb) Exemplo de mutação pontual no gene que codifica a cadeia da globina humana: substituição do nucleotídeoA por T no códon correspondente ao ácido glutâmico.Conseqüência: anemia falciforme- alteração estrutural do polipeptídio (substituição do ácido glutâmico pela valina);- alteração da função da proteína (globina);- redução da capacidade de transporte de oxigênio;- manifestação dos sintomas da anemia falciforme.4. Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por trêsnucleotídeos. Logo, o gene que codifica uma proteína tem sempre maior número de nucleotídeos que deaminoácidos. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação enão são transcritos.5. Porque o código genético é degenerado, isto é, para um mesmo aminoácido existem vários códonsdiferentes.6. a) As proteínas produzidas pelos extraterrestres em questão, poderiam ter, no máximo, 16 tipos diferentes deaminoácidos. Seu código genético, formado por pares de bases, permite a formação de apenas 16 códonsdiferentes. Isso sem considerar a possibilidade da existência de um, ou mais, códons de finalização. Nestecaso, não seria possível a produção das proteínas B e C com, respectivamente, 16 e 19 aminoácidos.b) A diversidade no planeta Terra seria maior, pois o código genético dos terráqueos é formado por 64 códons,sendo 3 códons de finalização. Assim o número de tipos distintos de aminoácidos presentes nos polipeptídeosseria, obviamente, maior.c) A proteína produzida pela bactéria terrestre "transgênica" não será idêntica ao polipeptídeo alienígena, umavez que o equipamento ribossômico da bactéria que incorporou o gene, está capacitado para traduzir códonsconstituídos por 3 bases nitrogenadas consecutivas.7. a) RNAm: UCC GUU AAU UCC GGC AAGb) O códon mutado, TTA, especificaria o terceiro aminoácido da tabela.
  14. 14. c) UUA8. a) RNA-polimerase.b) UAC.c) W - A - T - S - O - N - E - C - R - I - C - K.d) A proteína não será formada, pois foi alterado o códon de iniciação.9. Treonina - Arginina - Leucina10. a) 3TACGCA5.b) 5AUGCGU3. O RNA que será utilizado na tradução é o RNAm (RNA mensageiro).11. A mutação deve ter alterado um códon que codificava um aminoácido transformando-o em um códon deparada, que interrompe a leitura do ARNm pelo ribossoma.12. [C]13. [B]14. [C]15. [B]16. [C]17. [A]18. [D]19. [C]20. [D]21. [D]22. [A]23. [C]24. [D]25. [A]26. [D]27. [C]28. [C]29. [A]30. [A]31. [E]32. [C]33. [E]34. [C]35. [E]36. [A]37. [A]38. [A]39. [B]40. [A]
